Application of GmGID1-2 gene in regulating soybean plant type, nitrogen use efficiency and high yield and high oil

Abstract

The application discloses application of a soybean GmGID1-2 gene in regulation of soybean plant type, nitrogen utilization efficiency and high yield and high oil. The application of the GmGID1-2 gene in soybean variety improvement, the GmGID1-2 gene CDS sequence is shown as SEQ ID NO. 1, and knocking out the GmGID1-2 gene can improve the plant type (reduce plant height, increase branch number, main stem node number and pod number), improve stem diameter and stem strength, enhance nodule nitrogen fixation, and improve yield and seed oil content. The application digs out a one-factor-multiple-effect gene GmGID1-2, generates two new mutations of the GmGID1-2 through a gene editing technology, and causes protein early termination. Knocking out the GmGID1-2 gene simultaneously realizes improvement of multiple traits, and has great application potential and market prospect in improvement of plant type and stem strength of crops and plants such as soybean, realization of high yield and high oil, nitrogen efficiency and the like.

Description

Technical Field

[0001] This invention belongs to the field of agricultural genetic engineering and relates to the application of the soybean GmGID1-2 gene in regulating plant architecture, nitrogen use efficiency and high yield and high oil content in crops and plants such as soybean. Background Technology

[0002] Plant height is one of the important agronomic traits for improving agricultural production. Rice and wheat, in particular, have achieved a great green revolution by reducing plant height, improving lodging resistance, and increasing planting density (Khush, 1999; Peng et al., 1999; Evenson and Gollin, 2003). Soybeans, originating in China, are an important global food crop and a major source of oilseeds. However, compared to major global food crops such as rice, wheat, and corn, soybean yields are significantly lower. While rice, wheat, and corn can easily exceed 1000 jin per mu (approximately 667 catties per hectare), soybeans yield less than half that. Semi-dwarf plants have been produced in rice and wheat through mutants such as sd1 (Spielmeyeret et al., 2002) and Rht1 (Gale et al., 1985), which promote increased tillering and yield under high-fertilizer, high-density planting conditions. As a legume, soybeans differ from rice and wheat in that their pods are produced at the top of the single spike. They require a sufficient number of nodes and branches to ensure a certain number of pods and grains. Therefore, improving soybean plant architecture, besides appropriately reducing plant height and increasing lodging resistance, significantly impacts yield by increasing the number of nodes on the main stem, branches, pods per plant, and grains per pod. While the Green Revolution has led to substantial yield increases in crops like rice and wheat, semi-dwarf genes have inhibited the plant's efficiency in utilizing inorganic nitrogen fertilizers. Therefore, in recent years, achieving green and sustainable agricultural development with low input and high output has become central to modern agricultural development. As a representative crop of symbiotic nitrogen fixation between legumes and rhizobia, soybean biological nitrogen fixation can reduce the application of chemical fertilizers, contributing to the sustainable development of green agriculture. Summary of the Invention

[0003] The purpose of this invention is to address the aforementioned shortcomings of existing technologies by providing the application of the soybean GmGID1-2 gene in regulating soybean plant architecture, nitrogen use efficiency, and achieving high yield and high oil content.

[0004] Another objective of this invention is to provide a mutated GmGID1-2 gene and its applications.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] The application of the GmGID1-2 gene in soybean variety improvement: The CDS sequence of the GmGID1-2 gene is shown in SEQ ID NO.1. Knocking out the GmGID1-2 gene can improve plant architecture, increase stem strength, enhance nitrogen fixation in root nodules, and increase yield and seed oil content.

[0007] As a preferred embodiment of the present invention, the improved plant type includes reducing soybean plant height, increasing stem strength, and significantly increasing the number of branches, main stem nodes, pods, and seeds of soybean.

[0008] As a further preferred embodiment of the present invention, the number of pods is the number of pods per plant and / or the maximum number of pods in a single plant.

[0009] As a further preferred embodiment of the present invention, the number of grains is the number of grains per plant and / or the number of grains per pod.

[0010] As a preferred embodiment of the present invention, the method for knocking out the GmGID1-2 gene is gene editing technology or gene silencing VIGS technology.

[0011] As a further preferred embodiment of the present invention, the sgRNA used to knock out the GmGID1-2 gene using gene editing technology is selected from sgRNA-1 or sgRNA-2, wherein the positive strand of sgRNA-1 is shown as SEQ ID NO.3 or SEQ ID NO.4, and the positive strand of sgRNA-2 is shown as SEQ ID NO.7 or SEQ ID NO.8.

[0012] The gene editing system for the GmGID1-2 gene has been applied to improve plant architecture, increase stem strength, enhance nitrogen fixation in root nodules, and increase yield and seed oil content.

[0013] As a preferred embodiment of the present invention, the gene editing system of the GmGID1-2 gene is used to reduce soybean plant height, increase stem strength, significantly increase the number of branches, main stem nodes, pods, seeds, and single-plant seed weight, improve soybean yield and seed oil content, and at the same time promote soybean root growth and soybean root nodule symbiosis and improve biological nitrogen fixation capacity.

[0014] As a further preferred embodiment of the present invention, the number of pods is the number of pods per plant and / or the maximum number of pods in a single plant.

[0015] As a further preferred embodiment of the present invention, the number of grains is the number of grains per plant and / or the number of grains per pod.

[0016] As a preferred embodiment of the present invention, the gene editing system contains sgRNA of the GmGID1-2 gene, wherein the sgRNA is selected from sgRNA-1 or sgRNA-2, wherein the positive strand of sgRNA-1 is shown as SEQ ID NO.3 or SEQ ID NO.4, and the positive strand of sgRNA-2 is shown as SEQ ID NO.7 or SEQ ID NO.8.

[0017] The mutated GmGID1-2 gene, CDS sequence is shown in SEQ ID NO.5 or SEQ ID NO.9.

[0018] The application of the mutated GmGID1-2 gene described in this invention in soybean variety improvement: The mutated GmGID1-2 gene sequence causes premature termination of the translation of the protein encoded by this gene in soybean, resulting in a shorter protein sequence. The mutated GmGID1-2 gene can improve plant architecture, stem strength, nitrogen use efficiency, root nodule nitrogen fixation, and increase yield and seed oil content. It is preferably used to reduce soybean plant height, increase stem strength, significantly increase the number of branches, main stem nodes, pods, seeds, and single-plant seed weight, thereby increasing soybean yield and seed oil content. At the same time, it promotes soybean root growth and soybean root nodule symbiosis, and improves biological nitrogen fixation capacity.

[0019] Beneficial effects:

[0020] This invention uncovered a pleiotropic gene, GmGID1-2, and used gene editing technology to generate two new mutations in GmGID1-2, causing premature protein termination. Knocking out the GmGID1-2 gene simultaneously improves several traits:

[0021] (1) Knocking out the GmGID1-2 gene improves plant architecture, reduces soybean plant height, and significantly increases stem diameter. Figure 5 Significantly improves soybean stem strength in the field. Figure 6 Increase the number of soybean branches, main stem nodes, number of pods per plant (including three- and four-pod pods), number of seeds per plant, and number of seeds per pod. Figure 7 ), Maximum number of pods ( Figure 8 These are all important factors in increasing soybean yield.

[0022] (2) Knocking out the GmGID1-2 gene increases soybean grain weight and yield per plant and increases soybean seed oil content.

[0023] Gene editing of GmGID1-2 revealed that knocking out this gene increased soybean grain weight and yield per plant. Figure 9 Increase the oil content of soybean seeds. Figure 10 ).

[0024] (3) Knocking out the GmGID1-2 gene promotes soybean root growth and root nodule symbiosis and enhances soybean biological nitrogen fixation capacity.

[0025] Gene editing of GmGID1-2 revealed that knocking out this gene significantly promoted soybean root growth, such as root fresh weight, root dry weight, and root nodule symbiosis, such as nodule number and nodule dry weight. Figure 11 It significantly improves the biological nitrogen fixation capacity of soybeans, including nitrogenase activity, urea content, and nitrogen content. Figure 12 ).

[0026] (4) Overexpression of the GmGID1-2 gene enhances the absorption of inorganic nitrogen fertilizer in soybeans.

[0027] Overexpression of the GmGID1-2 gene can significantly increase the rate of inorganic nitrogen fertilizer uptake by soybean plants under both low-nitrogen and high-nitrogen environments. Figure 13 ).

[0028] Furthermore, similar modifications to this gene, its homologs, or genes related to the gibberellin signaling pathway, especially knockout materials created through gene editing of GmGID1-2, are of significant value in improving crop and plant architecture, increasing yield, seed oil content, and biological nitrogen fixation, such as soybean. Theoretically, achieving the same results as this invention can be obtained by using gene editing technology or other techniques (e.g., gene silencing: VIGS, etc.) to edit other sites of the GmGID1-2 gene to produce knockouts or silences, thus achieving loss of function. Attached Figure Description

[0029] Figure 1 .pCAMBIA3301 vector map

[0030] Figure 2 Editing sites and editing status of the GmGID1-2 gene in GmGID1-2 knockout lines

[0031] Figure 3 Validation of GmGID1-2 overexpression transgenic lines: Transgenic lines overexpressing the GmGID1-2 gene were obtained using the GaMV35S strong promoter. Data are presented as mean ± SE, n = 3. Statistical analysis was performed using the two-tailed Student's t-test; **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0032] Figure 4 Obtaining GmGID1-2 gene-edited soybean lines (A) Editing the GmGID1-2 gene produces two knockout lines GmGID1-2 KO-1 (+1bp) and GmGID1-2 KO-2(-11bp), the recipient material is Williams 82, and the figure shows the sequencing results of the new mutant gene generated after editing GmGID1-2; (B)GmGID1-2 KO The mutation site, GmGID1-2 KO The mutation sites are highlighted in red; (C) Control materials Williams 82 and gene-edited line GmGID1-2 KO-1 GmGID1-2 KO-2 Protein three-dimensional structure prediction ( https: / / swissmodel.expasy.org ) and the position of the termination sub-sub.

[0033] Figure 5 Knocking out the GmGID1-2 gene reduces soybean plant height and increases stem diameter; overexpression of the GmGID1-2 gene increases soybean plant height and decreases stem diameter. (A) Williams 82, GmGID1-2 OE and GmGID1-2 KO The morphology of the strain at the first and third compound leaves, scale bar is 5cm; (BC) Williams 82, GmGID1-2 OE and GmGID1-2 KO Plant height (B) and stem diameter (C) of the strains are expressed as mean ± SE (n = 3). Statistical significance was determined using one-way ANOVA and Duncan's multiple test at an α level of 0.05.

[0034] Figure 6 Knocking out the GmGID1-2 gene increased soybean stem strength (AB). Soybean stem strength (A) and stem strength (B) were measured in field samples from Hefei (summer 2023). Scale bar is 1 cm. Data are presented as mean ± SE (n = 18). Statistical significance was determined using a two-tailed Student's-st-test. ****P < 0.0001.

[0035] Figure 7 Knocking out the GmGID1-2 gene increases the number of soybean branches, main stem nodes, number of pods per plant (including three- and four-pod pods), number of seeds per plant, and number of seeds per pod. (A) Williams 82 and GmGID1-2 KO Morphology of the strains at maturity, scale bar 10cm; (BG) Williams 82 and GmGID1-2 KOThe plant type and yield-related traits of the strains were compared, including the number of branches (B), the number of nodes on the main stem (C), the number of seeds per plant (D), the number of pods per plant (E), the average number of seeds per pod (F), and the number of single, two-, three-, and four-pod pods per plant (G). Data are presented as mean ± SE, n = 18. Statistical significance was analyzed using the two-tailed Student's t-test; NS indicates no significance, ***P < 0.001, ****P < 0.0001.

[0036] Figure 8 Knocking out the GmGID1-2 gene increased the maximum number of pods per plant (AB) in soybean. Phenotype (A) and maximum number of pods per plant (B) were measured in Hefei (summer 2023). Scale bar is 2 cm. n = 18. Yellow arrows indicate the maximum number of pods per plant. Data are mean ± SE (n = 18), and statistical significance was determined using a two-tailed Student's t-test. ***P < 0.001, ****P < 0.0001.

[0037] Figure 9 Knocking out the GmGID1-2 gene increased soybean grain weight per plant and field plot yield. (A) Soybean grain weight per plant in Hefei summer 2023, data are mean ± SE, n = 18; (B) Soybean plot yield in Hefei summer 2023, data are mean ± SE, n = 3. Statistical significance was determined using a two-tailed Student's t-test. *P < 0.05, ****P < 0.0001.

[0038] Figure 10 Knocking out the GmGID1-2 gene increases the oil content of soybean seeds.

[0039] Oil content of soybean seeds in Hefei field. Data are mean ± SE (n=18). Statistical significance was determined using the two-tailed Student's-test. ***P<0.001.

[0040] Figure 11 Knockout of the GmGID1-2 gene promotes soybean root growth and nodule symbiosis. (A) Root phenotype (scale bar: 5 cm) and nodule phenotype (scale bar: 0.5 cm) 28 days after inoculation with rhizobia. (BE) Root fresh weight (B), root dry weight (C), nodule number (D), and nodule dry weight (E). Data are presented as mean ± SE, n = 4. Statistical significance was determined using one-way ANOVA and Duncan's multiple test at an α level of 0.05.

[0041] Figure 12 Knocking out the GmGID1-2 gene enhances the biological nitrogen fixation capacity of soybean.

[0042] Statistical analysis was performed on urea content (A), nitrogenase activity (B), and nitrogen content (C). Data are presented as mean ± SE (n = 4). Statistical significance was determined using one-way ANOVA and Duncan's multiple test at an α level of 0.05.

[0043] Figure 13 Overexpression of the GmGID1-2 gene enhances the absorption of inorganic nitrogen fertilizer in soybeans.

[0044] Statistical analysis at 0.125 mM and 1.25 mM 15 NO3- under conditions 15 N-NO3 - Absorption rate. Data are mean ± SE (n=3). Statistical significance was determined using a two-tailed Student's t-test. *P<0.05, **P<0.01. Detailed Implementation

[0045] Terminology Explanation:

[0046] GmGID1-2: GID1 is an abbreviation for Gibberellin Insensitive Dwarf1, and GmGID1-2 is one of the soybean GID1 family members in this patent application.

[0047] Gene: A gene is the complete sequence of nucleotides required to produce a polypeptide chain or functional RNA.

[0048] Promoter: A promoter is a DNA sequence that RNA polymerase recognizes, binds to, and initiates transcription of. Most promoters are located upstream of the 5' end of structural genes.

[0049] Overexpression: also known as over-expression, refers to the expression (transcription) of a gene being higher than the normal level, resulting in the production of large amounts of mRNA and corresponding protein products.

[0050] Gene editing refers to the process of modifying specific targets in an organism's genome using technologies such as CRISPR-Cas9. It efficiently and precisely inserts, deletes, or replaces genes, thereby altering their genetic information and phenotypic characteristics.

[0051] sgRNA: short for small guide RNA. It is part of the CRISPR-Cas9 system and is used to specifically identify the sequence of a target gene. It is usually 20 bp (excluding the adapter).

[0052] NCBI: Short for National Center for Biotechnology Information

[0053] PCR: Short for Polymerase Chain Reaction

[0054] Example 1: Vector Construction

[0055] 1. Construction of overexpression vectors

[0056] In this experiment, the overexpression vector pCAMBIA3301 was used for stable transformation of soybeans. Figure 1 The promoter is derived from the pBA002 vector and is initiated by the cauliflower mosaic virus promoter GaMV35S; it contains GUS (b-glucuroidase) and Bar reporter genes.

[0057] (1) First, select appropriate double restriction sites (Asc I and Pac I), and design the one-step cloning primers for the GmGID1-2 gene using software (CEDesign V1.03) as follows:

[0058] F: tctagaggatctcgaggcgcgccATGGCTGGCAGCAACCAA

[0059] R: attcgagctcactagttaattaaTTAACAGTCAGAATCAGAATTGACAAAG

[0060] The target sequence was amplified by PCR, and the PCR amplification products were purified and recovered using a purification kit (Takara, Japan) to obtain the purified product of the target insertion sequence.

[0061] (2) Next, the *E. coli* containing the pCAMBIA3301 vector plasmid was propagated in LB medium resistant to Kanamycin. The pCAMBIA3301 vector plasmid was then obtained using a plasmid extraction kit (Axygen, China). The vector plasmid was double-digested with restriction endonucleases (New England Biolabs, NEB), and the digested plasmid was purified and recovered to obtain a linearized vector. The double-digestion system is as follows:

[0062]

[0063] (The enzyme digestion system was reacted at 37℃ for 30 min)

[0064] (3) Finally, the target sequence was recombinated with the linearized vector using a homologous recombinase (Vazyme, China). The system is as follows:

[0065]

[0066] (The recombinant system was reacted at 37°C for 30 min)

[0067] The recombinant plasmid was transformed into Agrobacterium tumefaciens EHA105 for stable transformation of soybean (method described below).

[0068] 2. Construction of gene editing vectors

[0069] This embodiment utilizes the CRISPR-Cas9 system with Bas1 as the restriction enzyme site. The sgRNA is recombined into the pGES201 vector using T4 ligase. Figure 2 Gene editing vectors were constructed. The vector construction method is as follows:

[0070] (1) Design of sgRNA:

[0071] use( http: / / cbi.hzau.edu.cn / CRISPR2 / The website designed the CDS for the GmGID1-2 gene, added restriction enzyme sites and adapters, and synthesized it.

[0072] Positive oligonucleotide F: sgRNA-1:5'-GGATTG TGGTGTCTGTGAACTACCGG -3'(SEQ ID NO.3)

[0073] Antisense oligonucleotide R: sgRNA-1: 5'-AAACCCGGTAGTTCACAGACACCACA-3' (SEQ ID NO.4)

[0074] Positive oligonucleotide F: sgRNA-2:5'-GGATT GGCGGTCACCGGAGCATCGG -3'(SEQ ID NO.7)

[0075] Antisense oligonucleotide R: sgRNA-2: 5'-AAACCCGATGCTCCGGTGACCGCCCA-3' (SEQ ID NO.8)

[0076] (2) Oligonucleotides anneal to form double strands:

[0077] 5 μl of positive oligonucleotide (F primer 10 μM)

[0078] Antisense oligonucleotide (Rprimer 10μM) 5μl

[0079] NaCl (final concentration 100mM)

[0080] Tris-Cl pH 7.4 (final concentration 50mM)

[0081] Add water to make up to 50μl

[0082] 95℃ for 4 minutes

[0083] Gradient cooling ramp (RAMP) 0.1℃ / s (95℃ to 16℃)

[0084] Keep at 16℃

[0085] (3) Linearized carrier:

[0086] Digest 1 μg of pGES201 vector (resistant Kana) with BsaI enzyme.

[0087] (4) Connection conversion

[0088] Annealed double-stranded oligo 1μl

[0089] Linearization vector (50-100 ng / μl) 3 μl

[0090] 10x T4 buffer 1μl

[0091] T4 ligase 0.5μl

[0092] Add ddH2O to 10 μL (connect the reaction for 2 hours or overnight).

[0093] The constructed recombinant plasmids were transformed into Agrobacterium K599 for cotyledon root development identification. Recombinant plasmids showing editing effects were then transformed into Agrobacterium EHA105 for stable transformation of the soybean variety Williams 82. The method is as follows:

[0094] The EHA105 bacterial culture carrying the sgRNA vector was streaked in YEB culture dishes containing Rif and Kana resistance. After 2 days, a single colony was picked and activated in 3 ml of YEB containing Rif and Kana resistance. The activated bacterial culture was then multiplied at a ratio of 1 / 1000. The bacteria were collected for soybean explant infection.

[0095] Select plump and vigorous soybean seeds, and wipe the seed coat surface with defatted gauze in 75% ethanol to remove dust. After sterilizing the selected seeds with chlorine, soak the soybean seeds in sterile water for 16-24 hours. In a clean bench, use a scalpel and forceps to divide the soybean seed in half along the hypocotyl to obtain two explants.

[0096] Explants were placed in a resuspended infection solution for 30 min, and then cultured in co-culture solid medium (CCM) for 5 days (16 h / 8 h, 24 ℃ / 22 ℃). Afterward, they were transferred to shoot induction solid medium (SIM) for 14 days (16 h / 8 h, 24 ℃ / 22 ℃), requiring two culture phases. Then, they were transferred to shoot elongation solid medium (SEM) for 14 days (16 h / 8 h, 24 ℃ / 22 ℃), requiring four culture phases. The elongated seedlings were identified. Positive T0 plants were transferred to rooting medium (GM) for rooting, then transplanted and acclimatized to obtain overexpressing positive plants, which were then homozygous for subsequent related experiments.

[0097] Soybean stable conversion medium formulation:

[0098]

[0099]

[0100] 3. Obtaining GmGID1-2 overexpression transgenic lines

[0101] In the context of the soybean variety Williams 82, three transgenic lines overexpressing the GmGID1-2 gene were obtained using the pCAMBIA3301 overexpression vector, and named GmGID1-2, respectively. OE-1 GmGID1-2 OE-2 and GmGID1-2 OE-3 Compared to Williams 82, the overexpression upregulation folds were 106, 125, and 153, respectively. Figure 3 ).

[0102] 4. Obtaining GmGID1-2 gene-edited soybean lines

[0103] In the context of the soybean variety Williams 82, the GmGID1-2 gene was edited using CRISPR-Cas9 technology to generate insertion or deletion mutations (InDel) in the GmGID1-2 gene, resulting in two new mutant genes of GmGID1-2. The mutant genes have an insertion of 1 bp (+1 bp corresponds to the mutant gene sequence shown in SEQ ID NO. 5, and the encoded protein amino acid sequence is shown in SEQ ID NO. 6) and a deletion of 11 bp (-11 bp, the corresponding mutant gene sequence is shown in SEQ ID NO. 9, and the encoded protein amino acid sequence is shown in SEQ ID NO. 10), respectively, causing premature termination of GmGID1-2 translation. Two corresponding GmGID1-2 gene knockout lines were obtained and named GmGID1-2. KO-1 and GmGID1-2 KO-2 ( Figure 4 ).

[0104] Example 2

[0105] The following examines the relevant biological functions of the mutant strains and overexpression lines constructed in Example 1.

[0106] 1. Knocking out the GmGID1-2 gene reduces soybean plant height and increases stem diameter.

[0107] Identification of transgenic lines revealed that overexpression of the GmGID1-2 gene significantly promoted soybean plant elongation and significantly reduced stem diameter, while knockout of the GmGID1-2 gene significantly reduced soybean plant height and significantly increased stem diameter. Figure 5 ).

[0108] 2. Knocking out the GmGID1-2 gene increases soybean stem strength.

[0109] Analysis of soybeans planted in field plots during the summer of 2023 revealed GmGID1-2. KO The stem strength of the strain was significantly higher than that of Williams 82 in the field. Figure 6 ).

[0110] 3. Knocking out the GmGID1-2 gene increases the number of soybean branches, main stem nodes, number of pods per plant (including three- and four-pod pods), number of seeds per plant, and number of seeds per pod.

[0111] A field trial conducted in the summer of 2023 statistically analyzed the number of soybean branches, main stem nodes, pods, and seeds, and found that GmGID1-2 KO The number of branches, main stem nodes, number of pods per plant, number of seeds per plant, number of seeds per pod, number of three-seeded pods, and number of four-seeded pods in the strain were all significantly higher than those in the control Williams 82. Figure 7 ).

[0112] 4. Knocking out the GmGID1-2 gene increases the maximum number of pods in soybeans.

[0113] Analysis of soybeans planted in the field during the summer of 2023 revealed GmGID1-2 KO The strains had more pods at the soybean internodes. Statistical analysis of the maximum number of pods per plant revealed that GmGID1-2 KO The maximum number of pods in the strain was significantly higher than that in Williams82. Figure 8 ).

[0114] 5. Knocking out the GmGID1-2 gene increases soybean grain weight per plant and yield in field plots.

[0115] Analysis of soybeans planted in field plots during the summer of 2023 revealed GmGID1-2 KOThe single-plant grain weight and field plot yield of this line were significantly higher than those of Williams 82. Figure 9 ).

[0116] 6. Knocking out the GmGID1-2 gene increases the oil content of soybean seeds.

[0117] Using a near-infrared whole grain analyzer (Foss, A study conducted in Denmark on the oil content of mature soybean seeds harvested in the summer of 2023 revealed that GmGID1-2... KO The oil content of soybean seeds in this strain was significantly higher than that in the control Williams82. Figure 10 ).

[0118] 7. Knocking out the GmGID1-2 gene promotes soybean root growth and nodule symbiosis.

[0119] Soybeans are a typical example of biological nitrogen fixation, therefore we studied GmGID1-2. KO Analysis of the strain's biological nitrogen fixation revealed that 28 days after inoculation with rhizobium (USDA110), GmGID1-2 was observed. KO The root system (dry and fresh weight), number of root nodules, and dry weight of root nodules of the strain increased significantly. Figure 11 ).

[0120] 8. Knocking out the GmGID1-2 gene enhances the biological nitrogen fixation capacity of soybean.

[0121] Meanwhile, for GmGID1-2 KO We detected GmGID1-2 in the biological nitrogen fixation of the strain. KO The acylurea content, nitrogenase activity, and nitrogen content of the strain were all significantly higher than those of Williams 82. Figure 12 This indicates that GmGID1-2 KO The strain has a higher biological nitrogen fixation capacity.

[0122] 9. Overexpression of the GmGID1-2 gene enhances inorganic nitrogen fertilizer absorption in soybeans.

[0123] Overexpression of the GmGID1-2 gene via the 35S promoter revealed that enhanced function significantly increased the rate of inorganic nitrogen fertilizer uptake by soybean plants under both low-nitrogen and high-nitrogen conditions. Figure 13 ).

Claims

1. GmGID1-2 The application of genes in soybean variety improvement is characterized by, GmGID1-2 The gene CDS sequence is shown in SEQ ID NO.

1. Knockout GmGID1-2 Genes can simultaneously improve plant architecture, increase stem strength, enhance nitrogen fixation in root nodules, and increase yield and seed oil content; overexpression GmGID1-2 The gene significantly improves the absorption of inorganic nitrogen fertilizer by soybeans; the improved plant type includes a significant increase in the number of branches, main stem nodes, pods, and seeds of soybeans.

2. The application according to claim 1, characterized in that, The number of pods mentioned refers to the number of pods per plant and / or the maximum number of pods in a single cluster on a single plant.

3. The application according to claim 1, characterized in that, The number of grains mentioned refers to the number of grains per plant and / or the number of grains per pod.

4. The application according to claim 1, characterized in that, Knockout GmGID1-2 The gene-based methods include gene editing technology or gene silencing VIGS technology.

5. The application according to claim 4, characterized in that, Knockout using gene editing technology GmGID1-2 The sgRNA used in the gene is selected from sgRNA-1 or sgRNA-2, wherein the positive strand of sgRNA-1 is shown in SEQ ID NO.3 or SEQ ID NO.4, and the positive strand of sgRNA-2 is shown in SEQ ID NO.7 or SEQ ID NO.

8.

6. GmGID1-2 The gene editing system simultaneously increases stem strength, significantly increases the number of branches, main stem nodes, pods, seeds, and single-plant seed weight in soybeans, improves soybean yield and seed oil content, promotes soybean root growth and root nodule symbiosis, and enhances biological nitrogen fixation capacity; the gene editing system contains... GmGID1-2 The sgRNA of the gene is selected from sgRNA-1 or sgRNA-2, wherein the positive strand of sgRNA-1 is shown as SEQ ID NO.3 or SEQ ID NO.4, and the positive strand of sgRNA-2 is shown as SEQ ID NO.7 or SEQ ID NO.

8.

7. Mutant GmGID1-2 The application of genes in soybean variety improvement is characterized by, Mutant GmGID1-2 The gene sequence caused premature termination of translation of the protein encoded by this gene in soybeans, resulting in a shorter protein sequence and a mutation. GmGID1-2 The gene can simultaneously improve plant architecture, increase stem strength, enhance root nodule nitrogen fixation, and increase yield and seed oil content. The aforementioned mutation... GmGID1-2 The gene CDS sequence is shown in SEQ ID NO.5 or SEQ ID NO.

9. The improved plant type includes a significant increase in the number of branches, main stem nodes, pods, and seeds of soybean.

Images