Application of rice adhesion protein core factor OsSCC3 in regulation and control of rice fertility

Abstract

The invention discloses an application of a rice adhesion protein core factor OsSCC3 in regulation and control of rice fertility, an adhesion protein core subunit Osscc3 mutant capable of stably surviving is successfully prepared in rice through a CRISPR-Cas9 technology, the Osscc3 mutant shows abnormal phenomena that a plant is short and small, the crossing number in meiosis is sharply reduced, sister staining monomers are separated in advance and the like, and the rice adhesion protein core subunit Osscc3 mutant can be used for regulating and controlling rice fertility. Finally, pollen abortion is caused, and plants cannot bear fruits.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant genetic engineering, and relates to a rice fertility control gene SCC3 , and particularly relates to application of a rice cohesin core factor OsSCC3 in regulating rice fertility. BACKGROUND

[0002] Rice is one of the most important food crops in the world, and nearly half of the world's population relies on rice as their main food, especially in China, rice is the first food crop. Therefore, improving rice yield is a key problem in China's agricultural production. The production of hybrid rice is crucial to improving rice yield. Three-line hybrid rice is composed of three parts, i.e., a male sterile line, a maintainer line and a restorer line. The male sterile line is a pollen-degrading female rice, which cannot self-pollinate and can only be pollinated by external pollination to bear fruit. With the help of the male sterile line, combined with artificial pollination method, hybrid rice seeds can be produced on a large scale. Therefore, the male sterile line is the basis and key for the utilization of hybrid rice advantage. However, male sterile plants are rare in nature and difficult to identify, therefore, using genetic engineering technology to produce male sterile rice has become a major issue in rice breeding.

[0003] Meiosis is a key process for forming gametes, which can ensure the stability of material genetic material and promote the formation of genetic diversity. In recent years, scientists have found multiple genes related to meiosis through research on model organisms such as yeast, and these genes are functionally conserved in animals and plants. CRISPR-Cas9 gene editing technology provides a convenient and efficient means for targeted modification of these genes. By precisely regulating the expression of related genes, pollen abortion can be promoted using this technology.

[0004] Cohesin is a conserved protein complex in eukaryotes, which is involved in maintaining the ordered distribution of sister chromatids. The complex is composed of four conserved subunits, which are Structural maintenance of chromosomes (SMC1 / 3) and Sister chromatid cohesin (SCC1 / 3). The four subunits interact with each other to form a cohesin complex, and the absence of any subunit will cause the death of the organism.

[0005] At present, there is no report on the research of cohesin core subunit Oscc3 gene in rice breeding. SUMMARY

[0006] The present application aims at the technical problems to be solved, overcomes the deficiencies of the prior art and provides an application of a rice adhesion protein core factor OsSCC3 in regulating rice fertility.

[0007] The present application successfully prepares a stably surviving adhesion protein core subunit in rice by CRISPR-Cas9 technology Osscc3 mutant. By combining genetic and cell biology methods, it is found that OsSCC3 the gene plays an important role in the process of meiosis of rice, and has a significant influence on the process of homologous chromosome pairing and synapsis, and can affect the fertility of rice pollen. Osscc3 The mutant shows abnormal phenomena such as dwarf plants, a sharp decrease in the number of crossovers in meiosis, and early separation of sister chromatids, which ultimately leads to pollen abortion and the plant cannot bear fruit. This finding provides a theoretical basis and practical path for artificial control of rice pollen fertility.

[0008] One of the purposes of the present application is to provide a rice SCC3 gene mutant, which has the function of regulating rice fertility, and the mutant is obtained by inserting a single base T between the 2929th and 2930th bases in the coding region of SCC3 gene ( LOC_Os05g09620 ).

[0009] The further optimized technical solutions of the present application are as follows: The gene encoding the above-mentioned rice SCC3 gene mutant has a nucleotide sequence as shown in SEQ ID NO. 3.

[0010] The second purpose of the present application is to provide a recombinant plasmid comprising the gene of the above-mentioned rice SCC3 mutant.

[0011] The third purpose of the present application is to provide a host cell comprising the above-mentioned recombinant plasmid.

[0012] The fourth purpose of the present application is to provide an application of the rice SCC3 gene mutant in cultivating a rice male sterile line.

[0013] In the above-mentioned application, the CRISPR-Cas9 technology is used to perform site-directed mutagenesis on the rice SCC3 gene ( LOC_Os05g09620 ), so that the expression of the protein encoded by the gene is blocked, the process of meiosis of rice is abnormal, and the phenotype of rice shows pollen sterility and dwarf plants.

[0014] The fifth purpose of the present application is to provide a preparation method of transgenic rice, comprising: SCC3The gene is mutated as claimed in claim 1, a single base T is inserted between the 2929th base and the 2930th base in the N-terminal domain of the SCC3 protein, causing a frame shift mutation; the meiosis process of the mutant is defective, ultimately leading to pollen sterility, and transgenic rice is obtained.

[0015] The present application mutates the adhesion protein related male sterility gene in rice by CRISPR-Cas9 technology, prepares a mutant that can survive stably, determines that the gene is a functional gene involved in meiotic homologous recombination, and systematically describes how it regulates the meiosis process. By knocking out the gene, male sterile lines can be produced for rice hybrid breeding. Therefore, the present application provides important gene resources for the field of rice breeding. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 The gene structure diagram and mutation site diagram in the present application OsSCC3 .

[0017] Figure 2 The mutant phenotype analysis diagram in the present application Osscc3 .

[0018] Figure 3 The multiple sequence alignment diagram of OsSCC3 homologous proteins in the present application

[0019] Figure 4 The evolutionary relationship diagram of OsSCC3 and its homologous proteins in eukaryotes in the present application

[0020] Figure 5 The expression pattern diagram of the gene in the present application OsSCC3 .

[0021] Figure 6 The root tip cell chromosome behavior diagram in the present application Osscc3 .

[0022] Figure 7 The pollen mother cell chromosome behavior diagram in the present application Osscc3 .

[0023] Figure 8 The positioning situation diagram of the central element of the synaptonemal complex in the pollen mother cell in the present application Osscc3 .

[0024] Figure 9 The positioning situation diagram of the recombination protein in the pollen mother cell in the present application Osscc3 . DETAILED DESCRIPTION

[0025] The technical solution of the present invention will be further described in detail below with reference to the embodiments: This embodiment is implemented under the premise of the technical solution of the present invention, and provides detailed implementation methods and specific operation processes, but the protection scope of the present invention is not limited to the following embodiments.

[0026] The materials and reagents mentioned in this invention are available to the public through commercial channels both domestically and internationally, and will not be described in detail here.

[0027] Example 1 OsSCC3 Site-directed mutation of genes 1. OsSCC3 Obtaining and validating CRISPR-Cas9 site-directed mutants To obtain mutants of the adhesion protein-associated subunits that can survive stably, OsSCC3 Gene( LOC_ Os05g09620 CRISPR-Cas9 site-directed mutagenesis was performed. The pCAMBIA1300-cas9 binary vector was used as the transformation vector. [The text then abruptly shifts to a different topic:] Selecting... OsSCC3 The specific sequences “CCGCGGGAGGACCAC” (exon 2), “CATTAACCGAGCTTAC” (exon 11), and “TCCATCGTCAGATAT” (exon 19) were used as target sites. The intermediate vector SK-gRNA was digested with AarI (from Fermentas), and the target sequence, annealed to form a double strand, was then inserted. The intermediate vector containing the target sequence and the pCAMBIA1300-cas9 binary vector were then double-digested with KpnI and BamHI, respectively, and the DNA fragment excised from the intermediate vector was inserted into pCAMBIA1300-cas9. The recombinant expression vector was transformed into Agrobacterium EHA105 using electroporation, and then into mature embryo callus of wild-type Salt Rice 8. The callus tissue was induced into transgenic plants (T0) through tissue culture. The T0 generation produced first-generation seeds through self-pollination, and positive plants obtained through resistance selection were designated as the T1 generation. The mutant obtained by site-directed mutagenesis using the second exon-specific sequence "CCGCGGGAGGACCAC" as the target sequence is denoted as . OsSCC3-1 The mutant obtained by site-directed mutagenesis using the eleventh exon-specific sequence “CATTAACCGAGCTTAC” as the target sequence is denoted as OsSCC3-2 The mutant obtained by site-directed mutagenesis using the exon 19 specific sequence “TCCATCGTCAGATAT” as the target sequence is: OsSCC3-3 Finally, the transgenic lines were identified using primers SCC3-1-F / R, SCC3-2-F / R, and SCC3-3-F / R, respectively.

[0028] The primer sequences are as follows: Cas9-scc3-1-F: GGCAGCGGCCGCGGGA GGACCACT Cas9-scc3-1-R: AAACAGTGGTCCTCCCGCGGCCGC Cas9-scc3-2-F: GGCAATTAACCGA GCTTACTGACA Cas9-scc3-2-R: AAACTGTCAGTAAGCTCGGTTAAT Cas9-scc3-3-F: GGCAAACTTCCATCGTC AGATATA Cas9-scc3-3-R: AAACTATATCTGACGATGGAAGTT SCC3-1-F: GATGGACGAGACCCTAGCC SCC3-1-R: CAGTGCATCCCCAAGCACAA SCC3-2-F: TCATATTGGTCGAATGCTGC SCC3-2-R: ATCAACTTGCAGCAGCAAC SCC3-3-F: CTAACTAGGGATATGAGCGGTAT SCC3-3-R: CTACAAACGTAAAGTACGGGC It was found that identification and screening of T0 and T1 generation transgenic lines cannot isolate OsSCC3-1 and OsSCC3-2 homozygous mutants (n=128, of which 87 Osscc3-1 + / - and 41 wild type; n=116, of which 80 Osscc3-2 + / - and 36 wild type). In addition, the OsSCC3-1 + / - and OsSCC3-2 + / - were allelically crossed, and among the 78 F1 offspring obtained, 18 Osscc3-1 + / - and 26 Osscc3-2 + / - and 34 wild type. It can be speculated that OsSCC3, as a conserved structural protein, strong allelic mutation will cause embryonic lethality in offspring, so that homozygous mutants cannot be isolated. It is worth noting that although the strong allelic mutation is lethal, the knockout in the nineteenth exon OsSCC3Weak allelism can be used to identify homozygous individuals. Osscc3 The weak allelic mutant was named Osscc3 The mutation involves a single-base T insertion in the fourth-to-last exon, resulting in a frameshift mutation that causes premature termination of protein translation (see...). Figure 1 This mutation causes the SCC3 protein to lack the C-terminal 140 aa protein sequence. OsSCC3 Gene structure such as Figure 1 As shown, black rectangles represent exons, black lines represent introns, and gray rectangles represent non-coding regions. The area near mutation sites is indicated by an asterisk (—). The differences in the first 60 amino acid sequences between the wild-type (WT) and mutant (Osscc3) are as follows: WT:MDETLASLRRPKRGRPPRPR—EDHLAAEDFEEEGEDEEAEAAALARPQTKRKRAASAAAAA.

[0029] Osscc3 :MDETLASLRRPKRGRPPRPR--GPLGRRGLRGGGGG*GGRGGGARAAPDEAQARGQRRGRGR.

[0030] 2. Osscc3 Mutant phenotypic analysis right Osscc3 Phenotypic observations of the mutant during the seedling and vegetative growth stages revealed that, compared to the wild type, the mutant exhibited dwarfism during the seedling stage. During the vegetative growth stage, both plant height and ear length were significantly reduced compared to the wild type. Furthermore, the mutant failed to produce seeds during the reproductive growth stage (see...). Figure 2 The AC of the mutant was used to stain the pollen during the flowering period with I2-KI. It was found that the pollen in the mutant was not stained at all, indicating that the mutant pollen was sterile (see AC). Figure 2 (D). Figure 2 A is wild type and Osscc3 Seedling phenotype, B represents wild type and Osscc3 Plant type diagram, C represents wild type and Osscc3 The spikelet diagram, where D represents the wild type and Osscc3 Observation of I2-KI staining of pollen. Figure 2 The scale length is 50 µm.

[0031] 3. OsSCC3 protein sequence alignment and domain analysis By rapidly amplifying cDNA ends (RACE), we obtained... OsSCC3 The full-length cDNA of the gene is 3351 bp, and the gene contains 22 exons and 21 introns. OsSCC3It encodes a protein containing 1117 amino acids, which has a STAG domain at its N-terminus (see...). Figure 3 (A). Homologous proteins of OsSCC3 in other species were obtained from the NCBI website (https: / / www.ncbi.nlm.nih.gov / 0), revealing that SCC3 is relatively conserved in plants. Amino acid comparisons were performed on homologous proteins of OsSCC3 from maize, Arabidopsis thaliana, and Brachypodium distichum. The results showed that these proteins all contain a conserved STAG domain at the N-terminus (see A). Figure 3 (B). Figure 3 In the image, A represents the rice SCC3 protein domain, B represents the multiple sequence alignment of rice SCC3 with homologous proteins from maize, Arabidopsis thaliana, and Brachypodium distichum, and the black line marks the STAG conserved domain sequence.

[0032] 4. Phylogenetic analysis of the OsSCC3 protein Select using NCBI database SCC3 Phylogenetic analysis was performed on homologous proteins from different species, and phylogenetic trees were constructed using the Neighbor-joining method (bootstrap set to 1000) (see...). Figure 4 The results showed that SCC3 is widely present in different species and contains the STAG domain. SCC3 also exhibits different types in monocots, dicots, mammals, and yeast, with rice being the most closely related to maize, sorghum, and Brachypodium distichum.

[0033] 5. OsSCC3 Gene expression patterns Real-time quantitative PCR OsSCC3 Analysis was conducted on the expression in roots, stems, leaves, and spikelets. The results showed... OsSCC3 It is expressed in different tissues, with the highest expression level in rice panicles of 3-5 cm in length (see...). Figure 5 ). Figure 5 To illustrate the tissue expression patterns of SCC3 using RT-qPCR, the figures show: root (root), stem (stem), leaf (leaf), sheath (leaf sheath), P2 (2 cm long rice spike), P2-3 (2-3 cm long rice spike), P3-5 (3-5 cm long rice spike), P5-7 (5-7 cm long rice spike), and P7 (7 cm long rice spike). The RT-qPCR values ​​are the mean ± standard error of three biological replicates.

[0034] Example 2 Osscc3 Cellular phenotypic analysis 1. Osscc3 Observation of chromosome mitosis behavior Since the absence of OsSCC3 severely affects the plant's vegetative growth, and considering the function of OsSCC3 in cell division, it is speculated that it may be involved in the plant's mitotic process. Therefore, cytological observation was further conducted on vigorously dividing root tip meristem tissue. In the wild type, it could be observed that chromosomes from interphase to prophase gradually condensed from a loose clump into a linear shape, with a basic linear outline already present in prophase. In prometaphase, all chromosomes condensed into short rods, at which point the two sister chromatids of each short rod chromosome were observed to be closely attached. In metaphase, the chromosomes continued to condense and align on the equatorial plate. From anaphase to telophase, the sister chromatids separated, completing the entire mitotic process. Osscc3 In the mutant, the chromosome morphology from interphase to prophase is similar to that of the wild type, showing a gradually condensed state. However, upon entering prophase, a significant increase in the distance between the two sister chromatids of each rod-shaped chromosome can be observed, all exhibiting an "X" shaped chromosome morphology. Furthermore, as mitosis progresses, the metaphase chromosomes are loosely arranged on the equatorial plate, and 48 completely separated rice sister chromatids can be observed. This result indicates that the sister chromatids undergo premature separation during the transition from prophase to metaphase (see...). Figure 6 ).

[0035] 2. Osscc3 Observation of chromosome meiosis behavior To further investigate the effects of OsSCC3 on the entire meiotic process, studies were conducted on wild-type and... Osscc3 Chromosomes in mutant pollen mother cells were examined cytologically (see...) Figure 7 During zygote stage, chromosomes gradually condense into clumps, at which point there is no difference between wild-type and mutant. However, during pachytene stage, it is clearly observed that homologous chromosomes in the mutant cannot pair and exist as single strands of thin thread. During diakinesis, due to the inability of homologous chromosomes to pair in the mutant, 24 condensed haploids can be observed. During metaphase I, the 24 haploids are neatly arranged on the equatorial plate, and during anaphase I, sister chromatids are pulled to opposite poles by spindle fibers. During this pulling process, a small number of chromosome bridges and fragments, as well as micronuclei within the dichroic structures, are produced. These results indicate that... Osscc3 The meiotic process of pollen mother cells is abnormal in mutants.

[0036] Example 3 Osscc3 Observation of homologous recombination during meiosis in mutants 1. Osscc3 Synaptic Complex Formation Anomaly REC8 is a chromosome axis-specific element during meiosis, used to indicate homologous chromosome axes; ZEP1 is a central element of the synapsis complex, used to indicate the progress of synapsis. Therefore, the immunofluorescence signal of ZEP1 is used to monitor synapsis in wild-type and Osscc3 mutants (see...). Figure 8 ).

[0037] In the wild type, pairing and synapsis occur during the early zygotene stage, when ZEP1 begins to appear and gradually converges into a thread-like structure. Throughout the zygotene stage, as homologous chromosome pairing proceeds, the ZEP1 signal extends between homologous chromosomes until homologous chromosome pairing is completed during the pachytene stage, at which point ZEP1 forms a continuous and complete thread between homologous chromosomes.

[0038] And in Osscc3 In the mutant, ZEP1 signal was completely undetectable during early zygote stage, with only a few abnormal punctate signals throughout the entire zygote stage. ZEP1 remained abnormally large punctate until pachytene stage, after which the signal disappeared. This result indicates that OsSCC3 affects the pairing process between homologous chromosomes, leading to abnormal formation of the synaptic complex.

[0039] 2. OsSCC3 Affecting the ZMM protein-mediated CO formation pathway during homologous recombination γH2AX is an important marker of DSB formation during homologous recombination. In both wild-type and mutant individuals at early zygote stage, γH2AX exhibits numerous punctate signals on the chromosome, indicating... Osscc3 DSB formation is normal in mutants (see...) Figure 9 COM1 is a protein involved in subsequent DNA end processing and single-stranded invasion. Osscc3 The protein signal in the mutant was completely normal compared to the wild type, indicating that Osscc3 After the mutant forms a DSB, its DNA ends can be processed to form single strands and guide strand invasion. Furthermore, DMC1 and RAD51, as important single-strand binding proteins indicating homologous recombination, mediate single-strand invasion during homologous recombination and participate in sister chromatid repair during meiosis; ZIP4 and HEI10, as key factors mediating CO formation, in... Osscc3 The signal points of these proteins were significantly reduced in the mutants (see Figure 9 This indicates that OsSCC3 is involved in homologous recombination during meiosis and in the formation of CO. Figure 9In particular, γH2AX (histone phosphorylation mark, used to indicate DSB formation), COM1 (DNA end-binding protein, used to indicate homologous recombination process), DMC1 (single-strand binding protein, used to indicate homologous recombination process), RAD51 (homologous recombination protein, used to indicate homologous recombination process), ZIP4 (CO formation precursor protein, used to indicate CO formation process) and HEI10 (a class of CO marker proteins, used to indicate a class of CO) were immunofluorescently localized in wild type and mutant cells. Osscc3 Immunofluorescent localization of γH2AX, COM1, DMC1, RAD51, ZIP4 and HEI10 in wild type and mutant cells. REC8 was used to indicate homologous chromosome axes. Scale bar, 5 μm.

[0040] The above merely illustrates the present application, but the protection scope of the present application is not limited to this. Any person skilled in the art can understand and think of the transformation or replacement within the technical range disclosed by the present application, which should be covered in the inclusive scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.

Claims

1. Rice SCC3 Gene mutants, which have the function of regulating rice fertility, are characterized by: The mutant is SCC3 It is obtained by inserting a single T base between the 2929th and 2930th bases in the gene coding region.

2. The rice as described in claim 1. SCC3 The gene of the mutant has a nucleotide sequence as shown in SEQ ID NO.

3.

3. A recombinant plasmid, characterized in that, It contains the gene described in claim 2.

4. A host cell, characterized in that, It includes the recombinant plasmid as described in claim 3.

5. The rice as described in claim 1 SCC3 Application of gene mutants in the breeding of male-sterile rice lines.

6. The application according to claim 5, characterized in that, Using CRISPR-Cas9 technology to study rice SCC3 When a gene undergoes a site-directed mutation, the expression of the protein it encodes is inhibited, the rice meiotic process becomes abnormal, and the rice phenotype shows pollen sterility and dwarfism.

7. A method for preparing transgenic rice, characterized in that, The method includes: recipient rice SCC3 The mutation described in claim 1 causes a single T base to be inserted between the 2929th and 2930th bases in the N-terminal domain of the SCC3 protein, resulting in a frameshift mutation. The meiotic process of the mutant is defective, ultimately leading to pollen sterility and obtaining transgenic rice.

Images