Application of tomato slprmt4a gene in improving low temperature resistance of tomato and method for improving low temperature resistance of tomato

By knocking out the SlPRMT4a gene in tomatoes and editing tomato plants using a CRISPR/Cas9 vector, the low-temperature resistance of tomatoes was enhanced, solving the problem of limited growth of tomatoes under low-temperature conditions and achieving a significant improvement in low-temperature resistance.

CN120966901BActive Publication Date: 2026-03-24ZHEJIANG UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-22
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Tomato growth is limited under low temperature conditions, and current technologies have failed to effectively elucidate the function of the SlPRMT4a gene in the resistance of tomatoes to low temperature stress, thus limiting the improvement of tomato's low temperature resistance.

Method used

The SlPRMT4a gene in tomatoes was knocked out using gene knockout technology. sgRNA targeting the SlPRMT4a gene was constructed using a CRISPR/Cas9 vector. Tomato plants were then edited to improve their low-temperature resistance and enhance the expression of key cold-resistance genes SlCBF1/SlCBF2/SlCBF3.

Benefits of technology

It significantly improved the low-temperature resistance of tomato plants, manifested by a decrease in relative conductivity, an increase in the maximum photochemical quantum yield of PSII, and an increase in the expression of key cold-resistant genes, thus enhancing the tomato's ability to resist low temperatures.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120966901B_ABST
    Figure CN120966901B_ABST
Patent Text Reader

Abstract

The application discloses application of a tomato SlPRMT4a gene in improving low-temperature resistance of tomatoes and a method for improving low-temperature resistance of tomatoes. SlPRMT4a The method is to knock out a gene in tomatoes to significantly improve the low-temperature resistance of tomatoes. SlPRMT4a The coding sequence of the gene is shown as SEQ ID NO. 1. The method discloses the regulation of the gene in the low-temperature resistance of tomatoes for the first time. SlPRMT4a The low-temperature resistance of tomatoes is significantly improved by knocking out the gene, the method lays a theoretical foundation for studying the low-temperature resistance of tomatoes, provides a gene resource for cultivating new tomato varieties with low-temperature resistance, and has important practical application values for saving energy and reducing consumption in winter and spring production of facility vegetable industries and for helping to supply vegetables for a long time, stably and in balance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the technical fields of genetic engineering, molecular biology and plant physiology, and in particular to a tomato SlPRMT4a Application of genes in improving the low-temperature resistance of tomatoes and methods to improve the low-temperature resistance of tomatoes. Background Technology

[0002] tomato( Solanum lycopersicum As a warm-season crop, tomatoes thrive in temperatures ranging from 20-28℃, and low-temperature injury severely restricts their growth and development. Therefore, in-depth research into the physiological and molecular mechanisms by which tomatoes resist low-temperature stress is of great significance. By exploring the mechanisms and key genes involved in plant cold tolerance, it is hoped that the tomato's ability to withstand low temperatures can be enhanced, thereby reducing economic losses caused by chilling injury.

[0003] Epigenetic modification is a class of gene expression regulation mechanisms that do not involve changes in DNA sequence. The protein arginine methyltransferase (PRMT) family plays a crucial role, catalyzing arginine methylation and participating in various cellular processes such as transcriptional regulation, RNA processing, signal transduction, and cell differentiation. In Arabidopsis, AtPRMT4a is a type I histone arginine methyltransferase responsible for catalyzing monomethylation and asymmetric dimethylation of arginine. The AtPRMT4a / 4b double mutant exhibits a distinct late-flowering phenotype, regulating flowering time through a FLOWERING LOCUS C (FLC)-dependent pathway (Niu L et al., Redundant requirement for a pair of PROTEIN ARGININE METHYLTRANSFERASE4homologs for the proper regulation of Arabidopsis flowering time. Plant Physiol. 2008, 148, 490-503). AtPRMT4a / 4b are key genes involved in regulating photomorphogenesis (Hernando CE et al., Genome wide comparative analysis of the effects of PRMT5 and PRMT4 / CARM1arginine methyltransferases on the Arabidopsis thaliana transcriptome. BMCGenomics. 2015, 16, 192). Numerous studies have demonstrated the deep involvement of PRMTs in both abiotic and biotic stress responses. AtPRMT4a / 4b and AtPRMT5 positively regulate tolerance to salt stress (Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. Arginine methyltransferases and their encoding genes and applications in Arabidopsis thaliana: CN200610088825.9[P]. 2007-01-03; Hernando CE et al., Genome wide comparative analysis of the effects of PRMT5 and PRMT4 / CARM1 arginine methyltransferases on the Arabidopsis thalianatranscriptome. BMC Genomics. 2015, 16, 192).OsPRMT5 enhances rice resistance to bacterial blight by methylating OsPAL1 (Sheng C et al. OsPRMT5 methylates OsPAL1 to promote rice resistance, hindered by a Xanthomonas oryzae effector. J Integr PlantBiol. 2025, 67, 1599-1613). Under high temperature conditions, OsPRMT6a mediates arginine methylation of OsJAZ1, maintaining normal spikelet development in rice (Dong K et al. OsPRMT6a-mediated arginine methylation of OsJAZ1 regulates jasmonate signaling and spikelet development in rice. MolPlant. 2024, 17, 900-919). Previous studies have shown that AtPRMT3 is a negative regulator of freezing stress, and its mutants exhibit a significant frost-resistant phenotype. As a translation regulator, AtPRMT3 interacts with the ribosomal protein RPS2B. Disruption of the AtPRMT3-RPS2B module significantly enhanced the translation of specific mRNAs associated with cold stress, thereby significantly improving cold resistance (Wang Z et al. AtPRMT3-RPS2B promotes ribosome biogenesis and coordinates growth and cold adaptation trade-off. Nat Commun. 2024, 15, 8693). The CBF / DREB1 (C-repetition binding factor / dehydration response element binding protein 1)-dependent pathway plays a crucial role in cold stress regulation (Kang H et al. An integrative overview of cold response and regulatory pathways inhorticultural crops. J Integr Plant Biol. 2025, 67, 1028-1059). Previous studies have shown that SlCBF1 / SlCBF2 / SlCBF3 are key genes for cold resistance in tomatoes (Wang F et al., Phytochrome A and B Function Antigonistically to Regulate Cold Tolerance via Abscisic Acid-Dependent Jasmonate Signaling. Plant Physiol. 2016, 170, 459-71). However, tomatoes...SlPRMT4a The role and mechanism of genes in low-temperature stress have not been reported in studies. SlPRMT4a The function of genes in tomatoes' resistance to low-temperature stress is of great significance for breeding tomato varieties with high and low temperature resistance. Summary of the Invention

[0004] Therefore, the purpose of this application is to provide a tomato SlPRMT4a Application of genes in improving the low-temperature resistance of tomatoes and methods to improve the low-temperature resistance of tomatoes.

[0005] According to a first aspect of the embodiments of this application, a tomato is provided. SlPRMT4a The application of genes in improving the low-temperature resistance of tomatoes involves using gene knockout technology to eliminate genes in tomatoes that have been shown to be low-temperature resistant. SlPRMT4a The gene enhances the resistance of tomatoes to low temperatures. SlPRMT4a The coding sequence of the gene is shown in SEQ ID NO.1. SlPRMT4a The gene is numbered Solyc12g099560 in the tomato genome database.

[0006] According to a second aspect of the embodiments of this application, a method for improving the low-temperature resistance of tomatoes is provided, the method comprising:

[0007] Using gene knockout technology to eliminate the gene knockout mechanism in tomatoes SlPRMT4a The gene enhances the resistance of tomatoes to low temperatures. SlPRMT4a The coding sequence of the gene is shown in SEQ ID NO.1.

[0008] The specific ways in which the method described in this invention improves the low-temperature resistance of tomatoes include a decrease in relative conductivity and an increase in the maximum photochemical quantum yield of PSII (PSII). Fv / Fm The increase in the expression of cold-resistant key genes SlCBF1 / SlCBF2 / SlCBF3 was also observed.

[0009] Optionally, the SlPRMT4a The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO. 2.

[0010] Optionally, the gene knockout technology is specifically as follows:

[0011] In tomatoes SlPRMT4a The protein-coding region of the gene was selected from the target fragment containing the PAM motif adjacent to the pre-intermediate region sequence. Based on the first 20 bases of the target fragment, corresponding primers were designed to construct a CRISPR / Cas9 vector.

[0012] The CRISPR / Cas9 vector was introduced into host cells, and then used to infect the cotyledons of the target tomato. Positive gene-edited plants were screened to obtain gene-edited plants that are resistant to low temperatures.

[0013] Optionally, the low-temperature resistant gene-edited plant improves the plant's resistance to low temperatures by increasing the expression levels of the key cold-resistance genes SlCBF1 / SlCBF2 / SlCBF3.

[0014] Optionally, the host cell is an Agrobacterium cell.

[0015] Optionally, the host cell is a GV3101 Agrobacterium cell.

[0016] Optionally, the nucleotide sequence of the first 20 bases is as shown in SEQ ID NO.3.

[0017] The beneficial effects of this invention are as follows:

[0018] First construction of Tomato SlPRMT4a Gene knockout plants, through the treatment of tomatoes SlPRMT4a Gene knockout plants were subjected to low-temperature treatment, and the results showed that at low temperatures... SlPRMT4a Gene knockout plants exhibited a significantly cold-resistant phenotype. This invention is the first to utilize tomatoes... SlPRMT4a Gene knockout plants were subjected to low-temperature treatment and it was found that... SlPRMT4a This gene plays a negative regulatory role in the low-temperature stress tolerance of tomatoes; therefore, knocking out this gene can significantly increase the low-temperature resistance of tomato plants. This invention lays a theoretical foundation for studying the mechanism by which tomato plants resist low-temperature adversity and provides new gene resources for breeding new low-temperature tolerant tomato varieties, thus possessing high practical application value.

[0019] It should be understood that the above general description and the following detailed description are exemplary and explanatory only, and do not limit this application. Attached Figure Description

[0020] The accompanying drawings, which are incorporated in and form part of this specification, illustrate embodiments consistent with this application and, together with the description, serve to explain the principles of this application.

[0021] Figure 1 For tomatoes SlPRMT4a The nucleic acid sequences of the T2 generation (homozygous, without exogenous Cas9 fragments) of the gene knockout strain are used to identify the location and sequence of the sgRNA on the genome, and the PAM site is outlined with a box.

[0022] Figure 2 The tomato in Example 3 of this invention SlPRMT4a Phenotype of gene knockout lines after low-temperature treatment.

[0023] Figure 3 The tomato in Example 3 of this invention SlPRMT4a Relative electrical conductivity of gene knockout lines after low-temperature treatment.

[0024] Figure 4 The tomato in Example 3 of this invention SlPRMT4a Maximum photochemical quantum yield of PSII in gene knockout lines after low-temperature treatment ( Fv / Fm ).

[0025] Figure 5 Wild type and SlPRMT4a Changes in the expression levels of key cold-resistance genes in gene knockout lines after 12 hours of low-temperature treatment, where A represents tomato. SlCBF1 The expression level of gene (Solyc03g026280), B represents tomato. SlCBF2 Expression level of gene (Solyc03g124110), C represents tomato SlCBF3 Expression level of gene (Solyc03g026270). Detailed Implementation

[0026] The present invention will be further described below with reference to specific embodiments, but the present invention is not limited to the following embodiments. The present invention is intended to cover other modifications and variations within the scope and spirit of the present invention.

[0027] Unless otherwise stated, the present invention will be practiced using conventional botanical techniques, tissue culture, molecular biology, biological physiology and biochemistry, DNA recombination, and bioinformatics techniques that are readily apparent to those skilled in the art. These techniques are fully explained in the literature.

[0028] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available. The experimental material used was the tomato cultivar Ailsa Craig. Solanum lycopersicum L.cv).

[0029] Example 1: Construction of the SlPRMT4a CRISPR / Cas9 gene knockout vector;

[0030] For tomatoes SlPRMT4a The full-length DNA sequence of the gene (Solyc12g099560) was analyzed, and screening was performed using CRISPR-P2.0 with the U6 promoter selected. SlPRMT4a The gene's sgRNA (single guide RNA). Among them, SlPRMT4a The gene CRISPR / Cas9 vector uses sgRNA from the exon of its own gene, the specific sequence of which is shown in SEQ ID NO.3. The sgRNA has one forward primer and one reverse primer, which are used for PCR to obtain fragments containing sgRNA. The forward primer of the sgRNA used in the vector is a universal forward primer. The PCR primer sequences are shown in Table 1. Figure 1 Indicating gRNA in tomatoesSlPRMT4a Genomic location and sequence. The specific construction process was as follows: using an tRNA vector as a template, target PCR was performed using KOD high-fidelity enzyme, and the PCR product was purified to a fragment size of approximately 200 bp. Fragment recombination was completed using the Golden Gate Assembly Kit (BsaIHFv2) (NEB, E1601). The recombination system included Golden Gate Assembly Mix, PHEE401 vector, target PCR purified product, and T4 DNA ligase buffer, with ddH2O added to a final volume of 20 μL. The PCR program settings followed the kit instructions. The recombinant product was heat-shocked into trans5α E. coli competent cells (TransGen, CD201). As described in the instructions, activation was performed at 37°C and 200 rpm for 1 h. After centrifugation and discarding the supernatant, the remaining 100–150 μL of liquid was resuspended and evenly spread onto solid LB medium containing 50 mg / L kanamycin, and incubated overnight at 37°C. Single-spot small-scale shaking was performed, and positive clones were identified by bacterial culture PCR using universal M13-F and M13-R primers. The positive plasmids with correct sequencing alignment were named PHEE401-SlPRMT4a.

[0031] Table 1. PCR primer sequences for constructing CRISPR / Cas9 vectors

[0032]

[0033] Example 2: Tomato SlPRMT4a Construction and Detection of Gene Editing Materials

[0034] Gene-editing vectors were transformed into Agrobacterium GV3101 and infected with tomato cotyledons. Callus induction, hygromycin resistance induction differentiation, and rooting culture were then performed to obtain tissue culture seedlings. Positive results were verified using PCR and next-generation sequencing. slprmt4a Genetically edited plants were propagated for two generations until they were homozygous, and no Cas9 residues were found. slprmt4a #1 is missing 4 bases. slprmt4a #2 is missing 1 base ( Figure 1 ).

[0035] Example 3: SlPRMT4a Low-temperature resistance testing of gene-editing materials

[0036] Wild-type tomato seedlings with five leaves and one heart were compared with those obtained in Example 2. slprmt4aTwo mutant plant types were treated at 25℃ and 4℃ in an artificial climate incubator. After 7 days of low-temperature treatment, the low-temperature stress treatment group (4℃ treatment) was compared with the control group (25℃) under the same conditions without low-temperature treatment. The phenotype, relative conductivity, and maximum photochemical quantum yield of PSII of wild-type and gene-edited tomato plants were observed. Fv / Fm The changes in PSII (photochemical quantum yield) were observed. The method for determining the maximum photochemical quantum yield of PSII was as follows: tomato plants were dark-adapted for at least 30 minutes. Leaves from the same functional part were placed on a detection tray, and the maximum photochemical quantum yield of PSII in tomatoes after 7 days of low-temperature treatment was measured using a chlorophyll fluorescence imaging system (IMAG-PAM, Germany). The relative conductivity was determined as follows: 0.2g of tomato leaves from the same functional part, avoiding the veins, was placed in a graduated centrifuge tube containing 20mL ddH2O. The mixture was extracted for 2 hours in a shaker at 28℃ and 200rpm. The conductivity R1 of the extract was measured using a conductivity meter. The extract was then heated in a 95℃ hot water bath for 15 minutes, and the conductivity R2 was measured after cooling to room temperature. Relative conductivity = R1 / R2 × ​​100%. For RNA extraction, 0.2g of leaf samples from leaves treated at low temperature for 12h and from a control at room temperature were used. RNA was extracted using a total RNA extraction kit (Tiangen, DP419) following the manufacturer's instructions using the Trizol lysis method. The RNA was then reverse transcribed into cDNA using a HiScript II QRT SuperMix (Vazyme Biotech, China). qRTPCR experiments were then performed using a 480II Real-Time PCR detection system (Roche, Swiss) and AceQ qPCR SYBR Green Master Mix kits (Vazyme Biotech, China). The qRTPCR reaction conditions were: 95℃ for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 30 s, for 40 cycles. Fluorescence data were collected at the end of the extension phase of each cycle. Specific primers were designed based on the SlCBF1 / SlCBF2 / SlCBF3 gene sequences of tomato.

[0037] SlCBF1 Pre-primer: 5'GTCATCGTCGTTTTCTGAAG (SEQ ID NO.4);

[0038] SlCBF1 Gene post-primer: 5'AACGGCCTCTTAATGCTAAA (SEQ ID NO.5);

[0039] SlCBF2Pre-primer: 5'TTCGATCGGAAGAAGTTTCA (SEQ ID NO.6);

[0040] SlCBF2 Gene post-primer: 5'CAAGTAATCCTGGCATGGAA (SEQ ID NO.7);

[0041] SlCBF3 Pre-primer: 5'CGCCGAAATCTTCCGACCT (SEQ ID NO.8);

[0042] SlCBF3 Post-gene primer: 5'CGGCATGCAGAATAACGCTT (SEQ ID NO.9);

[0043] The results showed that slprmt4a Gene knockout tomato plants are more upright and have less leaf wilting than wild-type plants, indicating that gene knockout... slprmt4a Genes can significantly improve the low-temperature resistance of tomatoes. Figure 2 The relative electrical conductivity was significantly lower than that of the wild-type (WT) plant. [[ID= This indicates that knocking out ​ Genetically modified tomato plants exhibit reduced cell membrane electrolyte permeability, resulting in enhanced low-temperature resistance. Furthermore, gene-edited plants... ​ ( ​ The levels of photosynthesis were also higher than those of wild-type tomatoes (WT), indicating that the photoinhibition of photosystem II in tomato plants was significantly reduced under low temperatures, suggesting stronger resistance to low-temperature stress. RNA was extracted from leaves treated at 25℃ and 4℃ after 12 hours of low-temperature treatment, and reverse transcription was used for quantitative PCR. The results showed that key genes for cold resistance were identified. ​ ( ​ A) ​ ( ​ (B) ​ ( ​ The transcriptional level of C) in ​ The significant increase in the number of genes knocked out in the leaves indicates that the knockout effect under low temperature stress was significant. ​ Genes can enhance cold resistance in tomato plants. ​ The expression level of the gene is increased, which in turn promotes SlCBF signal transduction and significantly enhances the low-temperature resistance of tomatoes.

[0044] ​ The lowercase letters a, b, and c indicate significant differences among different plants at the 5% level, and the statistical method used was Turkey's test. Therefore, it can be seen that tomatoes... ​ Genes negatively regulate the cold tolerance of plants. Knockout. ​ Genes can significantly enhance the low-temperature resistance of tomatoes.

[0045] Based on the above embodiments, the nucleotide sequence shown in SEQ ID NO.1 is mutated by gene editing technology by substituting, deleting and / or adding one or more nucleotides without changing the function of the original nucleotide sequence. Then, it is transformed into Agrobacterium, and then the transformed Agrobacterium is used to infect tomato cotyledons and plant tissue culture is carried out. Positive gene-edited plants are screened, and low-temperature resistant gene-edited tomatoes can also be obtained.

[0046] Based on the above embodiments, the nucleotide sequence with the same function obtained by hybridization with the sequence shown in SEQ ID NO.1 under strict conditions is mutated in tomatoes using gene editing technology, then transformed into Agrobacterium, and then the transformed Agrobacterium is used to infect tomato cotyledons and plant tissue culture is carried out. Positive gene-edited plants are screened, and low-temperature resistant gene-edited tomatoes can also be obtained.

[0047] Based on the above embodiments, nucleotide sequences that have more than 90% homology with nucleotide sequences of 1), 2), or 3) and encode the same functional protein are mutated in tomatoes using gene editing technology, then transformed into Agrobacterium, and then the transformed Agrobacterium is used to infect tomato cotyledons and plant tissue culture is carried out. Positive gene-edited plants are screened, and low-temperature resistant gene-edited tomatoes can also be obtained.

[0048] Although the present invention has been described in detail above with general descriptions and specific embodiments, the present invention is not limited to the above embodiments, and many modifications or improvements are possible, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention are within the scope of protection claimed by the present invention.

Claims

1. Tomato SlPRMT4a The application of genes in improving the low-temperature resistance of tomatoes is characterized by, Using gene knockout technology to eliminate the gene knockout mechanism in tomatoes SlPRMT4a The gene enhances the resistance of tomatoes to low temperatures. SlPRMT4a The coding sequence of the gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The SlPRMT4a The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

3. The application according to claim 1, characterized in that, The gene knockout technology is as follows: In tomatoes SlPRMT4a The protein-coding region of the gene was selected from the target fragment containing the PAM motif adjacent to the pre-intermediate region sequence. Based on the first 20 bases of the target fragment, corresponding primers were designed to construct a CRISPR / Cas9 vector. The CRISPR / Cas9 vector was introduced into host cells, and then used to infect the cotyledons of the target tomato. Positive gene-edited plants were screened to obtain gene-edited plants that are resistant to low temperatures.

4. The application according to claim 3, characterized in that, The cold-resistant gene-edited plants enhance key genes for cold resistance. SlCBF1 / SlCBF2 / SlCBF3 The level of gene expression can be increased, thereby enhancing the plant's resistance to low temperatures.

5. The application according to claim 3, characterized in that, The nucleotide sequence of the first 20 bases is shown in SEQ ID NO.

3.

6. A method for improving the low-temperature resistance of tomatoes, characterized in that, The method is as follows: Using gene knockout technology to eliminate the gene knockout mechanism in tomatoes SlPRMT4a The gene enhances the resistance of tomatoes to low temperatures. SlPRMT4a The coding sequence of the gene is shown in SEQ ID NO.

1.

7. The method according to claim 6, characterized in that, The SlPRMT4a The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

8. The method according to claim 6, characterized in that, The gene knockout technology is as follows: In tomatoes SlPRMT4a The protein-coding region of the gene was selected from the target fragment containing the PAM motif adjacent to the pre-intermediate region sequence. Based on the first 20 bases of the target fragment, corresponding primers were designed to construct a CRISPR / Cas9 vector. The CRISPR / Cas9 vector was introduced into host cells, and then used to infect the cotyledons of the target tomato. Positive gene-edited plants were screened to obtain gene-edited plants that are resistant to low temperatures.

9. The method according to claim 8, characterized in that, The cold-resistant gene-edited plants enhance key genes for cold resistance. SlCBF1 / SlCBF2 / SlCBF3 The level of gene expression can be increased, thereby enhancing the plant's resistance to low temperatures.

10. The method according to claim 8, characterized in that, The nucleotide sequence of the first 20 bases is shown in SEQ ID NO. 3.

Citation Information

Patent Citations

  • Protein arginine methyltransferase of Arabidopsis thalianum and its coding gene and application

    CN1888058A