Application and method of RcREF1 gene in regulation and control of root growth of Chinese rose
By overexpressing the RcREF1 gene in rose plants, constructing an overexpression vector and infecting roses, the problems of difficult rooting and long rooting cycle of roses were solved, promoting root development and environmental adaptability, and improving reproductive efficiency and plant growth vigor.
Patent Information
- Application Number
- CN202511509195.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-22
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2045-10-22
AI Technical Summary
In existing technologies, roses face difficulties in rooting during asexual reproduction, have long rooting cycles, and exhibit low root vitality and slow growth after rooting, resulting in low propagation efficiency. Furthermore, exogenous hormone treatments suffer from imprecise control and plant deformities.
By cloning the RcREF1 gene and constructing an overexpression vector, the gene was transformed into Agrobacterium to infect rose plants, thereby achieving overexpression of the RcREF1 gene in roses and promoting root growth and development.
It significantly promotes the number and elongation of rose roots, improves the adaptability of the root system to the environment, solves the problems of difficult rooting and long rooting cycle, and enhances the propagation efficiency and plant growth vigor.
Smart Images

Figure CN120966902A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of agricultural bioengineering technology, and particularly relates to RcREF1 Application of a gene in regulating growth of a Chinese rose root system and a method. BACKGROUND
[0002] Chinese rose (Rosa chinensis) Rosa spp . As one of the four major cut flowers in the world, Chinese rose is a core crop with ornamental value in the global flower industry, and is widely used in fresh-cut flower market, landscape construction and home gardening field. The industry scale and market demand continue to grow. In the industrialized production of Chinese rose, asexual reproduction is a key means to achieve rapid propagation of excellent varieties and ensure the stability of variety traits. However, different Chinese rose varieties generally face difficulties in rooting, long rooting period, low root activity and slow growth after rooting during asexual reproduction, resulting in low propagation efficiency and low survival rate of seedlings, which not only increases production cost, but also seriously restricts the large-scale promotion of excellent Chinese rose varieties and the high-quality development of the industry. Therefore, exploring the key mechanisms of regulating Chinese rose root growth and developing technical means to promote efficient rooting of Chinese rose have become the core needs in the field of Chinese rose breeding and cultivation.
[0003] Root system is an important organ for plants to absorb water and nutrients, fix plants and perceive external environmental signals. Its growth and development directly determines the growth potential, stress resistance and later ornamental quality of Chinese rose plants. Promoting Chinese rose rooting and optimizing root architecture can significantly improve the adaptability of plants to adverse environments such as drought and saline-alkali, accelerate plant nutrient accumulation and growth process, and lay a foundation for subsequent improvement of flowering quality, which has important practical significance for promoting the quality and efficiency of Chinese rose industry.
[0004] In the study of molecular mechanisms of plant root growth regulation, transcription factors are the core switches of gene expression and play a key role in root development signal pathways. Among them, HD-Zip (homeodomain-leucine zipper) transcription factors are a unique transcriptional regulation family in plants, which can be divided into four subfamilies, HD-Zip I-IV, according to sequence characteristics, gene structure and functional differences. Previous studies have shown that HD-Zip I class transcription factors are widely involved in plant growth and development, especially in cell differentiation, embryonic root development, stress response and organ morphogenesis. For example, overexpression of some HD-Zip I class genes in model plants such as Arabidopsis and rice can significantly promote root elongation or lateral root formation, which reflects the conservation and functional potential of this class of transcription factors in regulating plant root growth.
[0005] With the application of molecular biotechnology in flower breeding, improving plant traits by regulating the expression of key transcription factors through genetic engineering has become a research hotspot. However, existing research on the identification of HD-Zip I transcription factors in roses and their functions in root growth regulation is still lacking. Specific HD-Zip I genes that can efficiently promote rose rooting and their mechanisms of action have not yet been identified. Furthermore, current rose rooting promotion techniques mostly rely on exogenous hormone treatment, which has problems such as difficulty in precisely controlling hormone dosage, easy occurrence of excessive vegetative growth or deformities, and inability to fundamentally solve inherent rooting barriers in varieties, thus limiting the effectiveness and stability of their application. Summary of the Invention
[0006] This invention aims to provide RcREF1 The application and methods of gene regulation in rose root growth provide a new option for promoting rose root growth. This application involves... RcREF1 Genes are integrated into roses through expression vectors, effectively promoting the growth and development of rose roots, which has significant application value for rose breeding.
[0007] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows: RcREF1 The application of genes in regulating rose root growth, the aforementioned RcREF1 The nucleotide sequence of the gene is shown in SEQ ID NO:1.
[0008] Preferably, the RcREF1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:2.
[0009] Preferably, by adjusting RcREF1 Gene expression levels regulate the growth of rose roots.
[0010] This invention also provides an overexpression vector for regulating rose root growth, the overexpression vector comprising the... RcREF1 Gene.
[0011] The present invention also provides a strain for regulating the root growth of roses, the strain comprising the overexpression vector described above.
[0012] The present invention also provides a method for utilizing the above-mentioned RcREF1 The method of regulating rose root growth through gene therapy includes the following steps: S1, Cloned Rose RcREF1 Gene; S2, Construction RcREF1 Gene overexpression vectors; The overexpression vectors obtained in S3 and S2 were transferred into Agrobacterium and used to infect rose plants, resulting in transgenic plants.
[0013] Compared with the prior art, the present application has the following advantages and technical effects: The present application discloses RcREF1 The application and method of the gene in regulating the growth of the root system of the Chinese rose, through cloning RcREF1 The gene, constructing an overexpression vector, transferring into Agrobacterium, infecting the Chinese rose plant, and obtaining a transgenic plant, can effectively promote the change of the root system configuration in the growth stage of the Chinese rose, promote the number and elongation of the root system, and effectively promote the adaptability of the Chinese rose to the external environment.
[0014] The technical solutions of the present application will be further described in detail below through the drawings and examples. BRIEF DESCRIPTION OF DRAWINGS
[0015] Figure 1 For RcREF1 Bioinformatics analysis of the gene, wherein, Figure 1 A in the figure is an evolutionary tree of HDzip family genes in Arabidopsis thaliana, Figure 1 B in the figure is RcREF1 The exon sequence of the gene, Figure 1 C in the figure is RcREF1 The conserved amino acid sequence alignment of REF in other species; Figure 2 The protein sequence structure diagram of RcREF1 , wherein, Figure 2 A in the figure is the protein structure model (prediction website https: / / alphafoldserver.com) of RcREF1, Figure 2 The protein sequence structure diagram of RcREF1 is annotated with the amino acid positions of the Helix region (21-33, 39-49, 53-120, 151-168 aa); Figure 3 RcREF1 recombinant vector plasmid map, the green box selected region is RcREF1 CDs remove the stop codon fragment; Figure 4 The nucleic acid gel electrophoresis gel map, wherein, Figure 4 A in the figure is RcREF1 The cloning nucleic acid gel electrophoresis gel map, Figure 4 B in the figure is pSuper- RcREF1 The gene CDs remove the stop codon fragment recombinant plasmid is transferred into E. coli (Dh5α), and the bacterial liquid PCR nucleic acid gel electrophoresis gel map, Figure 4 C in the figure is pSuper- RcREF1 The gene CDs remove the stop codon fragment recombinant plasmid is transferred into Agrobacterium (GV3101), and the bacterial liquid PCR nucleic acid gel electrophoresis gel map; Figure 5 The four RcREF1Transgenic Agrobacterium tumefaciens bacterial culture (overexpression control group pSuper, overexpression group pSuper-) RcREF1 TRV in the silent control group and TRV in the silent group RcREF1 Phenotypic diagram of root growth after infection of rose stem segments; Figure 6 Statistical analysis of root-related indicators after infection of rose stem segments with four types of transgenic Agrobacterium tumefaciens bacterial solutions, among which... Figure 6 In this context, A represents the number of roots that have taken root. Figure 6 B in the text is RcREF1 The relative expression level was detected. Figure 6 In this context, C represents the root length. Figure 6 In this context, D represents the root diameter. Detailed Implementation
[0016] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.
[0017] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.
[0018] Source of experimental materials: In this invention, unless otherwise specified, all other test materials and instruments are conventional test materials in the field and can be purchased through commercial channels.
[0019] Example 1 I. Rose RcREF1 Bioinformatics analysis of genes RcREF1 Evolutionary tree of the HDzip family in Arabidopsis thaliana ( Figure 1 The comparison with A) shows that it belongs to the HD-Zip class I transcription factor. Figure 1 B in the text is RcREF1 The gene sequence contains exons, a coding region of 516 bp, and an HD-Zip conserved domain, which is located from amino acid 14 to amino acid 125. Figure 1 C in the text is RcREF1 Compare conserved amino acid sequences of REF in other species.
[0020] RcREF1 A schematic diagram of the protein sequence structure is shown below. Figure 2 As shown, the amino acid composition of the Helix region is (21-33, 39-49, 53-120, 151-168 aa).
[0021] RcREF1 The gene is the nucleotide sequence shown in SEQ ID NO:1.
[0022] SEQ ID NO:1: ATGGATTTTTTCCAAACCCCAAGCAACAAGAACCAATTCCATCACAAGAAAAAGAGGCTAACCCAAGACCAAGTGAAGCTTCTGGAGAGAAGCTTCAGCTCCGACAACAAGCTCGAGCCAGACCGCAAGCTCCTGCTGGCCAAACAGCTCGGAATCCCGGCCAGACAGGTTGCCATTTGGTACCAAAACAAGCGAGCGCGGTGGAAGACGCAGAGCCTCGAGCTCGGCTACAATGCGATTCAAGTGCAGCTGGAGACT GCATTAGCGGAAAAGAGGAAACTGGAGAAAGATGTTGAGAGGCTTAAAGGAGAGTTAAACAGGGCTCATGAGCTGTTGTTGGATTTGAATAACCAAAGACAAGTAGGTGGTGATAATCATCCTGTGGTT TGCTCAGTGTTTTCAGCTTCTTGTGATCAAGAGGGTGCTGCTAGCTCTAGTTTGCAGCTTGGGGATCATGTGGTTAATCATGAGGTTAAGGAGTTTGAGGAGCTCTATGCTTGTTTGATTGGCATGTAG.
[0023] RcREF1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:2.
[0024] SEQ ID NO:2: MDFFQTPSNKNQFHHKKKRLTQDQVKLLERSFSSDNKLEPDRKLLLAKQLGIPARQVAIWYQNKRARWKTQSLELGYNAIQVQLETALAEKRKLEKDVERLKGELNRAHELLLDLNNQRQVGGDNHPVVCSVFSASCDQEGAASSSLQLGDHVVNHEVKEFEELYACLIGM.
[0025] II. Roses RcREF1 Cloning of coding sequences and vector construction First, RNA was extracted from rose leaves using the Novizan polysaccharide-polyphenol plant RNA extraction kit. The concentration (C0.05) of the extracted rose RNA was determined. RNA Reverse transcription was performed using the Novizan reverse transcription kit. The reverse transcription system is shown in Table 1. Table 1 Reaction System ;
[0026] Reverse transcription program: 37℃-15min, 85℃-5s.
[0027] For overexpression RcREF1 The construction of recombinant carriers, for RcREF1 Remove the stop codon from the encoded region, such as Figure 3 As shown in Table 2, the gene addition homologous arm cloning was performed directly using rose cDNA, and the system is shown in Table 2: Table 2 Reaction System ;
[0028] RcREF1 The PCR amplification procedure for the coding sequence is shown in Table 3.
[0029] Table 3 PCR amplification reaction procedure ;
[0030] Program 02-04 was repeated 30 times. After the PCR reaction was completed, nucleic acid agarose gel electrophoresis was performed as follows: Figure 4 As shown, the product was purified and recovered using the Novizan gel recovery kit after electrophoresis.
[0031] The primer homologous arm F sequence is shown in SEQ ID NO:3, and the primer homologous arm R sequence is shown in SEQ ID NO:4.
[0032] SEQ ID NO:3: cgactctagtctagaaagcttATGGATTTTTTCCAAACCCCA.
[0033] SEQ ID NO:4: cactagtatttaaatgtcgacCATGCCAATCAAACAAGCATAGA.
[0034] After the routine clonal amplification reaction in the PCR instrument is completed, nucleic acid agarose gel electrophoresis is performed. The gel is then cut and recovered, as follows: Figure 4 As shown. Linearized pSuper vector, and vector with added homologous arms. RcREF1 Homologous recombination of gene-silenced fragments was performed, as shown in Table 4: Table 4 Reaction System ;
[0035] The cells were heat-shocked at 50℃ for 5 min, incubated on ice for 2 min, and then the recombinant plasmid was transformed into E. coli according to the instructions of the Coollab DH5α E. coli competent cells. Subsequent identification of positive E. coli clones using the recombinant plasmid was performed. The bacterial culture PCR system is shown in Table 5. Table 5 Bacterial PCR System ;
[0036] The pSuper-F sequence is shown in SEQ ID NO:5, and the pSuper-R sequence is shown in SEQ ID NO:6.
[0037] SEQ ID NO:5: GCCATTTCGCCTTTTCAG.
[0038] SEQ ID NO:6: TGATAATCATCGCAAGACCG.
[0039] After the bacterial culture PCR was completed, nucleic acid agarose gel electrophoresis was performed. Positive clones were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. After confirming the sequencing accuracy, recombinant plasmid transformation was performed according to the instructions for Agrobacterium tumefaciens (CV3101) competent cells. The Agrobacterium tumefaciens PCR reaction system was the same as that for Escherichia coli PCR, and the nucleic acid agarose gel electrophoresis results are as follows. Figure 4 As shown.
[0040] The infection solution system for transforming rose plants is shown in Table 6 below: Table 6 Infection solution formulation ;
[0041] Agrobacterium tumefaciens suspensions of pSuper and pSuper-RcREF1 were cultured overnight at 28°C, and the bacterial pellet was collected by centrifugation. The bacterial cells were resuspended in the infection solution. The absorbance was uniformly adjusted to OD value of 0.8 at 600 nm. The mixture was then incubated in the dark for 3 hours. The bacterial solution was then pumped into the plant using a vacuum pump and incubated in the dark for three days. Rooting culture of rose stem segments was then performed by inoculating the stem segments into MS medium. The culture was conducted at 25°C with 12 hours of light followed by 12 hours of darkness. After three to four weeks of root germination, relevant indicators were measured, including the number of roots in the stem segment, root length, and root diameter, reflecting the pSuper- RcREF1 Promotes the development and growth of rose roots, resulting in the following: Figure 5 and Figure 6 As shown.
[0042] Depend on Figure 5 It can be seen that overexpression RcREF1 (pSuper- RcREF1 The root system development of the plant was significantly better than that of the control group. (Silent) RcREF1 (TRV- RcREF1Compared to the control group, the number and length of roots of the plants were inhibited.
[0043] Depend on Figure 6 It can be seen that overexpression RcREF1 (pSuper- RcREF1 The root system of the plant was 4.1, significantly higher than that of the control (pSuper), while the silent plant... RcREF1 (TRV- RcREF1 The root count of the pSuper- variety was 0.6, significantly lower than the control (TRV). Furthermore, root length also showed the same trend. RcREF1 The average root length is 1.0 cm, while TRV- RcREF1 The average root length is 0.31 cm. pSuper- RcREF1 The root diameter of TRV (0.99 mm) is greater than that of pSuper (0.88 mm). RcREF1 The root diameter (0.57 mm) was smaller than that of the TRV control.
[0044] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. RcREF1 The application of genes in regulating rose root growth is characterized by, The RcREF1 The nucleotide sequence of the gene is shown in SEQ ID NO:
1.
2. The application according to claim 1, characterized in that, The RcREF1 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:
2.
3. The application according to claim 1, characterized in that, By adjusting RcREF1 Gene expression levels regulate the growth of rose roots.
4. An overexpression vector for regulating the root growth of roses, characterized in that, The overexpression vector comprises the one described in claim 1. RcREF1 Gene.
5. A bacterial strain that regulates the root growth of roses, characterized in that, The strain includes the overexpression vector as described in claim 4.
6. A method utilizing the method described in claim 1 RcREF1 The method for regulating rose root growth by gene regulation is characterized by, Includes the following steps: S1, Cloned Rose RcREF1 Gene; S2, Construction RcREF1 Gene overexpression vectors; The overexpression vectors obtained in S3 and S2 were transferred into Agrobacterium and used to infect rose plants, resulting in transgenic plants.
Citation Information
Patent Citations
HD-Zip transcription factor GmHdz4 gene and application thereof
CN113151301A
Application of SmHD-Zip12 gene in regulation and control of hairy root traits of salvia miltiorrhiza
CN116606866A
Phoebe bournei PbHDZ35 gene and application thereof in promoting plant growth and development and improving plant drought resistance
CN119162196A
Application of tomato HB52 gene in regulation of tomato salt stress resistance
CN119570805A
Methods and compositions for improving yield characteristics in plants
US20240090466A1
Cited By
Application of RhATHB12 gene in regulation of axillary bud germination of Chinese rose, kit and regulation method
CN121874254A