Pancreatic cancer diagnosis marker based on plasma exosome circular RNA, kit and application

By combining the detection of circHPCAL1, circC3, and circPCSK6 with CA19-9 in plasma exosomes, the problem of insufficient sensitivity and specificity of existing pancreatic cancer biomarkers has been solved, enabling efficient early screening and prognostic assessment of pancreatic cancer.

CN120966992APending Publication Date: 2025-11-18ZHONGSHAN HOSPITAL AFFILIATED TO FUDAN UNIV XIAMEN HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511145531.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-15
Publication Date
2025-11-18

AI Technical Summary

Technical Problem

Existing diagnostic markers for pancreatic cancer, such as CA19-9, have insufficient sensitivity and specificity, and a high false positive rate, making it difficult to achieve early and accurate screening and diagnosis.

Method used

A triplet combination of circular RNAs circHPCAL1, circC3, and circPCSK6 from plasma exosomes, combined with CA19-9, was used to form a synergistic regulatory network through reverse transcription and quantitative PCR detection, thereby improving diagnostic efficacy.

Benefits of technology

It significantly improves the detection rate of pancreatic cancer, reduces the misdiagnosis rate, and achieves higher diagnostic accuracy and prognostic assessment. It is especially suitable for children, patients with anemia, or rapid outpatient screening, reducing the risk of false negatives.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120966992A_ABST
    Figure CN120966992A_ABST
Patent Text Reader

Abstract

The invention provides a pancreatic cancer diagnosis marker based on plasma exosome circular RNA, a kit and application in early screening, diagnosis and prognosis evaluation of pancreatic cancer, the marker comprises circular RNA circHPCAL1, circC3 and circPCSK6 derived from plasma exosome, a quadruple detection model is constructed by combining with CA19-9, diagnosis of AUC and diagnosis of pancreatic cancer are greatly improved, and the pancreatic cancer diagnosis efficiency is improved. The problem that an existing marker is high in false positive rate is solved. The kit comprises an exosome separation component, an RNA extraction component and a qPCR component, and is suitable for non-invasive early screening and prognosis monitoring.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to a pancreatic cancer diagnosis marker based on plasma exosome circular RNA, a kit for detecting the marker, and application of the marker in preparation of early screening, diagnosis and prognosis evaluation of pancreatic cancer. BACKGROUND

[0002] Pancreatic cancer (PaCa) is one of the most malignant digestive tract tumors, and is a highly invasive and high metastatic potential malignant tumor.

[0003] The early symptoms of pancreatic cancer are often not obvious and are easily ignored. Some patients may only have non-specific symptoms such as upper abdominal discomfort, dull pain, loss of appetite, weight loss, and fatigue. Pancreatic cancer progresses rapidly, and is often diagnosed in the late stage. The high mortality rate of pancreatic cancer patients is mainly due to late diagnosis. Most patients are diagnosed in the late stage, missing the opportunity for surgical intervention, resulting in a very poor prognosis. Therefore, early detection and diagnosis are extremely important for the treatment and intervention of pancreatic cancer patients and for improving the survival period.

[0004] In recent years, exosomes have become a hot spot for tumor marker research because they carry stable nucleic acid molecules and can be obtained through liquid biopsy. However, although serum biomarkers such as CA19-9 have been used for the clinical diagnosis of pancreatic cancer, the diagnostic efficiency of a single circRNA or miRNA is limited, with an AUC generally less than 0.85. The existing technology still has problems of low specificity and low sensitivity when using a single biomarker. In addition, not all patients show elevated CA19-9 levels, and patients with other diseases may also have false positives, such as cholangitis or pancreatitis.

[0005] Therefore, there is an urgent need for new biomarkers for early screening of pancreatic cancer. SUMMARY

[0006] In view of the above, in order to overcome the shortcomings of the prior art, the present application aims to provide a pancreatic cancer diagnosis marker based on plasma exosome circular RNA, a kit and application, to overcome the problems of insufficient pancreatic cancer diagnosis markers and false positives of existing markers.

[0007] Based on the above purpose:

[0008] In a first aspect, the present application provides a pancreatic cancer diagnosis marker based on plasma exosome circular RNA, which includes at least two of circular RNA circHPCAL1, circC3 and circPCSK6 derived from plasma exosomes.

[0009] Preferably, the marker is a tri-combination of circHPCAL1, circC3 and circPCSK6.

[0010] Preferably, the nucleotide sequence of the circHPCAL1 is hsa_circ_0000976, the nucleotide sequence of the circC3 is hsa_circ_0002130, and the nucleotide sequence of the circPCSK6 is hsa_circ_0037096.

[0011] In a second aspect, the present application provides a kit for detecting the plasma exosome circRNA-based pancreatic cancer diagnostic marker.

[0012] Preferably, the kit comprises specific primers or probes of the marker, in particular comprising:

[0013] Upstream and downstream primers for detecting circRNA circHPCAL1:

[0014] Upstream primer: 5'-GCCTTCAGCATGTACGACCT-3';

[0015] Downstream primer: 5'-CGACTACACCTGCACGATCT-3';

[0016] Upstream and downstream primers for detecting circRNA circC3:

[0017] Upstream primer: 5'-CTGGCTGTGAGCATGTCG-3';

[0018] Downstream primer: 5'-TCGGGAAACGATGTTCTCTT-3';

[0019] Upstream and downstream primers for detecting circRNA circPCSK6:

[0020] Upstream primer: 5'-TGTCATTGAGGGACAGAGGTG-3';

[0021] Downstream primer: 5'-TGATGATAAGCACTTTGGTGGC-3'.

[0022] Preferably, the kit further comprises the following reagents:

[0023] Reagents for extracting plasma exosome RNA;

[0024] Reagents for reverse transcription and quantitative PCR;

[0025] Reagents for detecting carbohydrate antigen CA19-9.

[0026] In a third aspect, the application provides application of the pancreatic cancer diagnostic marker based on the plasma exosome circular RNA in preparation of a pancreatic cancer diagnostic product, a pancreatic cancer early screening product, and a pancreatic cancer prognosis product, which is more widely applicable.

[0027] The tumor biomarkers circHPCAL1, circC3 and circPCSK6 have positive correlation with the expression level of the widely used pancreatic cancer marker carbohydrate antigen CA19-9 in the plasma of pancreatic cancer patients. Compared with CA19-9 alone, the combined detection of the expression levels of circHPCAL1, circC3 and circPCSK6 shows higher accuracy in evaluating the prognosis of pancreatic cancer patients. The expression levels of circHPCAL1, circC3 and circPCSK6, whether used alone or in combination with CA19-9, can be used as effective biomarkers for early screening, efficacy monitoring and prognosis evaluation of pancreatic cancer.

[0028] Specifically, compared with the prior art, the technical scheme of the application has the following beneficial effects:

[0029] 1. The pancreatic cancer biomarkers of the application use the circular RNAs circHPCAL1, circC3 and circPCSK6 in plasma exosomes to overcome the problems of insufficient pancreatic cancer diagnostic markers and false positives of existing markers.

[0030] 2. The application first screens and verifies the combination of circHPCAL1+circC3+circPCSK6, and first discovers the synergistic diagnostic value of the "triple circRNA", which significantly improves the diagnostic efficiency through a three-gene synergistic regulatory network.

[0031] 3. The application uses a quadruple combination (triple circRNA+CA19-9) to greatly improve the detection rate of pancreatic cancer and significantly reduce the misdiagnosis rate through complementary verification of the circRNA combination and CA19-9.

[0032] 4. The markers circHPCAL1, circC3 and circPCSK6 used in the application are all closed circular RNAs, and are wrapped by the lipid bilayer membrane of exosomes, having double anti-degradation mechanisms, anti-RNase of the circular structure, and anti-degradation of the exosome membrane isolation, which ensures the long-term stable existence of the markers in the plasma, and solves the problem of easy degradation of traditional linear RNA or free miRNA.

[0033] 5. The application adopts a triple marker combination (circHPCAL1+circC3+circPCSK6) to regulate pancreatic cancer-related pathways such as complement activation, calcium signaling, and protein precursor processing through competitive endogenous RNA networks, and the combined diagnostic efficiency is not simply additive of single markers, but produces a synergistic effect of "1+1+1>3".

[0034] 6. The application adopts a triple marker combination to cover pancreatic cancer heterogeneity subtypes through complementarity of different biological pathways (inflammation, metabolism, and proliferation), avoiding missed diagnosis of single markers due to tumor heterogeneity.

[0035] 7. In practice, only 200-250 μL of plasma is needed to stably detect the three circRNAs, which is much lower than the 2-5 mL of whole blood required for conventional miRNA or ctDNA detection, and is particularly suitable for children, anemic patients, or outpatient rapid screening scenarios.

[0036] 8. The exosome membrane can isolate PCR inhibitors such as hemoglobin and chylomicrons; experiments show that the Ct of hemolytic (Hb≤500 mg / dL) or lipemic (TG≤10 mmol / L) samples is less than 0.5, and no additional purification steps are needed, directly reducing the risk of false negatives. BRIEF DESCRIPTION OF DRAWINGS

[0037] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other embodiments can be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0038] Figure 1: Sequencing analysis and pathway research of differentially expressed mRNA and circRNA in pancreatic cancer plasma exosomes.

[0039] Among them: Figure 1-A is a heat map of differentially expressed mRNA in pancreatic cancer patients and normal controls. Figure 1-B is a heat map of differentially expressed circRNA in pancreatic cancer patients and normal controls. Figure 1-C is a volcano plot of differentially expressed mRNA in pancreatic cancer patients and normal controls. Figure 1-D is a volcano plot of differentially expressed circRNA in pancreatic cancer patients and normal controls. Figure 1-E is a GO pathway enrichment analysis of differentially expressed mRNA, Figure 1-F is a GO pathway enrichment analysis of differentially expressed circRNA host genes, Figure 1-G is a classical pathway analysis of differentially expressed mRNA, and Figure 1-H is a classical pathway analysis of differentially expressed circRNA host genes.

[0040] Figure 2: Expression levels of plasma exosomal circRNAs in normal pancreatic cells and pancreatic cancer cell lines.

[0041] Figure 2-A is the expression level of circHPCAL1 in normal pancreatic cells and pancreatic cancer cell lines. Figure 2-B is the expression level of circC3 in normal pancreatic cells and pancreatic cancer cell lines. Figure 2-C is the expression level of circPCSK6 in normal pancreatic cells and pancreatic cancer cell lines. Figure 2-D is the expression level of circITGAL in normal pancreatic cells and pancreatic cancer cell lines. Figure 2-E is the expression level of circPVT1 in normal pancreatic cells and pancreatic cancer cell lines. The T-test (Unpair) statistical test method was used, and p < 0.05 indicates that there is a statistical difference between the two.

[0042] Figure 3: Expression levels of plasma exosomal circRNAs in pancreatic cancer patients.

[0043] Figure 3-A is the expression level of circHPCAL1 in the plasma of 78 pancreatic cancer patients (PaCa) and 70 healthy volunteers (NC). Figure 3-B is the expression level of circC3 in the plasma of 78 pancreatic cancer patients (PaCa) and 70 healthy volunteers (NC). Figure 3-C is the expression level of circPCSK6 in the plasma of 78 pancreatic cancer patients (PaCa) and 70 healthy volunteers (NC). The T-test (Unpair) statistical test method was used, and p < 0.05 indicates that there is a statistical difference between the two.

[0044] Figure 4: Expression levels of plasma exosomal circRNAs in pancreatic cancer patient tissues.

[0045] Figure 4-A is the expression level of circHPCAL1 in the cancer tissues and adjacent tissues of 78 pancreatic cancer patients. Figure 4-B is the expression level of circC3 in the cancer tissues and adjacent tissues of 78 pancreatic cancer patients. Figure 4-C is the expression level of circPCSK6 in the cancer tissues and adjacent tissues of 78 pancreatic cancer patients. The T-test (Unpair) statistical test method was used, and p < 0.05 indicates that there is a statistical difference between the two.

[0046] Figure 5: Plasma exosomal circRNAs as a new potential biomarker for pancreatic cancer.

[0047] Figure 5: ROC curve of circHPCALl, circC3 and circPCSK6 in the evaluation of pancreatic cancer. Figure 5-A is the ROC curve of circHPCALl expression level in the evaluation of pancreatic cancer. Figure 5-B is the ROC curve of circC3 expression level in the evaluation of pancreatic cancer. Figure 5-C is the ROC curve of circPCSK6 expression level in the evaluation of pancreatic cancer. Figure 5-D is the ROC curve of the combination of circHPCALl, circC3 and circPCSK6 in the evaluation of pancreatic cancer. Figure 5-E is the ROC curve of the combination of circHPCALl and CA19-9 in the evaluation of pancreatic cancer. Figure 5-F is the ROC curve of the combination of circHPCALl, circC3, circPCSK6 and CA19-9 in the evaluation of pancreatic cancer.

[0048] Figure 6: Spearman correlation and linear regression analysis between the expression level of plasma exosomal circRNA in pancreatic cancer patients and the expression level in pancreatic cancer tissues.

[0049] Figure 6: Spearman correlation and linear regression analysis between the expression level of plasma exosomal circRNA in pancreatic cancer patients and the expression level in pancreatic cancer tissues. DETAILED DESCRIPTION

[0050] The application will be further described below in conjunction with the drawings and specific embodiments. It should be noted that the following described embodiments or technical features can be combined with each other to form new embodiments without conflict.

[0051] To make the objectives, technical solutions and advantages of the present application clearer, the embodiments of the present application will be further described in detail below with reference to the drawings and in conjunction with the specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and should not be used to limit the present application.

[0052] The technical solutions in the embodiments of the present application will be described clearly and completely below in conjunction with the drawings of the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work fall within the scope of protection of the present application.

[0053] The flowcharts shown in the drawings are only illustrative examples, and are not necessarily required to include all contents and operations / steps, nor necessarily executed in the order described. For example, some operations / steps can be further decomposed, combined, or partially merged, so the actual execution order can be changed according to actual conditions.

[0054] Non-coding RNA (ncRNA) is a class of functional RNA molecules that do not encode proteins. Among them, circular RNA (circRNA) has attracted much attention due to its unique covalently closed loop structure, which enables it to act as a "molecular sponge" as a competing endogenous RNA (ceRNA) to regulate alternative splicing and expression of genes by adsorbing miRNAs.

[0055] circRNA plays an important role in the occurrence and development of various tumors, and is involved in the regulation of key biological processes such as proliferation, migration, invasion, and apoptosis of cancer cells. More importantly, some circRNAs show significant tumor tissue specificity and exhibit differential expression characteristics in various malignant tumors, making them potential tumor diagnostic markers and therapeutic targets. In addition, due to its special loop structure, circRNA shows excellent stability in body fluids (such as saliva, blood, etc.), which can resist the degradation of RNase, providing an important guarantee for its clinical application.

[0056] Exosomes, as nanoscale vesicles secreted by cells, are rich in various bioactive substances such as proteins, lipids, and nucleic acids. Studies have shown that tumor-derived exosomes play a key role in the formation and maintenance of tumor microenvironment, and can promote the growth, invasion, and metastasis of tumors. It is particularly noteworthy that exosomes can selectively encapsulate nucleic acid molecules such as circRNA and transmit information between cells through the circulatory system.

[0057] With the development of high-throughput sequencing technology and bioinformatics analysis methods, researchers have identified multiple ncRNA signatures with diagnostic value in the plasma of pancreatic cancer patients. Among them, exosomal circRNA shows great potential as a new diagnostic marker due to its key regulatory role in the occurrence and development of pancreatic cancer and excellent stability. Therefore, in-depth study of the molecular mechanisms of exosomal circRNA in pancreatic cancer has important clinical application value for the development of new diagnostic methods and treatment strategies.

[0058] The present application aims to overcome the problems of insufficient sensitivity, specificity and high false positive rate of existing pancreatic cancer markers (such as CA19-9), and to provide a new set of pancreatic tumor markers with higher diagnostic and prognostic evaluation value. The pancreatic cancer tumor markers are circular non-coding RNA circHPCAL1 (hsa_circ_0000976), circC3 (hsa_circ_0002130) and circPCSK6 (hsa_circ_0037096).

[0059] In addition, the present application provides a detection kit for the marker combination, specifically comprising:

[0060] Component A: circRNA specific primer probe set (see Table 2 for sequence);

[0061] Component B: Exosome separation reagent (ExoQuick TM or ultracentrifugation buffer);

[0062] Component C: RNA extraction reagent (TRIzol LS or miRNeasy Kit);

[0063] Component D: Reverse transcription and qPCR reagent (containing gDNA Eraser, SYBR Green Mix);

[0064] Component E: Internal reference gene 18S rRNA primer pair;

[0065] Component F: Positive / negative control (pancreatic cancer / healthy human plasma RNA).

[0066] In addition, the present application also provides the use of the circular non-coding RNA (circHPCAL1, circC3 and circPCSK6) in the preparation of a diagnostic product for diagnosing or screening pancreatic cancer. The diagnostic product is particularly suitable for detecting plasma samples or tissue samples derived from pancreatic cancer patients.

[0067] Some embodiments of the present application will be described in detail below with reference to the accompanying drawings. The following examples and features in the examples can be combined with each other without conflict.

[0068] I. Differential expression profile analysis of circRNA in pancreatic cancer plasma exosomes

[0069] RNA sequencing analysis was performed on plasma exosome samples from 5 pancreatic cancer patients and 5 normal controls (NCs). Sequence alignment was performed using Hisat2, transcript assembly was performed using StringTie, then mRNA differential expression was analyzed using Ballgown, and circRNA differential expression was analyzed using edgeR (set FPKM average value > 0.01 as the screening threshold). The results showed that compared with normal controls, there were 1522 differentially expressed mRNAs Figure 1A (C) and 23 differentially expressed circRNAs Figure 1B (D) in the plasma of pancreatic cancer patients, among which 22 circRNAs were up-regulated and only circMASP1 was down-regulated (see Table 1 for details).

[0070] Table 1: Expression levels of differentially expressed exosome circRNAs and their host genes in pancreatic cancer plasma

[0071]

[0072] GO pathway enrichment analysis showed that these differentially expressed mRNAs and circRNA host genes were mainly involved in the composition of cell apical region, apical membrane, basal membrane and basolateral membrane, etc. Figure 1E (F). KEGG pathway analysis showed that 1522 differentially expressed mRNAs were significantly enriched in liver fibrosis / hepatic stellate cell activation, phagosome formation, etc. Figure 1G , while 23 differentially expressed circRNAs corresponded to 52 host genes mainly involved in caveolae-mediated endocytosis signaling, sorbitol degradation I metabolic pathways Figure 1H . It is worth noting that among the differentially expressed circRNAs, 5 circRNAs including hsa_circ_0000976 (circHPCAL1), hsa_circ_0002130 (circC3), hsa_circ_0037096 (circPCSK6), hsa_circ_0000690 (circITGAL) and hsa_circ_0001821 (circPVT1) showed consistent expression trends with their host genes Figure 1C (D and Table 2).

[0073] Table 2: qPCR primers for detecting circHPCAL1, circC3 and circPCSK6

[0074] circRNAs Sequence of Primers (5'-3') circHPCAL1-F GCCTTCAGCATGTACGACCT circHPCAL1-R CGACTACACCTGCACGATCT circC3-F CTGGCTGTGAGCATGTCG circC3-R TCGGGAAACGATGTTCTCTT circPCSK6-F TGTCATTGAGGGACAGAGGTG circPCSK6-R TGATGATAAGCACTTTGGTGGC circITGAL-F TGTCATTGAGGGACAGAGGTG circITGAL-R TGATGATAAGCACTTTGGTGGC circPVT1-F GCGCTGTCGCAAGAGAAAAC circPVT1-R ATCATCAACCAGCTTCTCAATTTCT 18S-F GTAACCCGTTGAACCCCATT 18S-R CCATCCAATCGGTAGTAGCG

[0075] II. Detection of circRNA expression levels

[0076] The complete sequence information of circHPCAL1, circC3, circPCSK6, circITGAL and circPVT1 was obtained through the circBank database (http: / / www.circbank.cn / ). Based on these sequences, specific qPCR detection primers were designed using SnapGene software (version 7.02) (see Table 2 for primer sequences). The PrimeScript TM RT Kit with gDNA Eraser (TaKaRa, item number RR047A) was used for RNA reverse transcription. The specific steps included: gDNA removal reaction: 42°C for 2 minutes; reverse transcription reaction: 37°C for 15 minutes, 85°C for 5 seconds; the reaction system was strictly prepared according to the requirements of the instruction manual to ensure that the genomic DNA was completely removed. TB Green TM Premix Ex Taq TM II (TaKaRa, item number RR820A) was used for qPCR detection on a Roche 480II real-time fluorescent quantitative PCR instrument, and the reaction program was set as follows: pre-denaturation: 95°C for 60 seconds; amplification cycle (45 cycles): 95°C for 5 seconds (denaturation), 60°C for 30 seconds (annealing / extension); melting curve analysis: 95°C for 5 seconds, 65°C for 1 minute, 97°C for continuous detection; 3 technical repeats were set for each sample. The 2-ΔΔCt method was used to calculate the relative expression of circRNA. 18S was used as the internal reference gene for standardization.

[0077] III. Detection of plasma circRNA expression levels in pancreatic cancer cell lines

[0078] TRIzol method (Invitrogen) was used to extract total RNA from normal pancreatic cell line HPNE and pancreatic cancer cell lines BxPC-3, MiaPaCa-2, Capan-1, SW1990, PANC-1, KP-3, SUIT-2. The NanoDrop 2000 spectrophotometer (Thermo Scientific) was used to detect the purity (A260 / A280 ratio 1.8-2.0) and concentration of RNA. 500 ng of RNA was used for reverse transcription reaction according to the instruction manual of PrimeScript TM RT reagent kit (TaKaRa, item number RR047A), and the obtained cDNA was diluted 10 times with nuclease-free water, and 4 μL was used as the qPCR template. The detection system used TB Green TM Premix Ex Taq TMII (TaKaRa, Cat# RR820A) on QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). The reaction program was set as follows: pre-denaturation: 95°C for 60 seconds; amplification cycle (45 cycles): 95°C for 5 seconds, 60°C for 30 seconds; melting curve analysis: 95°C for 15 seconds, 60°C for 1 minute, 95°C for 15 seconds; taking 18S as the internal reference gene, the relative expression of circHPCAL1, circC3, circPCSK6, circITGAL and circPVT1 was calculated by 2-ΔΔCt method (Figure 2). The quantitative results showed that: compared with normal pancreatic cells (HPNE), circHPCAL1, circC3 and circPCSK6 were significantly highly expressed in most pancreatic cancer cell lines (p < 0.01); while circITGAL and circPVT1 showed cell line-specific fluctuations. This quantitative evidence first confirmed the stable high expression characteristics of circHPCAL1, circC3 and circPCSK6 in pancreatic cancer cell lines, increasing the possibility of them as high-specificity pancreatic cancer diagnostic markers.

[0079] IV. Detection of plasma circRNA expression levels of pancreatic cancer patients and healthy people

[0080] Total RNA was extracted from plasma samples of 78 pancreatic cancer patients (PaCa) and 70 healthy volunteers (NC) using exoRNeasy Serum / Plasma Midi Kit kit (QIAGEN, Cat# 77144). 500 ng of RNA was used for reverse transcription reaction according to the instructions of PrimeScript TM RT Reagent Kit (TaKaRa, Cat# RR047A), and the obtained cDNA was diluted 10 times with nuclease-free water, and 4 μL was used as the qPCR template. TB Green TM Premix Ex Taq TM II (TaKaRa, Cat# RR820A) on Roche LightCycler 96 Real-Time PCR System (Roche). The reaction program was set as follows: pre-denaturation: 95°C for 60 seconds; amplification cycle (45 cycles): 95°C for 5 seconds, 60°C for 30 seconds; melting curve analysis: 95°C for 15 seconds, 60°C for 1 minute, 95°C for 15 seconds; taking 18S as the internal reference gene, the relative expression of circHPCAL1, circC3, circPCSK6, circITGAL and circPVT1 was calculated by 2-ΔΔCt method (Figure 2). The quantitative results showed that: compared with normal pancreatic cells (HPNE), circHPCAL1, circC3 and circPCSK6 were significantly highly expressed in most pancreatic cancer cell lines (p < 0.01); while circITGAL and circPVT1 showed cell line-specific fluctuations. This quantitative evidence first confirmed the stable high expression characteristics of circHPCAL1, circC3 and circPCSK6 in pancreatic cancer cell lines, increasing the possibility of them as high-specificity pancreatic cancer diagnostic markers. 480II system, the reaction program was set as follows: pre-denaturation: 95°C for 60 seconds; amplification cycle (45 cycles): 95°C for 5 seconds, 60°C for 30 seconds; melting curve analysis: 95°C for 5 seconds, 65°C for 1 minute, 97°C for continuous signal acquisition; 18S was used as an internal reference gene, and the relative expression of circHPCAL1, circC3 and circPCSK6 was calculated by 2-ΔΔCt method (Figure 3). Quantitative analysis showed that in the pancreatic cancer group: the expression level of circHPCAL1 (33.08±20.94) was about 8 times higher than that of the healthy control group (4.14±2.69) (p<0.001); the expression level of circC3 (8.83±5.88) was about 2.5 times higher than that of the control group (3.56±2.54) (p=0.018); the expression level of circPCSK6 (7.24±3.49) was about 2.6 times higher than that of the control group (2.75±1.72) (p=0.008). It is suggested that they have potential clinical application value as new liquid biopsy markers for early screening of pancreatic cancer.

[0081] V. Detection of circRNA expression levels in cancer tissues and pericancer tissues of pancreatic cancer patients

[0082] Total RNA was extracted from 78 pairs of paired pancreatic cancer tissues (Tumor) and pericancer tissues (Adjacent) by TRIzol method (Invitrogen). The RNA purity (A260 / A280 ratio 1.8-2.0) and concentration were detected by NanoDrop 2000 spectrophotometer (Thermo Scientific). 500 ng of RNA was reverse transcribed according to the instructions of PrimeScript TM RT kit (TaKaRa, catalog number RR047A), and the obtained cDNA was diluted 10 times with nuclease-free water, and 4 μL was used as the qPCR template. The detection system used TB Green TM Premix Ex Taq TMII (TaKaRa, Cat# RR820A) on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). The reaction program was set as follows: pre-denaturation: 95°C for 60 seconds; amplification cycle (45 cycles): 95°C for 5 seconds, 60°C for 30 seconds; melting curve analysis: 95°C for 15 seconds, 60°C for 1 minute, 95°C for 15 seconds; 18S was used as an internal reference gene, and the relative expression of circHPCAL1, circC3 and circPCSK6 was calculated by the 2- AACt method (Figure 4). The quantitative results showed that the expression level of circHPCAL1 in cancer tissues (31.61 ± 21.07) was significantly increased by 7.2 times (p < 0.001) compared with that in the adjacent tissues (4.39 ± 3.81); the expression level of circC3 in cancer tissues (17.06 ± 13.11) was increased by 3.8 times (p = 0.002) compared with that in the adjacent tissues (4.53 ± 3.33); the expression level of circPCSK6 in cancer tissues (11.35 ± 9.97) was increased by 3.0 times (p = 0.035) compared with that in the adjacent tissues (3.79 ± 2.88). It also showed the potential clinical application value of circHPCAL1, circC3 and circPCSK6 as tumor markers for screening of pancreatic cancer.

[0083] VI. Application of plasma circRNA expression level in the diagnosis of pancreatic cancer

[0084] The carbohydrate antigen CA19-9 is a commonly used clinical marker for digestive system tumors (including pancreatic cancer), which has a high detection sensitivity as a cell membrane surface glycolipid. However, this marker is easily affected by benign diseases such as pancreatitis and cholangitis (the false positive rate can reach 15-20%), so it is of great clinical significance to develop a new pancreatic cancer marker that can avoid the interference of inflammation. The diagnostic value of plasma markers in 78 pancreatic cancer patients and 70 healthy volunteers was evaluated by ROC curve (Figure 5, Table 3).

[0085] Table 3: ROC analysis of circHPCAL1, circC3, circPCSK6, CA19-9 for the diagnostic ability of pancreatic cancer patients and healthy controls.

[0086]

[0087]

[0088] The single marker AUC comparison showed: circHPCAL1: 0.858 (95% CI: 0.800-0.916); circC3: 0.660 (95% CI: 0.572-0.749); circPCSK6: 0.698 (95% CI: 0.614-0.783); CA19-9: 0.842 (95% CI: 0.769-0.915). Among them, the diagnostic efficiency of circHPCAL1 single index is equivalent to CA19-9 (AUC 0.858 vs 0.842). The joint diagnostic efficiency is improved: the AUC of circRNAs triple combination (circHPCAL1+C3+PCSK6) reaches 0.865, which is better than single CA19-9 (0.842); the AUC of quadruple combination (circRNAs+CA19-9) is significantly improved to 0.948 (95% CI: 0.907-0.989), and the sensitivity is improved to 85.90%. In addition, Spearman correlation analysis is used to evaluate the correlation between circHPCAL1, circC3 and circPCSK6 expression in pancreatic cancer patients' tissues-plasma, the results show that: circHPCAL1: r=0.345 (p=0.002); circC3: r=0.276 (p=0.014); circPCSK6: r=0.226 (p=0.047). It is shown that the plasma circRNA level can effectively reflect the expression characteristics of tumor tissues, supporting it as a minimally invasive dynamic monitoring marker (Figure 6). Therefore, the expression levels of circular non-coding RNAs circHPCAL1, circC3 and circPCSK6 can be used as markers for early screening, treatment and prognosis of pancreatic cancer.

[0089] The above is the exemplary embodiment disclosed by the present application, but it should be noted that various changes and modifications can be made without departing from the scope of the embodiments disclosed by the present application defined by the claims. The functions, steps and / or acts of the method claims described herein need not be performed in any particular order. Furthermore, although the elements of the embodiments disclosed by the present application can be described or claimed in individual form, they can also be understood as plural unless explicitly limited to a single.

[0090] It should be understood that, as used herein, the singular form "a", "an" and "the" are intended to include plural references unless the context clearly dictates otherwise. It should also be understood that "and / or" as used herein refers to any and all possible combinations of one or more of the associated listed items. The above-mentioned embodiment numbers of the embodiments disclosed by the present application are only for description and do not represent the advantages and disadvantages of the embodiments.

[0091] Those skilled in the art should understand clearly that the above discussion of any of the embodiments is only exemplary and is not intended to imply that the scope of the embodiments of the present application is limited to these examples; the technical features in the above embodiments or different embodiments can also be combined, and there are many other changes of different aspects of the embodiments of the present application as above, which are not provided in details for the sake of brevity. Therefore, any omission, modification, equivalent replacement, improvement, etc. made within the spirit and principle of the embodiments of the present application shall be included in the protection scope of the embodiments of the present application.

Claims

1. A pancreatic cancer diagnostic marker based on plasma exosomal circular RNA, characterized by, The marker comprises at least two of circHPCAL1, circC3 and circPCSK6 in the circular RNA in the plasma exosome. 2.The plasma exosome circular RNA-based pancreatic cancer diagnostic marker of claim 1, characterized by, The marker is a triple combination of circHPCAL1, circC3 and circPCSK6. 3.The plasma exosome circular RNA-based pancreatic cancer diagnostic marker according to claim 1 or 2, characterized in that, The nucleotide sequence of the circHPCAL1 is hsa_circ_0000976, the nucleotide sequence of the circC3 is hsa_circ_0002130, and the nucleotide sequence of the circPCSK6 is hsa_circ_0037096.

4. A kit for detecting the pancreatic cancer diagnostic marker based on the circular RNA in the plasma exosome according to any one of claims 1 to 3.

5. The kit of claim 4, wherein Specific primers or probes comprising the marker, in particular comprising: Upstream and downstream primers for detecting circular RNA circHPCAL1: Upstream primer: 5'-GCCTTCAGCATGTACGACCT-3'; Downstream primer: 5'-CGACTACACCTGCACGATCT-3'; Upstream and downstream primers for detecting circular RNA circC3: Upstream primer: 5'-CTGGCTGTGAGCATGTCG-3'; Downstream primer: 5'-TCGGGAAACGATGTTCTCTT-3'; Upstream and downstream primers for detecting circular RNA circPCSK6: Upstream primer: 5'-TGTCATTGAGGGACAGAGGTG-3'; Downstream primer: 5'-TGATGATAAGCACTTTGGTGGC-3'.

6. The kit of claim 5, wherein Further comprising the following reagents: Reagents for extracting plasma exosome RNA; Reagents for reverse transcription and quantitative PCR; Reagents for detecting carbohydrate antigen CA19-9.

7. Use of the pancreatic cancer diagnostic marker based on the circular RNA in the plasma exosome according to any one of claims 1 to 3 in the preparation of a pancreatic cancer diagnostic product.

8. Use of the pancreatic cancer diagnostic marker based on the circular RNA in the plasma exosome according to any one of claims 1 to 3 in the preparation of a pancreatic cancer early screening product.

9. Use of the pancreatic cancer diagnostic marker based on the circular RNA in the plasma exosome according to any one of claims 1 to 3 in the preparation of a pancreatic cancer prognosis product.