Application of CDDO-idazolide / CDDO-Im / B3 compound in targeted inhibition of TKI drug resistance of non-small cell lung cancer

Abstract

The invention provides an application of a CDDO-imdazole / CDDO-Im / B3 compound in targeted inhibition of TKI drug resistance of non-small cell lung cancer, and particularly provides an application of a compound (I) or a pharmaceutically acceptable salt thereof in treatment of drug-resistant tumors. The CDDO-imdazole / CDDO-Im / B3 compound is an effective novel APOBEC3A inhibitor, can be used for remarkably inhibiting the increase of the expression level of the APOBEC3A induced by TKI, and can be used for effectively inhibiting the drug resistance of tumors.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the use of a CDDO-imidazolide / CDDO-Im / B3 compound to target and inhibit TKI resistance in non-small cell lung cancer. Background Technology

[0002] Lung cancer is one of the most common and deadliest malignant tumors worldwide. Of lung cancer cases, 80%-85% are non-small cell lung cancer (NSCLC), which has three main types: adenocarcinoma, squamous cell carcinoma, and large cell carcinoma. The remaining 15%-20% are small cell lung cancer (SCLC) and other rarer types.

[0003] Epidermal growth factor receptor (EGFR) and anaplastic lymphoma kinase (ALK) are important driver genes in non-small cell lung cancer (NSCLC), both belonging to the receptor tyrosine kinase family. The most classic EGFR mutations are the deletion of exon 19 and the point mutation of exon 21 L858R. These mutations can lead to persistent activation of EGFR without ligand binding, accelerating tumor cell proliferation and metastasis. The ALK gene, on the other hand, can fuse with various paired genes, most commonly EML4-ALK (echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase) fusion, accounting for approximately 3-7% of NSCLC patients. This fusion leads to abnormal activation of the ALK kinase domain, which in turn continuously activates downstream signaling pathways such as RAS–MAPK and PI3K–AKT, ultimately promoting tumor cell survival and proliferation. Therefore, EGFR and ALK are key targets in the clinical treatment of lung cancer.

[0004] Tyrosine kinase inhibitors (TKIs) specifically bind to the ATP-binding sites of EGFR or ALK kinases, inhibiting their phosphorylation and blocking signal transduction pathways to exert anti-cancer effects. They are effective targeted drugs for the clinical treatment of NSCLC. Currently, many targeted drugs against EGFR and ALK, namely EGFR-TKIs and ALK-TKIs, have been approved for marketing by the National Medical Products Administration.

[0005] First-generation EGFR-TKIs, including gefitinib, erlotinib, and icotinib, can reversibly bind to EGFR, prolonging progression-free survival (PFS). Second-generation EGFR-TKIs, represented by afatinib and dacomitinib, are characterized by irreversible binding to EGFR, significantly enhancing drug activity. Osimertinib, as a third-generation EGFR-TKI, not only binds irreversibly to EGFR but also overcomes resistance mutations caused by first and second-generation EGFR-TKIs, while also exhibiting good brain-penetrating activity, controlling brain metastases in lung cancer. However, osimertinib also faces resistance issues, and fourth-generation EGFR-TKIs are currently in clinical development.

[0006] ALK-TKIs include first-generation crizotinib, second-generation alectinib, ceritinib, and brigatinib, and third-generation loratinib. Crizotinib, as the first approved ALK-TKI drug, pioneered targeted therapy for ALK-positive NSCLC. Clinical trials showed that crizotinib could prolong progression-free survival (PFS) and improve the objective response rate (ORR), far superior to traditional platinum-based chemotherapy. However, crizotinib has poor permeability and cannot cross the blood-brain barrier, resulting in negligible therapeutic effects on lung cancer brain metastases. Therefore, second-generation ALK-TKI drugs were developed and marketed. Compared to crizotinib, alectinib has stronger anti-tumor activity and fewer adverse reactions. Alectinib can penetrate the blood-brain barrier, reducing the risk of lung cancer brain metastases from 31.5% to 4.6%. On the other hand, its binding to the ALK kinase domain is more specific, resulting in higher inhibitory activity. PFS is nearly three times longer than crizotinib, and the risk of disease progression or death is reduced by 57%. Therefore, alectinib, with its significant efficacy, has become the preferred first-line treatment for ALK-positive lung cancer patients. Third-generation ALK-TKI lolatinib and fourth-generation drugs have also been launched or entered clinical trials. These drugs not only have high blood-brain penetration but can also effectively alleviate ALK resistance mutations, providing more layers of treatment options for patients with advanced lung cancer. Although these drugs have shown significant efficacy in clinical treatment, drug resistance to TKIs will inevitably be a serious challenge over time. Most patients develop acquired resistance after continuous use of TKI drugs, leading to tumor recurrence.

[0007] In summary, there is an urgent need in this field to develop drugs that effectively inhibit resistance to targeted TKIs. Summary of the Invention

[0008] The purpose of this invention is to provide a drug that effectively inhibits resistance to targeted drugs (TKIs) and its application, especially in the treatment of tumors such as lung cancer (including but not limited to lung adenocarcinoma and lung squamous cell carcinoma), cervical cancer, head and neck squamous cell carcinoma, esophageal squamous cell carcinoma, bladder cancer, breast cancer, ovarian cancer, liver cancer, kidney cancer, and leukemia.

[0009] In a first aspect, the present invention provides the use of a compound (I) or a pharmaceutically acceptable salt thereof for the preparation of a medicament for the treatment of drug-resistant tumors;

[0010] The compound (I) has the following structure:

[0011]

[0012] In another preferred embodiment, the drug-resistant tumor is selected from the group consisting of: lung cancer (including but not limited to lung adenocarcinoma and lung squamous cell carcinoma), cervical cancer, head and neck squamous cell carcinoma, esophageal squamous cell carcinoma, bladder cancer, breast cancer, ovarian cancer, stomach cancer, intestinal cancer, liver cancer, kidney cancer, leukemia, etc.

[0013] In another preferred embodiment, the drug-resistant tumor is lung cancer.

[0014] In another preferred embodiment, the lung cancer is non-small cell lung cancer.

[0015] In another preferred embodiment, the non-small cell lung cancer is selected from the group consisting of adenocarcinoma, squamous cell carcinoma, and large cell carcinoma.

[0016] In another preferred embodiment, the drug-resistant tumor is non-small cell lung cancer resistant to tyrosine kinase inhibitors.

[0017] In another preferred embodiment, the drug-resistant tumor is a tumor that highly expresses APOBEC3A.

[0018] In another preferred embodiment, the drug-resistant tumor is a lung cancer with high expression of APOBEC3A.

[0019] In another preferred embodiment, the drug-resistant tumor is non-small cell lung cancer with high APOBEC3A expression.

[0020] In another preferred embodiment, the tyrosine kinase inhibitor-resistant non-small cell lung cancer is non-small cell lung cancer with high APOBEC3A expression.

[0021] In another preferred embodiment, the tyrosine kinase inhibitor is selected from the group consisting of gefitinib, erlotinib, icotinib, afatinib, dacomitinib, osimertinib, alectinib, ceritinib, brigatinib, or salts thereof.

[0022] In another preferred embodiment, the tyrosine kinase inhibitor is alectinib, osimertinib, or their salts.

[0023] In a second aspect, the present invention provides a pharmaceutical composition for treating drug-resistant tumors, the pharmaceutical composition comprising a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier;

[0024]

[0025] In another preferred embodiment, the carrier includes, but is not limited to, a sustained-release agent, excipient, filler, diluent, binder, wetting agent, disintegrant, absorption promoter, adsorbent carrier, surfactant, or lubricant.

[0026] In another preferred embodiment, the dosage form of the pharmaceutical composition is selected from the group consisting of tablets, capsules, granules, pills, powders, solutions, suspensions, emulsions, liposomes, transdermal preparations, and suppositories, or combinations thereof.

[0027] In another preferred embodiment, the pharmaceutical composition is administered via a method selected from the group consisting of: injection, cavity administration, or inhalation.

[0028] In a third aspect, the present invention provides a pharmaceutical composition comprising a first pharmaceutically active ingredient and a second pharmaceutically active ingredient;

[0029] The first active pharmaceutical ingredient is a compound of formula I or a pharmaceutically acceptable salt thereof;

[0030]

[0031] The second active ingredient in the drug is a tyrosine kinase inhibitor for treating tumors.

[0032] In another preferred embodiment, the tyrosine kinase inhibitor is selected from the group consisting of gefitinib, erlotinib, icotinib, afatinib, dacomitinib, osimertinib, alectinib, ceritinib, brigatinib, or salts thereof.

[0033] In another preferred embodiment, the tyrosine kinase inhibitor is selected from the group consisting of crizotinib, ceritinib, alectinib, ensartinib, loratinib, osimertinib, brigatinib, and their salts.

[0034] In another preferred embodiment, the tyrosine kinase inhibitor is selected from the group consisting of alectinib, osimertinib, and their salts.

[0035] In another preferred embodiment, the drug combination is a drug combination for treating or preventing drug-resistant tumors.

[0036] In another preferred embodiment, the tyrosine kinase inhibitor and the compound as shown in Formula I may be contained in separate pharmaceutical compositions or formulations, or together in the same pharmaceutical composition or formulation.

[0037] In another preferred embodiment, the tyrosine kinase inhibitor and the compound as shown in Formula I can be used for simultaneous administration, sequential administration, or intermittent administration.

[0038] In another preferred embodiment, the molar ratio of the tyrosine kinase inhibitor to the compound shown in Formula I is 1–1000:1000–1.

[0039] In a fourth aspect, the present invention provides the use of a pharmaceutical combination as described in the third aspect of the present invention for preparing a drug for inhibiting tumors.

[0040] In a fifth aspect, the present invention provides a pharmaceutical composition comprising:

[0041] (a) A compound of formula I or a pharmaceutically acceptable salt thereof that is the first active ingredient;

[0042]

[0043] (b) a tyrosine kinase-targeting drug resistance inhibitor as a second active ingredient; and

[0044] (c) Pharmaceutically acceptable carriers.

[0045] In another preferred embodiment, the carrier is selected from the group consisting of: sustained-release agents, excipients, fillers, diluents, binders, wetting agents, disintegrants, absorption promoters, adsorbent carriers, surfactants, or lubricants.

[0046] In another preferred embodiment, the dosage form of the pharmaceutical composition is selected from the group consisting of tablets, capsules, granules, pills, powders, solutions, suspensions, emulsions, liposomes, transdermal preparations, and suppositories, or combinations thereof.

[0047] In another preferred embodiment, the pharmaceutical composition may be administered by injection, cavity administration, or respiratory administration.

[0048] In a sixth aspect, the present invention provides a medicine box, comprising:

[0049] (a) A first container, and a first pharmaceutical composition located within the first container, the first pharmaceutical composition containing a compound of formula I or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier as a first active ingredient;

[0050]

[0051] (b) a second container, and a second pharmaceutical composition located within the second container, the second pharmaceutical composition containing a tyrosine kinase-targeting drug resistance inhibitor as a second active ingredient and a pharmaceutically acceptable carrier.

[0052] In a seventh aspect, the present invention provides a medicine box, comprising:

[0053] (a) a first container, and a first pharmaceutical composition located within the first container, the first pharmaceutical composition containing a compound of formula I as a first active ingredient, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier; and

[0054]

[0055] (b) a second container, and a second pharmaceutical composition located within the second container, the second pharmaceutical composition containing a tyrosine kinase-targeting drug resistance inhibitor as a second active ingredient and a pharmaceutically acceptable carrier; and

[0056] (c) The third container, and the detection reagent for detecting APOBEC3A expression located in the third container.

[0057] In another preferred embodiment, the detection reagent detects the mRNA or protein level of APOBEC3A.

[0058] An eighth aspect of the present invention provides a method for reversing drug resistance in tumor cells, comprising the steps of:

[0059] (a) Culture drug-resistant tumor cells in the presence of a compound of formula I or a pharmaceutically acceptable salt thereof, thereby reducing the drug resistance of the tumor cells:

[0060]

[0061] In another preferred embodiment, the drug resistance is resistance to tyrosine kinase inhibitors.

[0062] In another preferred embodiment, in step (a), the drug-resistant tumor cells are cultured in the presence of a compound of formula I or a pharmaceutically acceptable salt thereof, and a tyrosine kinase inhibitor.

[0063] In another preferred embodiment, in step (a), the concentration of the compound of formula I or a pharmaceutically acceptable salt thereof is 2-50 μM.

[0064] In another preferred embodiment, in step (a), the concentration of the compound of formula I or a pharmaceutically acceptable salt thereof is 5-20 μM.

[0065] In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

[0066] In another preferred embodiment, the method is in vitro.

[0067] A ninth aspect of the present invention provides a method for treating a tumor, comprising the step of: applying a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof to a desired subject.

[0068] In another preferred embodiment, the subject is a cancer patient.

[0069] In another preferred embodiment, the patient is a patient with drug-resistant tumors or a patient who is insensitive to anti-tumor drugs.

[0070] In another preferred embodiment, the antitumor drug is a tyrosine kinase-targeting drug resistance inhibitor.

[0071] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0072] Figure 1 The results showed that CDDO-imidazolide / CDDO-Im / B3 inhibited the TKI-induced increase in APOBEC3A expression levels. In the figure: A, APOBEC3A gene transcription level in H3122 cells; B, APOBEC3A protein level in H3122 cells; C, APOBEC3A gene transcription level in PC9 cells. Significant differences were indicated: *P<0.05, **P<0.01, ***P<0.001.

[0073] Figure 2 The results showed that CDDO-imidazolide / CDDO-Im / B3 significantly inhibited the formation of drug-resistant cells. Figure A shows the effect of CCK-8 assay on H3122 cell growth, and the effect of B3 combined with alectinib; B shows a representative image from the drug-resistant colony formation assay; C shows quantitative statistics on the number of colonies in the drug-resistant colony formation assay; D shows quantitative statistics on the area of ​​colonies in the drug-resistant colony formation assay. Significant differences were defined as follows: *P<0.05, **P<0.01, ***P<0.001.

[0074] Figure 3The effects of CDDO-imidazolide / CDDO-Im / B3 combined with alectinib on mouse tumors are shown. Figure A shows the effect of B3 combined with alectinib on mouse tumor volume. The control group received saline, the alectinib group received alectinib alone, and the alectinib+B3 group received alectinib and B3 in combination. Figure B shows the effect of B3 combined with alectinib on mouse body weight. Figure C shows tumor anatomy after 74 days of treatment in the alectinib-resistant group and the B3 combined with alectinib group. Figure D shows the weight of the dissected tumor. Figure E shows representative staining results of the proliferation marker Ki67 in tumor tissue. Figure F shows representative staining results of the apoptosis marker Cleavedcaspase 3 in tumor tissue. Figure G shows the percentage of quantitative Ki67-positive cells. Figure H shows the percentage of quantitative Cleavedcaspase 3-positive cells. Significant differences are indicated by *P<0.05, **P<0.01, and **P<0.001. Detailed Implementation

[0075] Through extensive and in-depth research and numerous screenings, the inventors unexpectedly discovered for the first time that the CDDO-imidazolide / CDDO-Im / B3 compound exhibits excellent inhibitory activity against drug-resistant tumors, significantly inhibiting their growth, particularly temozolomide-resistant and EGFR inhibitor-resistant tumors, and holds promise for development as a drug against drug-resistant tumors. Based on this discovery, the inventors completed this invention.

[0076] the term

[0077] Receptor tyrosine kinases: a class of enzyme-linked receptors that can bind to ligands and catalyze the phosphorylation of tyrosine residues in downstream target proteins, playing a role in cellular physiological activities.

[0078] EML4-ALK fusion: The EML4 and ALK genes are located in the p21 and p23 regions of human chromosome 2, respectively, separated by a distance of 10 Mb. In non-small cell lung cancer, these two unconnected gene segments fuse through chromosomal inversion to produce the oncogenic EML4-ALK fusion protein.

[0079] The RAS–MAPK pathway (Ras-Mitogen-Activated Protein Kinase Pathway) is an important intracellular signal transduction pathway involved in regulating cell proliferation, differentiation, survival, and migration. RAS proteins become active upon external stimulation. Activated RAS proteins, through a series of protein-protein interactions and phosphorylation events, progressively transmit signals to downstream MAPK molecules. Ultimately, activated MAPK molecules enter the cell nucleus, regulating transcription factor activity and influencing the expression of specific genes, thereby achieving precise regulation of cellular physiological activities.

[0080] The PI3K–AKT pathway (Phosphatidylinositol 3-Kinase / Akt Pathway): After the ligand on the cell membrane binds to the receptor, the activated phosphatidylinositol-3-kinase (PI3K) and its downstream factors signal the signaling pathway, which ultimately activates the protein kinase B (AKT) signaling pathway, which is closely related to cell proliferation, survival and metabolism.

[0081] Progression-free survival (PFS): An important indicator for evaluating the efficacy of cancer treatment drugs. It usually refers to the total survival time of a cancer patient from the start of treatment until cancer recurrence or death from any cause.

[0082] Objective response rate (ORR): refers to the proportion of patients whose tumor volume shrinks to a predetermined value and can be maintained for the minimum required period of time.

[0083] Acquired drug resistance refers to the gradual development of resistance in tumor cells to therapeutic drugs during long-term treatment, rendering previously effective treatment regimens ineffective.

[0084] HER2 amplification: The HER2 gene is the human epidermal growth factor receptor 2 gene. An increase in the copy number of the HER2 gene leads to the production of excessive HER2 protein by cells.

[0085] RET rearrangement: RET stands for Rearranged during Transfection gene. The RET gene structure breaks and reconnects with other gene segments to form a fusion gene.

[0086] KRAS mutation: The KRAS gene stands for Kirsten rat sarcoma virus oncogene homolog. KRAS mutations mainly occur at codons 12, 13, and 61. KRAS mutations continuously activate downstream signaling pathways, promoting abnormal cell proliferation and are one of the important driving factors in tumorigenesis and development.

[0087] MAP2K1 mutation: MAP2K1 is mitogen-activated protein kinase 1. Alterations in MAP2K1 can activate the MAPK signaling pathway, thereby promoting tumor development and progression.

[0088] Cytidine deaminase: an intracellular enzyme that specifically catalyzes the irreversible deamination of cytidine and plays an important role in nucleic acid metabolism.

[0089] TpC sites refer to specific DNA sequence locations in the genome. "TpC" represents a dinucleotide sequence of thymine (T) and cytosine (C). TpC sites are hotspots for mutations in tumors.

[0090] The CCK-8 assay (Cell Counting Kit-8 assay) is a widely used experimental method for detecting cell proliferation and activity. Based on the principles of cell metabolism, it assesses cell proliferation capacity and activity by detecting the activity of intracellular dehydrogenases.

[0091] The active ingredient of the present invention

[0092] As used herein, the terms “active ingredient of the invention” and “compound of the invention” are used interchangeably to refer to compounds having the structure of Formula I or pharmaceutically acceptable salts.

[0093]

[0094] It should be understood that the term also includes amorphous forms, various crystal forms, pharmaceutically acceptable inorganic or organic salts, hydrates or solvates, and other different forms of compounds represented by Formula I.

[0095] Tyrosine kinase inhibitors (TKIs)

[0096] Tyrosine kinase inhibitors (TKIs) can specifically bind to the ATP-binding sites of EGFR or ALK kinases, inhibiting their phosphorylation and blocking signal transduction pathways, thereby exerting anti-cancer effects and becoming effective targeted drugs for the clinical treatment of NSCLC.

[0097] Representative tyrosine kinase inhibitors include (but are not limited to): gefitinib, erlotinib, icotinib, afatinib, dacomitinib, osimertinib, alectinib, ceritinib, and brigatinib.

[0098] Taking ALK-TKIs as an example, developed drugs include first-generation crizotinib, second-generation alectinib, ceritinib, and brigatinib, and third-generation lolatinib. Clinical trials have shown that crizotinib can prolong progression-free survival (PFS) and improve objective response rate (ORR). Compared with crizotinib, second-generation alectinib has stronger anti-tumor activity and fewer adverse reactions. Third-generation ALK-TKI lolatinib and fourth-generation drugs are also being marketed or entering clinical trials.

[0099] Taking EGFR-TKIs as an example, developed drugs include first-generation drugs such as gefitinib, erlotinib, and icotinib, which can reversibly bind to EGFR, prolonging patients' progression-free survival (PFS). Second-generation EGFR-TKIs, represented by afatinib and dacomitinib, are characterized by irreversible binding to EGFR, thus significantly improving drug activity. Osimertinib, as a third-generation EGFR-TKI, not only can irreversibly bind to EGFR, but also overcomes the resistance mutations caused by first and second-generation drugs, and has good brain-penetrating activity, controlling brain metastases in lung cancer.

[0100] Taking alectinib as an example, its structural formula is:

[0101]

[0102] Taking osimertinib as an example, its structural formula is:

[0103]

[0104] Pharmaceutical Compositions and Administration

[0105] The present invention provides a pharmaceutical composition containing the compound of the present invention as an active ingredient.

[0106] The pharmaceutical compositions of the present invention comprise, within a safe and effective range, the compound of the present invention or a pharmacologically acceptable salt thereof, and a pharmacologically acceptable excipient or carrier. "Safe and effective range" refers to an amount of the compound sufficient to significantly improve the condition without causing serious side effects. Typically, the pharmaceutical composition contains 1-2000 mg of the compound of the present invention per dose, more preferably, 10-500 mg of the compound of the present invention per dose. Preferably, "one dose" is one capsule or tablet.

[0107] "Pharmaceutically acceptable carriers" refers to one or more compatible solid or liquid fillers or gelling substances that are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components in the composition can be mixed with and with the compounds of the present invention without significantly reducing the efficacy of the compounds. Examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (such as... Wetting agents (such as sodium dodecyl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0108] There are no particular limitations on the administration of the compounds or pharmaceutical compositions of the present invention. Representative administration methods include (but are not limited to): oral, intratumoral, rectal, parenteral (intravenous, intramuscular or subcutaneous), and local administration.

[0109] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In these solid dosage forms, the active compound is mixed with at least one conventional inert excipient (or carrier), such as sodium citrate or dicalcium phosphate, or with the following components: (a) fillers or compatibilizers, such as starch, lactose, sucrose, glucose, mannitol, and silica; (b) binders, such as hydroxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose, and gum arabic; (c) humectants, such as glycerin; (d) disintegrants, such as agar, calcium carbonate, potato starch or cassava starch, alginate, certain complex silicates, and sodium carbonate; (e) slowing agents, such as paraffin; (f) absorption accelerators, such as quaternary ammonium compounds; (g) wetting agents, such as cetyl alcohol and glyceryl monostearate; (h) adsorbents, such as kaolin; and (i) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium dodecyl sulfate, or mixtures thereof. Buffers may also be included in capsules, tablets, and pills.

[0110] Solid dosage forms such as tablets, sugar pills, capsules, pellets, and granules can be prepared using coatings and shells, such as casings and other materials known in the art. They may contain opacifying agents, and the release of the active compound or compound from such compositions can be delayed in a portion of the digestive tract. Examples of encapsulating components that can be used are polymeric substances and waxes. If necessary, the active compound may also be formed into microcapsules with one or more of the excipients described above.

[0111] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, or tinctures. In addition to the active compound, liquid dosage forms may contain inert diluents conventionally used in the art, such as water or other solvents, solubilizers and emulsifiers, e.g., ethanol, isopropanol, ethyl carbonate, ethyl acetate, propylene glycol, 1,3-butanediol, dimethylformamide, and oils, particularly cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil, and sesame oil, or mixtures of these substances.

[0112] In addition to these inert diluents, the composition may also contain auxiliaries such as wetting agents, emulsifiers and suspending agents, sweeteners, flavoring agents and fragrances.

[0113] In addition to the active compound, the suspension may contain suspending agents such as ethoxylated isooctadecyl alcohol, polyoxyethylene sorbitol and dehydrated sorbitol esters, microcrystalline cellulose, aluminum methoxide and agar, or mixtures of these substances.

[0114] Compositions for parenteral injection may comprise physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions, or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents, or excipients include water, ethanol, polyols, and suitable mixtures thereof.

[0115] Dosage forms of the compounds of the present invention for topical administration include ointments, powders, patches, sprays, and inhalers. The active ingredient is mixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, or propellants that may be necessary.

[0116] The compounds of this invention can be administered alone or in combination with other pharmaceutically acceptable compounds.

[0117] When using the pharmaceutical composition, a safe and effective amount of the compound of the present invention is applied to the mammal (such as a human) requiring treatment. The dosage administered is the pharmaceutically considered effective dose. For a person weighing 60 kg, the daily dose is typically 1–2000 mg, preferably 20–500 mg. Of course, the specific dosage should also take into account factors such as the route of administration and the patient's health condition, which are all within the scope of the skill of a skilled physician.

[0118] Combination therapy

[0119] The present invention also provides a method for treating tumors (especially drug-resistant tumors) or inhibiting tumor cells by combining the compounds of the present invention with tyrosine kinase inhibitors (TKIs).

[0120] In some aspects, the active ingredients of the present invention (such as compounds represented by Formula I) are used to treat or adjuvantly treat tumors in subjects in need.

[0121] When used in combination, the molar ratio of the compound of the present invention to the tyrosine kinase inhibitor is typically 1–1000:1000–1.

[0122] In this invention, the compounds of this invention and tyrosine kinase inhibitors (TKIs) can be administered simultaneously, sequentially, or alternately.

[0123] In some embodiments, the active ingredient of the present invention is administered in combination with the kinase inhibitor.

[0124] The active ingredient of this invention can be administered sequentially or alternately with a kinase inhibitor. In alternating or sequential treatment, the effective dose of each agent is administered continuously or sequentially. The dose administered depends on the absorption, inactivation, and excretion rates of the drug, as well as other factors known to those skilled in the art. For any particular subject, the specific dosing regimen and schedule should be adjusted over time according to individual needs and the professional judgment of the person administering or supervising the composition.

[0125] In some embodiments, the active ingredient of the present invention and the kinase inhibitor are administered simultaneously.

[0126] In some embodiments, the active ingredient and kinase inhibitor of the present invention are administered to a patient sequentially and at time intervals. In other embodiments, administration is performed to a mammal, such as a mouse, so that the active ingredient of the present invention can act synergistically with the kinase inhibitor to provide increased benefit compared to administration in other ways. In some embodiments, the kinase inhibitor may be administered simultaneously or sequentially at different times in any order; however, if not simultaneously, they should be administered close enough in time to provide the desired therapeutic or preventative effect. In some embodiments, the active ingredient and kinase inhibitor of the present invention exert their effects at overlapping times. Each active substance and kinase inhibitor may be administered individually in any suitable form and via any suitable route. In some embodiments, the active ingredient of the present invention is administered before, simultaneously with, or after administration of the kinase inhibitor.

[0127] The main advantages of this invention include:

[0128] (a) Through extensive screening, this invention has for the first time discovered that CDDO-imidazolide / CDDO-Im / B3 is an effective novel inhibitor of APOBEC3A, which can significantly inhibit the increase in APOBEC3A expression level induced by TKI.

[0129] (b) The in vitro cell experiments of the present invention show that the use of B3 in combination with TKI can effectively reduce the drug resistance of tumor cells.

[0130] (c) The present invention shows that no obvious toxic reactions were observed when B3 and TKI were used in combination in animal models, and at the same time, it can promote tumor shrinkage in mice and effectively overcome the problem of TKI resistance.

[0131] (d) This invention provides innovative treatment strategies and drug combinations for drug-resistant non-small cell lung cancer, and also lays a solid theoretical and experimental foundation for subsequent clinical combination therapy.

[0132] discuss

[0133] The underlying molecular mechanisms underlying the development of drug resistance mutations in tumor cells during targeted TKI therapy remain unclear. Recent research indicates that the apolipoprotein B mRNA editing enzyme APOBEC3A (Apolipo protein B mRNA editing catalytic polypeptide-like 3A) drives the NSCLC TKI resistance process.

[0134] APOBEC3 is a cytidine deaminase that catalyzes the deamination of cytosine to uracil in single-stranded DNA, resulting in C>T or C>G substitutions at TpC sites in the genome. It is also an important antiviral factor in the immune system. There are seven members in the human APOBEC3 family: APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, and APOBEC3H. APOBEC3-induced mutations are widespread in various types of cancer. APOBEC3A and APOBEC3B have also been shown to be involved in tumor development and evolution. In particular, studies have found that APOBEC3A mutation signals are highly enriched in tumor samples from TKI-resistant patients. Lung cancer targeted therapies, whether EGFR-TKIs or ALK-TKIs, can induce high expression of APOBEC3A, promoting DNA damage, increasing genomic instability, and driving the evolution of persistently resistant cells. Therefore, inhibiting the expression or activity of APOBEC3A may be a novel therapeutic strategy for preventing and delaying acquired resistance to TKIs in lung cancer.

[0135] It is worth noting that the combination therapy of TKIs and APOBEC3A inhibitors is an effective means of treating lung cancer and preventing drug resistance. However, to date, no APOBEC3A inhibitors with high efficacy and selectivity have been discovered. Future research will focus on further screening and discovering high-quality APOBEC3A inhibitors to advance the clinical translation of combination therapies.

[0136] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0137] Example 1: CDDO-imidazolide / CDDO-Im / B3 significantly inhibited TKI-induced APOBEC3A expression.

[0138] 1. Materials

[0139] NSCLC cell line H3122 wild-type cells (human non-small cell lung adenocarcinoma cells expressing the EML4-ALK fusion gene), PC9 (human non-small cell lung adenocarcinoma cells with EGFR gene exon 19 deletion mutation), B3, alectinib, osimertinib.

[0140] 2. Method

[0141] (1) H3122 cells were treated with B3 and alectinib in combination.

[0142] H3122 cells were used at a rate of 4 × 10 5 Cells were seeded at a density of [number] cells / well in 6-well plates and incubated overnight at 37°C. On the second day, the alectinib group and the alectinib+B3 group were replaced with fresh medium containing 100 nM alectinib, and treated for 3 days. Subsequently, the alectinib+B3 group had its original culture medium removed and was replaced with fresh medium containing 100 nM alectinib and 10 μM B3, and treated for another 4 days. The alectinib group was replaced with fresh medium containing 100 nM alectinib and treated synchronously for 4 days. The control group was treated synchronously with the same concentration of DMSO for 7 days. After treatment, cell pellets were collected, and APOBEC3A expression levels were detected by RT-qPCR and Western blot.

[0143] (2) PC-9 cells were treated with B3 in combination with osimertinib

[0144] PC-9 cells at 2×10 5 Cells were seeded at a density of [number] cells / well in 6-well plates and incubated overnight at 37°C. On the second day, the osimertinib group and the osimertinib+B3 group were replaced with fresh medium containing 100 nM osimertinib and treated for 3 days. Subsequently, the osimertinib+B3 group had its original culture medium removed and was replaced with fresh medium containing 100 nM osimertinib and 10 μM B3, and treated for another 4 days. The osimertinib group was replaced with fresh medium containing 100 nM osimertinib and treated synchronously for 4 days. The control group was treated synchronously with the same concentration of DMSO for 7 days. After treatment, cell pellets were collected, and APOBEC3A expression levels were detected by RT-qPCR.

[0145] (3) Cell RNA extraction and reverse transcription

[0146] Add 1 ml of Trizol lysis buffer to the cell pellet, lyse thoroughly, then add 200 μL of chloroform for RNA extraction. Wash the RNA pellet with 75% ethanol. After drying the pellet, add an appropriate amount of DEPC water, determine the concentration, and store at -80°C or perform reverse transcription. Reverse transcription was performed using a reverse transcription kit (Lablead, F0202). The obtained cDNA was stored at -80°C.

[0147] (4) RT-qPCR experiment

[0148] RT-qPCR was performed using 2X SYBR GreenMaster qPCR mix (Selleck) reagents. Primers are as follows:

[0149] upstream primer for apobec3a gene: TGGCATTGGAAGGCATAAGAC

[0150] downstream primer for apobec3a gene: TTAGCCTGGTTGTGTAGAAAGC

[0151] upstream primer of the internal reference β-actin gene: GGCCGGCTACAGCTTCA

[0152] Internal reference β-actin gene downstream primer: TCTCCTTAATGTCACGCACGAT(5) Western blot

[0153] Cell pellet was lysed with an appropriate amount of RAPI lysis buffer, and then SDS loading buffer was added. The pellet was boiled at 98°C for 10 min. The sample was then loaded into the wells for SDS-PAGE gel electrophoresis. After electrophoresis, wet transfer was performed at a constant current of 0.25 A for 1 hour. After blocking with 3% BSA, the pellet was incubated overnight at 4°C with primary antibody (APOBEC3A, Proteintech, 25084-1-AP; Actin, Santa Cruz, SC-58673). The next day, the pellet was incubated with secondary antibody at room temperature for 1 hour, followed by chemiluminescence imaging.

[0154] 3. Results

[0155] like Figure 1 As shown in Figures AB, alectinib alone upregulated both APOBEC3A transcriptional and protein levels in H3122 cells. In contrast, the combination of alectinib and B3 significantly inhibited both APOBEC3A transcriptional and protein levels.

[0156] like Figure 1As shown in C, osimertinib alone upregulated APOBEC3A transcription in PC-9 cells, while the combination of osimertinib and B3 significantly inhibited APOBEC3A transcription.

[0157] Example 2: Effects of CDDO-imidazolide / CDDO-Im / B3 on cell proliferation and TKI resistance

[0158] 1. Materials

[0159] H3122 wild-type NSCLC cell line (human non-small cell lung adenocarcinoma cells expressing the EML4-ALK fusion gene), B3, alectinib.

[0160] 2. Method

[0161] (1) CCK-8 assay for cell proliferation

[0162] H3122 cells were seeded at a density of 4000 cells / well in 96-well plates (6 replicates per group). A blank control group (culture medium only, no cells) was set up. After seeding, the plates were incubated at 37°C for 24 h. After 24 h, the cells were divided into groups for drug treatment: DMSO group (DMSO only), B3 group (10 μM B3 only), Alectinib group (100 nm Alectinib only), and Alectinib + B3 group (100 nm Alectinib and 10 μM B3). CCK-8 working solution was added at different time points (0, 3, 6, 9 days), and after incubation at 37°C for 2 h, the absorbance at 490 nm was measured using a microplate reader, and growth curves were plotted.

[0163] (2) Cloning experiment

[0164] H3122 cells were fed with a dose of 4 × 10 5 Cells were seeded at a density of [number] cells / well in 6-well plates. The following day, when the cell density reached 40%, drug treatment was initiated. The Alectinib group received medium containing 100 nm Alectinib; the Alectinib+B3 group received medium containing 100 nm Alectinib and 10 μM B3. The medium and drugs were changed twice weekly. After 4-6 weeks of drug treatment, drug-resistant and durable cell clones grew on the plates. Cell clones were fixed with 4% PFA and stained with crystal violet. Finally, the number and area of ​​clones were quantitatively analyzed.

[0165] 3. Results

[0166] Figure 2Results A showed that, compared with the control group DMSO, B3 treatment alone had no effect on cell proliferation; the addition of Alectinib significantly inhibited cell proliferation; and there was no significant difference in cell proliferation between the Alectinib + B3 combined treatment group and the Alectinib alone group. This indicates that B3 has no significant effect on the proliferation of normal cells.

[0167] Clonogenesis experiments showed that the number and area of ​​clones in the Alectinib + B3 combination group were significantly lower than those in the Alectinib alone group. Figure 2 (BD), these results indicate that B3 inhibits the formation of drug-resistant persistent cell clones and enhances the sensitivity of lung cancer cells to alectinib.

[0168] Example 3: The role of CDDO-imidazolide / CDDO-Im / B3 in a nude mouse xenograft model resistant to targeted drug TKIs

[0169] 1. Materials

[0170] BALB / cNude mice (female, 4-5 weeks old), H3122 wild-type NSCLC cell line (human non-small cell lung adenocarcinoma cells expressing the EML4-ALK fusion gene), B3, alectinib.

[0171] 2. Method

[0172] (1) Xenotransplantation and drug administration of lung cancer in nude mice

[0173] H3122 cell suspension was mixed with matrix gel at a 1:1 ratio and diluted to 5 x 10⁶ cells / 100 μL. 100 μL of the cell suspension was then injected into the right axilla of nude mice. When the tumor reached approximately 300 mm³, the tumor-bearing mice were randomly divided into three groups of 5-6 mice each: control group (saline), alectinib-resistant group (Alectinib, 30 mg / kg, orally administered via gavage, 4-5 times / week), and alectinib + B3 combination group (Alectinib, 30 mg / kg, orally administered via gavage; B3, 0.1 mg / kg, intraperitoneally injected, 4-5 times / week). Mouse weight and tumor volume were measured twice weekly. Tumor volume = length x width² / 2. Treatment continued for approximately two months, after which the mice were sacrificed and the tumors were dissected.

[0174] (2) Staining of paraffin sections

[0175] After dissection, tumor tissue was immediately immersed in 4% paraformaldehyde solution and fixed overnight at 4°C. The fixed tissue was then dehydrated using an ethanol gradient and subsequently embedded in paraffin. The paraffin-embedded tumor tissue sections were baked and stored at room temperature for later use. For immunofluorescence staining, the sections were first dewaxed, then blocked with 3% BSA at room temperature for 1 hour, and incubated overnight at 4°C with primary antibody Ki67 (abcam, ab16667) or Cleaved Caspase-3 (cellsignaling, #9661). The next day, incubation was performed with the corresponding secondary antibody. Next, DAPI was used to stain the cell nuclei. Finally, the sections were mounted. Images of the stained sections were acquired using a confocal microscope for subsequent analysis.

[0176] 3. Results

[0177] like Figure 3 As shown in Figure A, in the absence of drug treatment, the tumor volume in the control group mice gradually increased. When the tumor volume reached 2000 mm... 3 At approximately 12 days, this exceeded ethical limits, therefore the control group mice were euthanized. In the alectinib-resistant group, tumor volume shrank rapidly after alectinib monotherapy, but over time, approximately one month after administration, tumor resistance began to develop, and the volume gradually increased. In contrast, the alectinib+B3 group, using a regimen of alectinib combined with B3, significantly reduced tumor volume in the early stages of treatment and maintained tumor size close to 0 mm. 3 The level was [value missing], and no tumor recurrence was observed during subsequent administration.

[0178] At the same time, such as Figure 3 As shown in Figure B, there were no significant differences in mean body weight among the control group, the Alectinib-resistant group, and the Alectinib+B3 group during the treatment period. These results indicate that B3 overcomes alectinib resistance and has no significant toxic side effects on the health of mice.

[0179] 74 days after administration, mice in the Alectinib-resistant group and the Alectinib+B3 group underwent anatomical dissection and tissue collection. Tumor size and weight after dissection are as follows: Figure 3 As shown in CD. Compared with the Alectinib-resistant group, the Alectinib+B3 group showed a significant reduction in both tumor size and weight.

[0180] like Figure 3As shown in the EH results, the Ki67 staining results of tumor sections revealed that the proportion of Ki67-positive cells in the tumors of mice in the Alectinib+B3 group was significantly lower than that in the Alectinib-resistant group. Furthermore, the staining results of the apoptosis marker Cleaved Caspase-3 showed a significantly enhanced positive signal in the tumor tissues of mice in the Alectinib+B3 group.

[0181] These results demonstrate that CDDO-imidazolide / CDDO-Im / B3 can effectively reverse TKI-induced drug resistance, significantly inhibit tumor growth, and promote tumor shrinkage. Furthermore, no significant toxic side effects were observed in mice during treatment. Notably, this effect is not only observed in TKI-induced resistance in lung cancer, but also shows potential application value in resistance to other types of cancer and their corresponding targeted drugs.

[0182] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. Use of a compound (I) or a pharmaceutically acceptable salt thereof for the preparation of a medicament for the treatment of drug-resistant tumors; in, The compound (I) has the following structure:

2. A pharmaceutical composition for treating drug-resistant tumors, said pharmaceutical composition comprising a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier; 3. A drug combination, characterized in that, The drug combination comprises a first active pharmaceutical ingredient and a second active pharmaceutical ingredient; The first active pharmaceutical ingredient is a compound of formula I or a pharmaceutically acceptable salt thereof; The second active ingredient in the drug is a tyrosine kinase inhibitor for treating tumors.

4. The use of the pharmaceutical combination according to claim 3, characterized in that, Used to prepare drugs that inhibit tumors.

5. A pharmaceutical composition, characterized in that, Include: (a) A compound of formula I or a pharmaceutically acceptable salt thereof that is the first active ingredient; (b) a tyrosine kinase-targeting drug resistance inhibitor as a second active ingredient; and (c) Pharmaceutically acceptable carriers.

6. A medicine box, characterized in that, include: (a) A first container, and a first pharmaceutical composition located within the first container, the first pharmaceutical composition containing a compound of formula I or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier as a first active ingredient; (b) a second container, and a second pharmaceutical composition located within the second container, the second pharmaceutical composition containing a tyrosine kinase-targeting drug resistance inhibitor as a second active ingredient and a pharmaceutically acceptable carrier.

7. A medicine box, characterized in that, include: (a) A first container, and a first pharmaceutical composition located within the first container, the first pharmaceutical composition containing a compound of formula I or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier as a first active ingredient; and (b) a second container, and a second pharmaceutical composition located within the second container, the second pharmaceutical composition containing a tyrosine kinase-targeting drug resistance inhibitor as a second active ingredient and a pharmaceutically acceptable carrier; and (c) The third container, and the detection reagent for detecting APOBEC3A expression located in the third container.

8. A method for reversing drug resistance in tumor cells, characterized in that, Including the following steps: (a) Culture drug-resistant tumor cells in the presence of a compound of formula I or a pharmaceutically acceptable salt thereof, thereby reducing the drug resistance of the tumor cells:

9. A method for treating tumors, characterized in that, The procedure includes the following steps: administering a therapeutically effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof to the recipient.

Images