Clostridium aerovorans for ester synthesis as well as construction method and application of clostridium aerovorans

By metabolically engineering Clostridium yangnifolium and overexpressing the optimized acyltransferase opATF1 gene, short-chain fatty acid esters can be synthesized using one-carbon gas as a raw material. This solves the problems of equipment corrosion, environmental pollution, and high cost in existing technologies, and achieves efficient and environmentally friendly ester synthesis.

CN120988959APending Publication Date: 2025-11-21NANJING SHIQI BIOCHEMICAL TECH CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511158642.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-19
Publication Date
2025-11-21

AI Technical Summary

Technical Problem

In existing technologies, the chemical synthesis of short-chain fatty acid esters suffers from problems such as equipment corrosion, numerous byproducts, low yield, complex post-processing steps, and severe environmental pollution. Biological synthesis is costly and it is difficult to modify Clostridium to secrete lipases.

Method used

By metabolically engineering Clostridium yangnifolium and overexpressing the codon-optimized acyltransferase opATF1 gene from Saccharomyces cerevisiae, short-chain fatty acid esters are synthesized in Clostridium yangnifolium using one-carbon gas as a raw material, avoiding the addition of exogenous lipases and alcohols, and improving the product synthesis efficiency through fermentation engineering.

Benefits of technology

This method enables the efficient synthesis of short-chain fatty acid esters under mild conditions, reducing raw material costs, minimizing environmental pollution, and improving the synthesis efficiency and purity of the products, thus possessing industrialization potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120988959A_ABST
    Figure CN120988959A_ABST
Patent Text Reader

Abstract

The invention discloses ester-synthesized clostridium aerovorans as well as a construction method and application thereof, and belongs to the technical field of genetically engineered bacterium, genetically engineered clostridium aerovorans capable of synthesizing ester is constructed, a clostridium Yangtinctorii engineering strain synthesized by butanol is taken as a host, and alcohol acyltransferase ATF1 gene from saccharomyces cerevisiae is over-expressed, so that the ester-synthesized clostridium aerovorans is obtained. The clostridium Yangtsangensis genetic engineering strain capable of producing various esters is obtained; 1.4 g / L of butyl acetate can be obtained from the genetic engineering strain in serum bottle fermentation; the fermentation yield can be further increased in a 3L fermentation tank, 12.5 g / L of butyl acetate is obtained, and meanwhile, a small amount of ester compounds such as ethyl acetate, ethyl butyrate and butyl butyrate are obtained; the genetic engineering clostridium aerovorans disclosed by the invention is suitable for fermenting green gases such as synthesis gas serving as raw materials to synthesize green butyl acetate.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetically engineered bacteria, and particularly relates to a Clostridium aceticum for ester synthesis and a construction method and application thereof. BACKGROUND

[0002] Short-chain fatty acid esters are a class of substances widely existing in nature, which have a pleasant fragrance and mainly exist in fruits such as apples, bananas and strawberries. Due to its solubility in various organic substances, low toxicity and good volatility, it is often used in the industries of glue, paint and cosmetics; it can also be used as a solvent and carrier for perfumes, food additives, medicines and plays an important role in the fields of food and medicine; in addition, fatty acid esters are a kind of fuel with many excellent properties, which can be added to gasoline, diesel and even aviation fuel to improve the combustion performance of the target fuel.

[0003] At present, short-chain fatty acid esters are generally synthesized by Fischer esterification. For example, the industrial synthesis of butyl acetate usually uses butanol and excess acetic acid as raw materials to perform esterification under the catalysis of concentrated sulfuric acid. Due to the high reaction temperature (above 110℃) and the use of concentrated sulfuric acid, there are generally disadvantages such as equipment corrosion, many by-products, low yield, complex post-processing steps and easy environmental pollution.

[0004] Although there are currently studies that can replace milder catalysts to synthesize short-chain fatty acid esters, the problems of environmental pollution and many by-products that exist in chemical synthesis products cannot be avoided.

[0005] Biological synthesis of short-chain fatty acid esters has the advantages of mild reaction conditions, high reaction specificity and environmental friendliness. Clostridium is a potential host for biological synthesis of short-chain fatty acid esters because its fermentation products are generally short-chain fatty acids or alcohols. At present, biological methods mainly include enzyme method and direct fermentation method. The enzyme method uses Clostridium saccharolyticum to ferment or exogenously adds short-chain fatty acids and fatty alcohols, and then adds lipase to catalyze the esterification between the two to generate short-chain fatty acid esters. The exogenous addition of lipase increases the cost of ester production, and it is also difficult to secrete lipase by modifying Clostridium, so this scheme has not made progress.

[0006] Another scheme is to express alcohol acyltransferase in Clostridium to directly synthesize esters in one step with alcohol and acyl-CoA as substrates. At present, alcohol acyltransferase has been expressed in some Clostridium saccharolyticum, which can synthesize short-chain fatty acid esters, but the cost of biological synthesis with glucose as raw material is high, and there is still a certain distance from industrialization.

[0007] In order to overcome the above problems, cheap one-carbon gas such as steel plant tail gas and synthesis gas is used as a substrate to synthesize high-value bulk chemicals, which has broad industrial prospects. Clostridium autoethanogenum can utilize one-carbon gas to synthesize acetic acid and ethanol. Through metabolic engineering, Clostridium autoethanogenum represented by Clostridium ljungdahlii can utilize one-carbon gas as a carbon source to synthesize butyric acid, butanol, isopropanol, 3-hydroxybutyric acid and other products. Clostridium autoethanogenum for butanol synthesis has high content of acetyl-CoA, butyryl-CoA, ethanol and butanol, and through overexpression of alcohol acyltransferase, it can synthesize short-chain fatty acid esters such as butyl acetate, ethyl acetate, ethyl butyrate and butyl butyrate. SUMMARY

[0008] The technical problems solved by the present application are: in view of the problems of device corrosion, byproducts, low yield, complex post-processing steps, easy environmental pollution, and the problems of environmental pollution and byproducts in chemical synthesis, it is also difficult to secrete lipase by Clostridium, and the cost of biological synthesis using glucose as raw material is high, the present application provides a Clostridium for ester synthesis, a construction method and application thereof, and the Clostridium for ester synthesis using one-carbon gas as raw material. The engineering strain takes Clostridium autoethanogenum for butanol production as a chassis, overexpresses the optimized alcohol acyltransferase opATF1 gene from Saccharomyces cerevisiae, and can synthesize the main product butyl acetate and a small amount of byproducts such as ethyl acetate, ethyl butyrate and butyl butyrate under the action of exogenous ATF1.

[0009] The technical scheme is: a Clostridium for ester synthesis is constructed by constructing a recombinant expression plasmid, overexpressing the alcohol acyltransferase opATF1 gene from Saccharomyces cerevisiae S288C and optimized by codon in the Clostridium.

[0010] Preferably, the host strain used is Clostridium, specifically Clostridium autoethanogenum, Clostridium carboxidivorans or modified Clostridium ljungdahlii, and the modified Clostridium ljungdahlii is constructed by integrating the relevant genes for butanol production in wild-type Clostridium ljungdahlii DSM 13528.

[0011] Preferably, the optimized alcohol acyltransferase opATF1 gene has a nucleic acid sequence as shown in SEQ ID NO. 1; the alcohol acyltransferase ATF1 is from Saccharomyces cerevisiae, i.e. Saccharomyces cerevisiae S288C, and the original gene nucleic acid sequence is as shown in SEQ ID NO. 3, and the promoter for overexpression of the opATF1 gene is the endogenous promoter P ptaThe nucleic acid sequence of which is shown as SEQ ID NO. 2.

[0012] Preferably, the Clostridium ljungdahlii as the host is genetically engineered bacteria itself, which has the ability to produce ethanol and butanol.

[0013] Preferably, the overexpression plasmid used is based on pMTL83151 plasmid backbone, and the overexpression plasmid pMTL83151-opATF1 is constructed and transformed into Clostridium ljungdahlii.

[0014] Preferably, the method for constructing the ester-synthesizing Clostridium aceticum comprises the following steps:

[0015] First step: PCR amplification of P pta Promoter and opATF1 gene;

[0016] Second step: ligation of the target gene and the double-digested vector;

[0017] Third step: transformation of the ligation product into E. coli TOP10, plating of the positive transformants on LB medium with chloramphenicol resistance, and sequencing to confirm the correct recombinant plasmid pMTL83151-opATF1;

[0018] Fourth step: transformation of the recombinant plasmid into the modified Clostridium ljungdahlii CLJ-BuOH capable of producing butanol by electroporation, to obtain the genetically engineered Clostridium ljungdahlii strain CLJ-opATF1.

[0019] An ester-synthesizing Clostridium aceticum obtained by any of the above-mentioned construction methods, specifically the genetically engineered Clostridium aceticum strain CLJ-opATF1.

[0020] The application also discloses an application of the ester-synthesizing Clostridium aceticum in gas fermentation production of short-chain fatty acid esters, wherein the Clostridium ljungdahlii CLJ-opATF1 overexpressing opATF1 gene to produce esters is inoculated into a culture medium to perform anaerobic gas fermentation to synthesize short-chain fatty acid esters, the fermentation is performed in a serum bottle or a 3L fermentation tank, the liquid loading amount is 30 mL or 2L, the inoculation amount is 1-20% of the volume of the liquid loading amount, the serum bottle or the 3L fermentation tank is filled with four-component gas to 0.2 MPa, and the fermentation is performed at 37°C and 100 rpm, wherein the four-component gas is CO:CO2:H2:N2=56%:20%:9%:15%.

[0021] Preferably, the fermentation medium is a modified American Type Culture Collection (ATCC) 1754 medium, with double the amount of mineral salts and no added fructose or sodium bicarbonate; the ATCC The 1754 culture medium has the following specific formula: ammonium chloride 1 g / L, potassium chloride 0.1 g / L, magnesium sulfate heptahydrate 0.2 g / L, sodium chloride 0.8 g / L, potassium dihydrogen phosphate 0.1 g / L, yeast extract 1 g / L, calcium chloride dihydrate 0.04 g / L, sodium selenite 0.2 mg / L, nickel chloride hexahydrate 0.2 mg / L, sodium tungstate dihydrate 0.2 mg / L, biotin 0.02 mg / L, folic acid 0.02 mg / L, pyridoxine hydrochloride 0.1 mg / L, thiamine 0.05 mg / L, riboflavin 0.05 mg / L, niacin 0.05 mg / L, D-calcium pantothenate 0.05 mg / L, cobalamin 0.001 mg / L, para-aminobenzoic acid 0.05 mg / L, and lipoic acid 0.05 mg / L.

[0022] Furthermore, the product is butyl acetate, and the byproducts are ethyl acetate, ethyl butyrate, and butyl butyrate; the carbon source used is a mixed gas consisting of carbon monoxide, carbon dioxide, and hydrogen.

[0023] Beneficial effects:

[0024] Compared with the prior art, the present invention has the following advantages:

[0025] 1. The present invention uses Clostridium aeruginosa produced by butanol as the host strain, which contains abundant acyl-CoA and short-chain fatty alcohols during growth and product synthesis, and can synthesize short-chain fatty acid esters in the next step under the action of alcohol acyltransferase.

[0026] 2. No exogenous acid or alcohol needs to be added as a substrate during fermentation, nor is it necessary to add lipase to assist catalysis, which greatly reduces the cost of raw materials;

[0027] 3. The strain of this invention can directly synthesize short-chain fatty acid ester products using inexpensive gas sources such as syngas and steel plant tail gas as substrates. Compared with using glucose as a substrate, it further reduces raw material costs and has the potential for industrialization.

[0028] 4. This invention provides an aerobic Clostridium for ester synthesis, its construction method, and its application. The strain provided by this invention has a high ability to synthesize butyl acetate, and the fermentation level of butyl acetate can be further improved through metabolic engineering and fermentation engineering. It can also improve the yield of ethyl acetate, ethyl butyrate, and butyl butyrate by changing the substrate preference of acyl alcohol transferase through protein engineering. Attached Figure Description

[0029] Figure 1This is the metabolic pathway by which Clostridium aeruginosa synthesizes short-chain fatty acid esters according to this application;

[0030] Figure 2 This is the spectrum of the recombinant plasmid pMTL83151-opATF1 in this application;

[0031] Figure 3 These are the results of screening plates and PCR verification of positive E. coli clones during the construction of the recombinant plasmid pMTL83151-opATF1 in this application;

[0032] Figure 4 The recombinant plasmid pMTL83151-opATF1 of this application was electroporated into the Clostridium aeruginosa host strain CLJ-BuOH, and positive transformants were screened by 5 mg / L thiamphenicol to obtain the recombinant strain CLJ-opATF1 (Figure 1).

[0033] Figure 5 This is a graph showing the yield of short-chain fatty acid esters of the strain CLJ-opATF1 in this application after fermentation in serum bottles using optimized ATCC 1754 medium for 72 hours.

[0034] Figure 6 This is a graph showing the yield of short-chain fatty acid esters of the strain CLJ-opATF1 in this application after fermentation for 72 hours in a 3L fermenter using optimized ATCC 1754 medium. Detailed Implementation

[0035] The present invention will be further described in detail below through specific embodiments. Those skilled in the art should understand that the embodiments are merely illustrative of the invention and should not be considered as specific limitations thereof.

[0036] In the following examples, the Clostridium aerogenes host strain used was Clostridium yangnii CLJ-BuOH, which was constructed by integrating butanol production-related genes into the wild-type Clostridium yangnii (Clostridium ljungdahlii DSM 13528) (Huang H, Chai C, Yang S, et al. Phage serine integrase-mediated genome engineering for efficient expression of chemical biosynthetic pathway in gas-fermenting Clostridium ljungdahlii[J].Metabolic engineering,2019,52:293-302.).

[0037] The YTF medium formula used for the growth, transformation and resuscitation of Clostridium aeruginosa is as follows: yeast extract 10 g / L, peptone 16 g / L, sodium chloride 4 g / L, cysteine ​​hydrochloride 0.75 g / L, fructose 5 g / L.

[0038] The optimized ATCC 1754 culture medium formula used for Clostridium aeruginosa fermentation is as follows: ammonium chloride 1 g / L, potassium chloride 0.1 g / L, magnesium sulfate heptahydrate 0.2 g / L, sodium chloride 0.8 g / L, potassium dihydrogen phosphate 0.1 g / L, yeast extract 1 g / L, calcium chloride dihydrate 0.04 g / L, sodium selenite 0.2 mg / L, nickel chloride hexahydrate 0.2 mg / L, sodium tungstate dihydrate 0.2 mg / L, biotin 0.02 mg / L, folic acid 0.02 mg / L, pyridoxine hydrochloride 0.1 mg / L, thiamine 0.05 mg / L, riboflavin 0.05 mg / L, niacin 0.05 mg / L, D-calcium pantothenate 0.05 mg / L, cobalamin 0.001 mg / L, para-aminobenzoic acid 0.05 mg / L, and lipoic acid 0.05 mg / L.

[0039] Example 1

[0040] An ester-synthesizing Clostridium aerogenes is disclosed. The ester-synthesizing Clostridium aerogenes is constructed by overexpressing the codon-optimized acyltransferase opATF1 gene from *Saccharomyces cerevisiae* S288C within a recombinant expression plasmid. The host strain used is *C. aerogenes*, specifically *Clostridium autoethanogenum*, *Clostridium carboxidivorans*, or a modified *Clostridium yangni*. The modified *Clostridium yangni* is constructed by integrating butanol production-related genes into the wild-type *Clostridium ljungdahlii* DSM 13528. The optimized acyltransferase opATF1 gene has the nucleic acid sequence shown in SEQ ID NO.1. The acyltransferase ATF1 is derived from *Saccharomyces cerevisiae* S288C, and its original gene nucleic acid sequence is shown in SEQ ID NO.3. The promoter used for opATF1 gene overexpression is the *Clostridium yangni* endogenous promoter P. pta Its nucleic acid sequence is shown in SEQ ID NO.2.

[0041] The optimized opATF1 gene for alcohol acyltransferase has the following nucleic acid sequence: SEQ ID NO.1:

[0042] atgaatgaaatagacgaaaaaaatcaggctcctgtacagcaagaatgtttaaaagagatgatacaaaatggacatgcaagaagaatgggttctgt

[0043] agaagatctttatgtagcattaaatcgtcaaaatttatatagaaatttttgtacttatggagaacttagtgattattgtacaagagatcaactgacccttg

[0044] cgcttagagaaatatgccttaagaatccaactctacttcatatagttttacctactagatggccaaatcacgaaaattattataggtccagcgaatatt

[0045] acagcaggccacatccagtccacgattatatatctgtacttcaggaactaaagttgtcaggtgtggtacttaatgaacagcctgaatactctgctgtt

[0046] atgaaacaaattttggaggaatttaaaaattcaaagggaagctatactgctaaaatatttaaattgactacaacattaactattccttattttggacctac

[0047] aggacctagctggagattaatatgtctcccagaagagcatacagaaaagtggaaaaaatttatctttgtaagtaatcattgtatgtcagatggaaga

[0048] agttctattcatttttttcatgatttaagggatgaattaaataatattaaaactccacctaaaaagttagattacatattcaaatatgaagaagactatcaa

[0049] ttgttgcggaagcttcctgagcctatagagaaagtaattgattttagaccgccctatttatttataccaaagtctttattatccggatttatttataatcattt

[0050] aagatttagttctaaaggtgtttgcatgagaatggatgatgtggaaaaaacagatgatgtagtgacagagataataaacataagtccaactgaattt

[0051] caggcaattaaagcaaatattaaatctaatatacaaggcaaatgtaccatcacaccttttttgcatgtttgctggtttgtttccttgcataaatggggaa

[0052] agttctttaagccattaaactttgaatggttaacggatatatttatacctgcagattgtagaagtcagcttccagatgacgatgaaatgaggcaaatgt

[0053] atagatatggtgcaaatgttggttttatagattttacaccatggatttcagagtttgatatgaatgataataaggaaaacttttggcctcttatagaacatt

[0054] atcatgaagttataagtgaagcacttcgcaataaaaaacacctgcatggacttggcttcaatatacagggatttgtacaaaaatacgtaaatattgat

[0055] aaagttatgtgtgatagagctataggtaaaagacgtgggggtactttactatcaaatgtaggactatttaatcaattagaagaacctgatgcaaaata

[0056] ttcaatttgtgacttagccttcggacaatttcaaggttcatggcatcaagctttttctctcggagtatgttctactaacgtaaaaggtatgaacattgttgttgctagtacaaaaaacgtagttggaagtcaggaatcacttgaagaattatgcagtatttataaagctttactattagggccatga。

[0057] Endogenous promoter P of Clostridium yangii pta, and its nucleic acid sequence is SEQ ID NO.2:

[0058] acattttgtagcagaacgagcactttcaatatgatatttatgtccattgtgaaagggattatattcaactattattccagttacgttcatagaaattttcctt

[0059] tctaaaatattttattccatgtcaagaactctgtttatttcattaaagaactataagtacaaagtatagggcatttgaaaaaataggctagtatattgattg

[0060] attatttattttaaaatgcctaagtgaaatatatacatattataacaataaaataagtattagtgtaggatttttaaatagagtatctattttcagattaaattt

[0061] ttgcttatttgatttacattatataatattgagtaaagtattgactagcaaaattttttgatactttaatttgtgaaatttcttatcaaaagttatatttttgaatgatttttattgaaaaatacaactaaaaaggattatagtataagtgtgtgtaattttgtgttaaatttaaagggaggaaatgaac。

[0062] The ATF1 gene of Saccharomyces cerevisiae S288C, and its nucleic acid sequence is SEQ ID NO.3:

[0063] atgaatgaaatcgatgagaaaaatcaggcccccgtgcaacaagaatgcctgaaagagatgattcagaatgggcatgctcggcgtatgggatct

[0064] gttgaagatctgtatgttgctctcaacagacaaaacttatatcgaaacttctgcacatatggagaattgagtgattactgtactagggatcagctcac

[0065] attagctttgagggaaatctgcctgaaaaatccaactttttacatattgttctaccaacaagatggccaaatcatgaaattattatcgcagttccga

[0066] atactattcacggccacatccagtgcatgattatatttcagtattacaagaattgaaactgagtggtgtggttctcaatgaacaacctgagtacagtg

[0067] footatgaagcaaaattatagaagaattcaaaaatagtaagggttcctatactgcaaaaatttttaaacttactaccactttgactattccttactttgga

[0068] ccaacaggaccgagttggcggctaatttgtcttccagaagagcacacagaaagtggaaaaaatttatctttgtatctaatcattgcatgtctgatg

[0069] gtcggtcttcgatccacttttttcatgatttaagagaggaattaaataatattaaaactccaccaaaaaaaattagattacattttcaagtacgaggag

[0070] ttaccaattattgagaaacttccagaaccgatcgaaaggtgatagactttagaccaccgtacttgtttattccgaagtcacttctttcgggtttcatc

[0071] tacaatcatttgagatttcttcaaaaggtgtctgtatgagaatggatgatgtggaaaaaaccgatgatgttgtcaccgagatcatcaatatttcacca

[0072] acagaatttcaagcgattaaagcaaatattaaatcaaatatccaaggtaagtgtactatcactccgtttttacatgtttgttggtttgtatctcttcataaa

[0073] tggggtaaatttttcaaaccattgaacttcgaatggcttacggatatttttatccccgcagattgccgctcacaactaccagatgatgatgaaatgag

[0074] acagatgtacagatatggcgctaacgttggatttattgacttcaccccctggataagcgaatttgacatgaatgataacaaagaaaatttttggccac

[0075] ttatgagcactaccatgaagtaatttcggaagctttaagaaataaaaagcatctccatggcttagggttcaatatacaaggcttcgttcaaaaatatg

[0076] tgaacattgacaaggtaatgtgcgatcgtgccatcgggaaaagacgcggaggtacattgttaagcaatgtaggtctgtttaatcagttagaggag

[0077] cccgatgccaaatattctatatgcgatttggcatttggccaatttcaaggatcctggcaccaagcattttccttgggtgtttgttcgactaatgtaaagg

[0078] ggatgaatattgttgttgcttcaacaaagaatgttgttggtagtcaagaatctctcgaagagctttgctccatttacaaagctctccttttaggcccttag.

[0079] The construction of the Clostridium yangnifolium engineered strain CLJ-opATF1 overexpressing the opATF1 gene was carried out in the following steps:

[0080] Step 1: Using pMTL83151 as the plasmid backbone, construct the recombinant plasmid pMTL83151-opATF1.

[0081] The specific construction method includes the following steps:

[0082] 1) PCR amplification of P pta Promoter and opATF1 gene.

[0083] The endogenous promoter P was amplified using primers pta-F (nucleotide sequence SEQ ID NO.4: ATATGCCCGGGGATCCCATTTGTCAACTATAGATGG) and pta-R (nucleotide sequence SEQ ID NO.5: CTAAGGATCCTCCTGGTACCTTTAAATTTAACACAAAATT). pta The synthesized codon-optimized opATF1 gene was amplified using primers opATF1-F (nucleotide sequence SEQ ID NO.6: TAAAGGTACCAGGAGGATCCTTAGATGAATGAAATAGACG) and opATF1-R (nucleotide sequence SEQ ID NO.7: CAGGCCTCGAGTCATGGCCCTAATAGTAAAG), and then the two were amplified into a single fragment P using overlap PCR. pta -opATF1.

[0084] 2) The target gene is ligated to the double-enzyme digestion vector.

[0085] Fragment P was cleaved using restriction endonucleases SmaI and XhoI. pta -opATF1 and backbone plasmid pMTL83151 were digested with enzymes, recovered, and ligated overnight with T4 ligase.

[0086] 3) E. coli transformation and verification.

[0087] The ligation product was transformed into E. coli TOP10, and positive transformants were screened on chloramphenicol-resistant LB medium plates. The correct recombinant plasmid pMTL83151-opATF1 was confirmed by sequencing using universal primers M13F and M13R.

[0088] Step 2: The recombinant plasmid pMTL83151-opATF1 was transformed into Clostridium yangi CLJ-BuOH by electroporation. Positive transformants were screened on YTF medium plates resistant to thiamphenicol. The transformants were verified by PCR using universal primers M13F and M13R. The sequencing results of the PCR product were consistent with the opATF1 gene, thus obtaining the genetically engineered Clostridium yangi strain CLJ-opATF1.

[0089] Example 2

[0090] Short-chain fatty acid esters were produced by serum flask fermentation of the engineered Clostridium yangyi strain CLJ-opATF1. Fermentation was carried out in 125 mL Wheaton serum flasks (Sigma-Aldrich, USA), with a working volume of 30 mL. The specific steps are as follows:

[0091] 1) A single colony of CLJ-opATF1 was cultured in YTF medium for 24 hours. When the optical density (OD) of the cells was... 600 When the pH reaches 0.5-1.0, transfer approximately 5% (v / v) of the medium to 30 mL of optimized ATCC 1754 medium.

[0092] 2) Aerate the serum bottles to 0.2 MPa, with the gas composition being CO-CO2-H2-N2 (56% / 20% / 9% / 15%). Incubate the serum bottles horizontally in a shaking incubator at 37°C and 100 rpm.

[0093] 3) Refill the gas to 0.2 MPa every 24 hours until the final product is measured after 72 hours.

[0094] The final product of serum bottle fermentation is shown below. Figure 5 After 72 hours of fermentation, a total of 1.4 g / L of butyl acetate was synthesized, along with approximately 0.1 g / L of butyl butyrate. Ethyl acetate and ethyl butyrate were not detected.

[0095] Example 3

[0096] The engineered strain of Clostridium yangi, CLJ-opATF1, was used to further increase the yield of short-chain fatty acid esters in a 3L fermenter. The specific steps are as follows: 1) Prepare 400mL of seed culture medium and culture overnight.

[0097] 2) Ensure seed OD before inoculation 600 The value was between 0.8 and 1.0. Seeds were inoculated into a 3L fermenter containing 2L of optimized ATCC1754 medium under anaerobic conditions.

[0098] 3) After inoculation, the temperature should be controlled at 37℃, and the stirring speed should be controlled at 200-500 rpm (initially 200 rpm; increase by 50 rpm every 12 hours; increase to 500 rpm after 72 hours). Throughout the fermentation process, the gas flow rate should be maintained at 400 mL / min, and the pH should be controlled at around 5.0 with ammonia.

[0099] 4) Fermentation continued for 144 hours. The final fermentation broth was taken and extracted with n-dodecane. The total concentration of short-chain fatty acid esters in the extract and the remaining fermentation broth was determined by gas chromatography and then converted into the final yield in the fermenter.

[0100] The final product of the 3L fermenter fermentation is shown below. Figure 6After 144 hours of fermentation, a total of 12.5 g / L of butyl acetate was synthesized, along with 0.8 g / L of butyl butyrate, 0.04 g / L of ethyl acetate, and 0.02 g / L of ethyl butyrate. Compared with the existing technology CN112538451A, which uses Clostridium beyerrix overexpressing the ATF gene to produce butyl acetate, this invention utilizes a more difficult-to-ferment gaseous feedstock to achieve a higher yield of short-chain fatty acid esters, resulting in a significant and unpredictable improvement in technical performance.

Claims

1. A method for constructing an ester-synthesizing Clostridium aeruginosa, characterized in that, The ester-synthesizing Clostridium aeruginosa was constructed by overexpressing the opATF1 gene of acyl alcohol transferase from Saccharomyces cerevisiae S288C, which was codon-optimized, in Clostridium aeruginosa using a recombinant expression plasmid.

2. The method for constructing an ester-synthesizing Clostridium aeruginosa according to claim 1, characterized in that, The host strain used is Clostridium aerogenes, specifically Clostridium autoethanogenum, Clostridium carboxidivorans, or a modified Clostridium yangnii. The modified Clostridium yangnii was constructed by integrating butanol production-related genes into the wild-type Clostridium ljungdahlii DSM 13528.

3. The method for constructing an ester-synthesizing Clostridium aeruginosa according to claim 1, characterized in that, The optimized acyltransferase opATF1 gene has the nucleic acid sequence shown in SEQ ID NO.

1. Acyltransferase ATF1 originates from *Saccharomyces cerevisiae*, specifically *Saccharomyces cerevisiae* S288C, and its original gene nucleic acid sequence is shown in SEQ ID NO.

3. The promoter used for opATF1 gene overexpression is the *Clostridium yangii* endogenous promoter P. pta Its nucleic acid sequence is shown in SEQ ID NO.

2.

4. The method for constructing an ester-synthesizing Clostridium aeruginosa according to claim 1, characterized in that, The *Clostridium yangi* strain, which serves as the host, is a genetically engineered bacterium capable of producing ethanol and butanol.

5. The method for constructing an ester-synthesizing Clostridium aeruginosa according to claim 1, characterized in that, The overexpression plasmid used was pMTL83151-opATF1, which was constructed based on pMTL83151 as the plasmid backbone and transformed into Clostridium yangniger.

6. The method for constructing an ester-synthesizing Clostridium aeruginosa according to claim 1, characterized in that, Includes the following steps: Step 1: PCR amplification of P pta Promoter and opATF1 gene; Step 2: Ligate the target gene to the double-enzyme digestion vector; Step 3: The ligation product was transformed into E. coli TOP10, and positive transformants were screened using chloramphenicol-resistant LB medium plates. Sequencing confirmed the correct recombinant plasmid pMTL83151-opATF1. Step 4: The recombinant plasmid was transformed into Clostridium yangnifolium CLJ-BuOH by electroporation to obtain the genetically engineered Clostridium yangnifolium strain CLJ-opATF1.

7. A Clostridium aeruginosa synthesized from esters obtained by any one of the construction methods of claims 1-6, characterized in that: The Clostridium aerogenes is specifically the genetically engineered Clostridium aerogenes strain CLJ-opATF1.

8. The application of the aerobic Clostridium perfringens of claim 7 in the gaseous fermentation production of short-chain fatty acid esters, characterized in that: Clostridium yangi CLJ-opATF1, which overexpresses the opATF1 gene to produce esters, was inoculated into a culture medium and subjected to anaerobic gas fermentation to synthesize short-chain fatty acid esters. Fermentation was carried out in serum bottles or 3L fermenters with a liquid volume of 30mL or 2L. The inoculum volume was 1-20% of the liquid volume. The serum bottles or 3L fermenters were filled with a quaternary gas to 0.2MPa and fermented at 37℃ and 100rpm. The quaternary gas had a composition of CO:CO2:H2:N2 = 56%:20%:9%:15%.

9. The application according to claim 8, characterized in that, The fermentation medium is a modified American Type Culture Collection (ATCC) 1754 medium, with the mineral salts doubled and fructose and sodium bicarbonate omitted. The specific formulation of the ATCC 1754 medium is as follows: ammonium chloride 1 g / L, potassium chloride 0.1 g / L, magnesium sulfate heptahydrate 0.2 g / L, sodium chloride 0.8 g / L, potassium dihydrogen phosphate 0.1 g / L, yeast extract 1 g / L, calcium chloride dihydrate 0.04 g / L, sodium selenite 0.2 mg / L, nickel chloride hexahydrate 0.2 mg / L, sodium tungstate dihydrate 0.2 mg / L, biotin 0.02 mg / L, folic acid 0.02 mg / L, pyridoxine hydrochloride 0.1 mg / L, thiamine 0.05 mg / L, riboflavin 0.05 mg / L, and niacin 0.05 mg / L. D-Calcium Pantothenate 0.05 mg / L, Cobalamin 0.001 mg / L, Para-aminobenzoic Acid 0.05 mg / L, Lipoic Acid 0.05 mg / L.

10. The application according to claim 8, characterized in that, The product is butyl acetate, and the byproducts are ethyl acetate, ethyl butyrate, and butyl butyrate; the carbon source used is a mixed gas consisting of carbon monoxide, carbon dioxide, and hydrogen.

Citation Information

Patent Citations

  • ATF gene overexpression clostridium beijerinckii for producing butyl acetate

    CN112538451A