Lipase mutant with synchronously improved acid tolerance and thermal stability as well as preparation method and application of lipase mutant

Abstract

The invention relates to a lipase mutant with synchronously improved acid tolerance and thermal stability and a preparation method and application thereof, the amino acid sequence of the lipase mutant is based on the sequence shown in SEQ ID NO: 1, isoleucine at the 224th site is mutated into tryptophan, and / or alanine at the 282nd site is mutated into leucine. Compared with a wild type, the strain shows higher enzyme activity in an acid environment and a high-temperature environment; the (t50) of the lipase mutant is respectively improved by 9 DEG C and 6 DEG C, the half-life periods (t1 / 2) at 45 DEG C are respectively prolonged by 6.25 times and 4.58 times compared with the wild type, and the half-life periods (t1 / 2) at 70 DEG C are respectively prolonged by 7 times and 4 times compared with the wild type; meanwhile, when p-nitrophenol palmitate is used as a substrate, the catalytic efficiencies of the two mutants are respectively improved by 2.3 times and 1.54 times compared with those of the wild type.

Description

Technical Field

[0001] This invention relates to the field of microbial and enzyme engineering technology, and in particular to lipase mutants with simultaneously enhanced acid tolerance and thermal stability, their preparation methods, and applications. Background Technology

[0002] Biodiesel can be produced through the esterification of free fatty acids or the transesterification of triglycerides. Currently, production mainly relies on virgin vegetable oils (such as soybean oil and rapeseed oil), which account for 70-80% of the total production cost. Therefore, non-edible oils (such as castor oil and jatropha oil), low-value lipids (such as animal fats and waste cooking oil), and microalgae have become more attractive alternative feedstocks, with the choice depending on regional availability and economics. Chemical production typically requires a two-stage reaction system to accommodate different esterification / transesterification conditions. In contrast, lipase-catalyzed methods can produce biodiesel in a single reactor without producing saponifications and are more adaptable to changes in the feedstock supply chain. Immobilized enzymes also facilitate separation from the product, simplifying downstream processes and reducing costs.

[0003] Lipases (triacylglycerol hydrolases, EC 3.1.1.3) mediate the conversion of triacylglycerols into free fatty acids in organisms. Their substrates are primarily natural oils and fats, but they can also stereospecifically hydrolyze them to synthesize esters. In low-water environments, lipases can catalyze ester synthesis (esterification of alcohols with carboxylic acids or transesterification of alcohols with esters). Therefore, lipases are widely used in ester synthesis in detergents, pharmaceuticals, and the food / energy industries. However, their limited thermal stability and other limitations restrict their application in specific industrial settings. High thermal stability is a key factor for the success of industrial bioprocesses: reaction rates increase exponentially with temperature until enzyme denaturation; and improved thermal stability is also associated with the enzyme's long-term survival under mild conditions and its activity under harsh process conditions. Therefore, industry constantly seeks lipases with excellent thermal stability—even small improvements can significantly reduce production costs.

[0004] Because different industries have varying requirements for the properties of lipases, research on improving lipases with application potential remains of great significance. Screening for lipases capable of producing high-performance enzymes and then modifying them using genetic engineering or protein engineering to improve their performance has important theoretical and practical value for industry. Summary of the Invention

[0005] Technical Problem Solved: The purpose of this invention is to provide a lipase mutant with enhanced acid tolerance and thermal stability, its construction method, and its applications, thereby solving the problems existing in the prior art. The lipase mutant of this invention is obtained by point mutation of the amino acids in the wild-type lipase. This mutant exhibits high enzyme activity at both acidic and neutral pH conditions and can withstand high-temperature treatment above 50°C, showing great application potential in industrial fields such as waste oil degradation, feed, bioenergy, and food.

[0006] Technical solution: A lipase mutant, whose amino acid sequence is based on the sequence shown in SEQ ID NO:1, by mutating isoleucine at position 224 to tryptophan, and / or mutating alanine at position 282 to leucine.

[0007] When position 224 is mutated to tryptophan, the amino acid sequence is shown in SEQ ID NO:2; when position 282 is mutated to leucine, the amino acid sequence is shown in SEQ ID NO:3.

[0008] A nucleic acid molecule encoding the above-mentioned lipase mutant, wherein the nucleotide sequence is as shown in SEQ ID NO:5 when encoding tryptophan at position 224 is mutated, and the nucleotide sequence is as shown in SEQ ID NO:6 when encoding leucine at position 282 is mutated.

[0009] A recombinant vector comprising the above-mentioned nucleic acid molecule, wherein the vector is a pET28a-derived vector; when carrying SEQ ID NO:5, the vector is named pET28a-I224W; when carrying SEQ ID NO:6, the vector is named pET28a-A282L.

[0010] A recombinant microorganism comprising the above-mentioned recombinant vector, wherein the host bacterium is Escherichia coli BL21(DE3); when the vector is pET28a-I224W, the strain is named BL21(DE3) / I224W; when the vector is pET28a-A282L, the strain is named BL21(DE3) / A282L.

[0011] A method for preparing the above-mentioned lipase mutant includes the following steps: (a) using the nucleotide sequence shown in SEQ ID NO:4 as a template, introducing a mutation at position 224 and / or position 282 by site-directed mutagenesis; (b) cloning the mutant gene into an expression vector; (c) transforming host cells and inducing expression; and (d) purifying to obtain the lipase mutant.

[0012] The above site-directed mutagenesis was amplified using whole plasmid PCR, and the primer sequences were selected from:

[0013] I224W-F:ATTCAGGGACTGTGGGCTGGCGAGAAAG;

[0014] I224W-R:CCACAGTCCCTGAATGTAGGAACCAAAGCA;

[0015] A282L-F:GATATGGTTAATCAGGTGCTGGGCCT;

[0016] A282L-R:CAGCACCTGATTAACCATATCAATATGATC.

[0017] The purification process described above employed nickel column affinity chromatography, which included washing with buffer A containing 10 mM imidazole, followed by elution with buffer A containing 250 mM imidazole. Buffer A consisted of 50 mM Tris-Cl at pH 7.5 and 0.3 M NaCl.

[0018] Application of the above-mentioned lipase mutants in lipid hydrolysis or esterification reactions.

[0019] The above reactions are carried out in an acidic environment with a pH of 4.0-6.0 or at a temperature of 45-70°C.

[0020] Beneficial Effects: This invention modifies the lipase PmLipY (amino acid sequence shown in SEQ ID NO.3) using site-directed mutagenesis, mutating isoleucine at position 224 (Ile, I) to tryptophan (Trp, W) and alanine at position 282 (Ala, A) to leucine (Leu, L), thereby obtaining a lipase mutant with simultaneously enhanced acid tolerance and thermostability. Compared with the wild type, it exhibits higher enzyme activity in acidic and high-temperature environments; the lipase mutant (t 50 The half-life (t) at 45°C was increased by 9°C and 6°C, respectively. 1 / 2 The half-life at 70°C was extended by 6.25 times and 4.58 times compared to the wild type, respectively, and the half-life (t) was also extended. 1 / 2 The catalytic efficiency of the two mutants was increased by 7 times and 4 times respectively compared to the wild type; meanwhile, when p-nitrophenol palmitate was used as a substrate, the catalytic efficiency of the two mutants was increased by 2.3 times and 1.54 times respectively compared to the wild type. The mutation method of this invention belongs to enzyme molecular modification technology, which shortens the time for modifying enzyme properties compared to blind screening or artificial (natural) mutagenesis, and provides new technical guidance for the development of high-performance lipases. Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 SDS-PAGE analysis of wild-type lipase and its mutants, where M is a low molecular weight protein marker; A, B, and C are the purified wild-type enzyme PmLipY and its two mutants I224W and A282L, respectively.

[0023] Figure 2 The optimal pH values ​​for lipase mutants I224W and A282L and wild-type PmLipY are determined.

[0024] Figure 3 The results show the pH stability of lipase mutants I224W and A282L and wild-type PmLipY.

[0025] Figure 4 The results show the optimal temperature determination for lipase mutants I224W and A282L, and wild-type PmLipY.

[0026] Figure 5 The t-lipase mutants I224W and A282L and wild-type PmLipY 50 Measurement results;

[0027] Figure 6 The results show the half-life determination of lipase mutants I224W and A282L and wild-type PmLipY at 45℃.

[0028] Figure 7 The results show the half-life of lipase mutants I224W and A282L and wild-type PmLipY at 70℃. Detailed Implementation

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0031] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0032] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0033] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0034] The sources of materials that may be used in the embodiments of the present invention are as follows:

[0035] 1. Strains and vectors: The expression host was Escherichia coli BL21(DE3), and the expression plasmid vector pET28a was purchased from Invitrogen.

[0036] 2. Enzymes and other biochemical reagents: p-nitrophenol palmitate was purchased from Yuanye Company; all others were domestically produced analytical grade reagents (all purchased from Sinopharm Group);

[0037] 3. Culture medium: LB medium: 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;

[0038] Example 1: Cloning of the gene encoding an acid- and heat-resistant lipase mutant

[0039] Using the PmLipY gene (amino acid sequence shown in SEQ ID NO.1) as the parent, mutations were performed to obtain the gene encoding the acid- and heat-resistant lipase mutant (SEQ ID NO.2, SEQ ID NO.3). The mutation and cloning methods are referenced in (Rational Design of Lipase ROL to Increase Its Thermostability for Production of Structured Tags. Int J Mol Sci, 2022, 23(17):9515.). Primer information used is shown in Table 1.

[0040] Table 1 Primer Synthesis List

[0041]

[0042] Example 2: Preparation of acid- and heat-resistant lipase mutants

[0043] Using the pET28a(+)-PmLipY plasmid containing the *Proteus mirabilis* lipase gene as a template, primers were designed based on the mutation site for whole-plasmid PCR amplification. After verification by agarose gel electrophoresis, the PCR product was recovered and transformed into *E. coli* BL21(DE3) competent cells using a heat shock transformation method. The selected positive transformants were sent to Sangon Biotech Co., Ltd. (Shanghai) for DNA sequencing verification, yielding the target strains I224W and A282L. The cells were cultured in 2L LB medium containing 50 μg / mL kanamycin at 37°C until the optical density reached 0.6 at 600 nm. Protein expression was induced by the addition of 0.5 mM isopropyl-β-D-thiogalactoside, and the cells were incubated at 16°C for another 16 hours. Cells were collected by centrifugation (4,000 rpm, 20 min), resuspended in 100 mL buffer A (50 mM Tris-Cl pH 7.5, 0.3 M NaCl, 10 mM imidazole), and lysed by sonication at 4 °C. The lysate was centrifuged at 13,000 rpm for 40 min, and the supernatant was loaded onto a 5 mL nickel-nitrogen triacetic acid column. The cells were washed with 20 mL buffer A, followed by elution with buffer A containing 250 mM imidazole to obtain 80 mg of protein with a purity >95%. The recombinant lipase was dialyzed overnight in 20 mM Tris-Cl pH 7.5 buffer containing 100 mM NaCl, flash-frozen in liquid nitrogen, and stored at -80 °C.

[0044] Example 3: Activity analysis of acid- and heat-resistant lipase mutants and wild-type lipase

[0045] I. Determination of enzyme activity by ρNPP method

[0046] The specific method is as follows: Under pH 9.0 and 60℃ conditions, mix 50 μL of diluted enzyme solution with 450 μL of substrate, react for 5 min, add 50 μL of TCA to terminate the reaction, and add 50 μL of NaCO3 for color development. Measure the OD value at 405 nm. One enzyme activity unit (U) is defined as the amount of enzyme required to decompose ρNPP to generate 1 μmol ρNP per minute under given conditions.

[0047] II. Performance Determination of Acid- and Heat-Resistant Lipase Mutants and Wild-Type Lipase

[0048] 1. The optimal pH measurement method is as follows:

[0049] The acid- and heat-resistant lipase mutants I224W and A282L purified in Example 2, along with the wild-type lipase PmLipY, were used to determine their optimal pH at different pH values. The substrate pNPP was dissolved in 0.1 mol / L citrate-disodium hydrogen phosphate buffer at different pH values, and enzyme activity was measured at 50°C. The results are as follows: Figure 2 As shown, the optimal reaction pH of the acid- and heat-resistant lipase mutant A282L shifts to an acidic environment by 1 unit compared to the wild type, with an optimal pH of 8.0.

[0050] 2. The method for determining pH stability is as follows:

[0051] The acid- and heat-resistant lipase mutants I224W and A282L, along with the wild-type lipase PmLipY, were incubated at 37°C for 1 hour in buffer solutions with different pH values ​​(1-12), and then the remaining enzyme activity was measured. The results are as follows: Figure 3 As shown, the acid- and heat-resistant lipase mutant still maintains more than 70% of the relative enzyme activity in the pH range of 4.0-6.0, and its stability is significantly better than that of the wild type.

[0052] 3. The method for determining the optimal temperature is as follows:

[0053] The enzyme activities of acid- and heat-resistant lipase mutants I224W and A282L, and wild-type lipase PmLipY were measured in a 0.1 mol / L citrate-disodium hydrogen phosphate buffer (pH 8.0) at different temperatures. The results are as follows: Figure 4 As shown, the optimal temperature for both the mutant and the wild type is 60℃, but the relative enzyme activity of the mutant at 65℃ (I224W: 64%; A282L: 73%) is significantly higher than that of the wild type (37%).

[0054] 4. Thermal stability was determined as follows:

[0055] The detection method is referenced in the literature (Improvement of methanol tolerance and catalytic activity of Rhizomucor miehei lipase for one-step synthesis of biodiesel by semi-rational design. Bioresour Technol. 2022, 348(0):126769.), and the results are as follows. Figure 5 As shown, the thermostability of acid- and heat-resistant lipase mutants is significantly better than that of wild-type: mutants I224W and A282L have a t 50 Compared to the wild type, the half-life at 45°C was increased by 9°C and 6°C, respectively, and the half-life (t) was also increased. 1 / 2 The half-life of I224W (7.5h) and A282L (5.5h) was extended by 6.25 times and 4.58 times respectively compared with the wild type (1.2h), and the half-life at 70℃ (t) was also extended. 1 / 2 The time for I224W (7 min) and A282L (4 min) was 7 times and 4 times longer than that for the wild type (1 min), respectively.

[0056] 4. The methods for determining dynamic parameters are as follows:

[0057] The detection method was based on the literature (Y12F mutation in Pseudomonas plecoglossicida S7lipase enhances its thermal and pH stability for industrial applications: acombination of in silico and in vitro study. World J Microbiol Biotechnol. 2023, 39(3):75.), determining the first-order reaction time and K. m and V max The reaction time was 5 min. Then, using different concentrations of ρNPP (1, 0.8, 0.5, 0.2, 0.1, 0.05, and 0.01%) as substrates, enzyme activity was measured under standard conditions (60℃, pH 9.0), and the corresponding reaction rates were calculated. Kc was calculated using Graphpad Prism 10.1.2 software. m and V max .

[0058] When ρNPP is used as a substrate, the K of wild type and mutants I224W and A282L m The values ​​were 2.44, 0.81, and 1.21 mM, respectively; I224W (470 mM)-1 ·min -1 Catalytic efficiency is higher than that of wild type (200mM) -1 ·min -1 The activity of I224W (128 U / mg) was 1.4 times higher than that of wild type (92 U / mg) (see Table 2).

[0059] Table 2. Specific activity and kinetic parameters of acid- and heat-resistant lipase mutants and wild-type lipases.

[0060]

[0061] Note: Kinetic values ​​are displayed as mean standard deviation (n=3).

[0062] The above results indicate that the acid- and heat-resistant lipase mutants I224W and A282L can withstand high-temperature treatment above 50°C and have very high enzyme activity under both acidic and neutral pH conditions, showing great application potential in industrial fields such as feed, bioenergy, and food.

[0063] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A lipase mutant, characterized in that, Its amino acid sequence is based on the sequence shown in SEQ ID NO:1, with isoleucine at position 224 mutated to tryptophan, and / or alanine at position 282 mutated to leucine.

2. The lipase mutant according to claim 1, characterized in that, When position 224 is mutated to tryptophan, the amino acid sequence is shown in SEQ ID NO:2; when position 282 is mutated to leucine, the amino acid sequence is shown in SEQ ID NO:

3.

3. A nucleic acid molecule encoding a lipase mutant according to any one of claims 1-2, characterized in that, When the nucleotide sequence encoding tryptophan at position 224 is mutated, the nucleotide sequence is shown in SEQ ID NO:5; when the nucleotide sequence encoding leucine at position 282 is mutated, the nucleotide sequence is shown in SEQ ID NO:

6.

4. A recombinant vector, characterized in that, The vector comprises the nucleic acid molecule of claim 3, and the vector is a pET28a-derived vector; when carrying SEQ ID NO:5, the vector is named pET28a-I224W; when carrying SEQ ID NO:6, the vector is named pET28a-A282L.

5. A recombinant microorganism, characterized in that, The strain comprises the recombinant vector of claim 4, and the host bacterium is Escherichia coli BL21(DE3); when the vector is pET28a-I224W, the strain is named BL21(DE3) / I224W; when the vector is pET28a-A282L, the strain is named BL21(DE3) / A282L.

6. A method for preparing the lipase mutant according to any one of claims 1-2, characterized in that, Includes the following steps: (a) Using the nucleotide sequence shown in SEQ ID NO:4 as a template, introduce mutations at positions 224 and / or 282 through site-directed mutagenesis; (b) clone the mutant gene into an expression vector; (c) transform host cells and induce expression; (d) purify to obtain the lipase mutant.

7. The method according to claim 6, characterized in that, The site-directed mutagenesis was amplified using whole-plasmid PCR, and the primer sequences were selected from: I224W-F: ATTCAGGGACTGTGGGCTGGCGAGAAAG; I224W-R: CCACAGTCCCTGAATGTAGGAACCAAAGCA; A282L-F: GATATGGTTAATCAGGTGCTGGGCCT; A282L-R: CAGCACCTGATTAACCATATCAATATGATC.

8. The method according to claim 6, characterized in that, The purification was performed using nickel column affinity chromatography, which included washing with buffer A containing 10 mM imidazole and eluting with buffer A containing 250 mM imidazole. Buffer A was 50 mM Tris-Cl pH 7.5 and 0.3 M NaCl.

9. The use of the lipase mutant according to any one of claims 1-2 in the hydrolysis or esterification of oils and fats.

10. The application according to claim 9, characterized in that, The reaction is carried out in an acidic environment with a pH of 4.0-6.0 or at a temperature of 45-70°C.

Images