Two novel Cas12a endonucleases and application thereof in nucleic acid detection

Abstract

The invention discloses two novel CRISPR-Cas12a (Clustered Regularly Interspaced Short Palindromic Repeats) endonuclease Gs12-23 and a novel CRISPR-Cas12a endonuclease Wherein the PAM recognition sequence of the Gs12-23 is THTV (H = A / T / C, V = A / C / G), and the PAM recognition sequence of the Gs12-24 is TTTV (V = A / C / G). Gs12-23 has the advantage of wide target recognition range, and Gs12-24 has excellent performance in the aspects of temperature tolerance and activity, shows gene editing ability in a wider temperature range, and can realize high-activity and high-specificity cutting of target DNA in a genome. On the basis, a nucleic acid visual detection technology based on CRISPR / Gs12-23 and Gs12-24 system mediation is successfully constructed, and the technology has an extremely wide application prospect in the field of nucleic acid detection and is expected to bring new breakthrough and development to nucleic acid detection.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of genome editing and nucleic acid detection, and particularly relates to two novel Cas12a endonucleases Gs12-2 and Gs12-24 and their application in nucleic acid detection. BACKGROUND

[0002] Traditional gene editing technologies mainly include Zinc Finger Nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs) and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system. Among them, ZFNs and TALENs represent the first and second generation of gene editing technologies, respectively, and their molecular structures are composed of specific DNA recognition domains and non-specific DNA cleavage domains. The DNA binding domains of these technologies are engineered to target specific genomic sites, thereby guiding the nuclease domain to cut the target DNA. However, the first and second generation of gene editing technologies have many limitations in practical application, including low target recognition efficiency, high construction cost, significant off-target effects and high structural complexity. These technical bottlenecks have driven the rapid development of the third generation of gene editing technology, CRISPR / Cas system, which is derived from the adaptive immune mechanism of prokaryotes. Its core functional elements include CRISPR-associated protein (Cas) and guide RNA (crRNA).

[0003] Based on the in-depth study of the structure and function mechanism of CRISPR effector protein complex, the CRISPR / Cas system can be systematically divided into two categories: the first category system is composed of multi-subunit protein complex (covering type I, type III and type IV), while the second category system is a single multi-domain effector protein (including type II Cas9, type V Cas12 and type VI Cas13 protein). Compared with the first category system, the second category system has more advantages in the field of gene editing due to its simple structure, high editing efficiency and convenient operation. Among them, type V effector protein Cas12a (also known as Cpf1) was identified in 2015, and its molecular weight is about 1200-1500 amino acid residues. Under the guidance of CRISPR RNA (crRNA), the protein can specifically recognize and cut double-stranded DNA (dsDNA) containing protospacer-adjacent motif (PAM, characterized by rich thymine nucleotide sequence). It is worth noting that the Cas12a system only needs 42-44 nucleotide length of crRNA to function, and does not depend on the assistance of trans-activating crRNA (tracrRNA), and has ribonuclease (RNase) and deoxyribonuclease (DNase) activity. Research in 2018 found that Cas12a can maintain enzyme activity after completing the specific cutting of target dsDNA, and can non-specifically cut the surrounding single-stranded DNA (ssDNA), which is defined as the "collateral cleavage" effect. Based on this property, researchers combined the collateral cleavage activity of Cas12a with nucleic acid amplification technology, and by introducing a fluorescently labeled ssDNA reporter probe, successfully developed a variety of molecular diagnostic platforms with the advantages of rapidness, sensitivity and low cost.

[0004] Although the CRISPR / Cas12a system has shown significant application potential in nucleic acid detection, its operation simplicity and cost-effectiveness advantage are obvious, but there are still some technical bottlenecks, including insufficient targeting specificity, strong PAM sequence limitation, etc. These limitations are essentially due to the inherent properties of Cas12a nuclease. Therefore, developing a new CRISPR / Cas12a gene editing system with high editing activity, simplified PAM requirement, wide genomic coverage and high specificity is still a key scientific problem to be solved in the current gene editing field. SUMMARY

[0005] The application first mines and identifies two novel Cas12a endonucleases Gs12-23 and Gs12-24, and further establishes a nucleic acid visualization detection method based on Gs12-23 or Gs12-24 mediation.

[0006] In order to achieve the above-mentioned purpose, the application adopts the following technical solutions:

[0007] The endonuclease in the CRISPR / Cas12a system comprises the following proteins:

[0008] I. Gs12-23 protein of the amino acid sequence shown in SEQ ID NO. 1 and Gs12-24 protein of the amino acid sequence shown in SEQ ID NO. 2;

[0009] II. Protein having more than 80% sequence similarity compared with the amino acid sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2, and substantially retaining the biological function derived from the sequence;

[0010] III. Protein having substitution, deletion or addition of one or more amino acids compared with the amino acid sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2, and substantially retaining the biological function derived from the sequence.

[0011] The fusion protein comprises the above-mentioned endonuclease and a polypeptide connected to the N-terminus or C-terminus of the endonuclease.

[0012] The polynucleotide is a polynucleotide encoding the above-mentioned endonuclease, or a polynucleotide encoding the above-mentioned fusion protein. The vector or host cell containing the polynucleotide.

[0013] A visualization nucleic acid detection kit comprises the above-mentioned endonuclease, a single-stranded DNA fluorescence-quenching probe, and a guide RNA paired with a target nucleic acid.

[0014] The kit for visualizing detection of African swine fever virus nucleic acid comprises the above-mentioned endonuclease, a single-stranded DNA fluorescence-quenching reporter gene, and a guide RNA paired with a target nucleic acid p72 gene. Preferably, the sequence of the guide RNA is shown in SEQ ID NO. 3; and the LAMP primers of the p72 gene are shown in SEQ ID NO. 5-10.

[0015] Compared with the prior art, the application has the following advantages and beneficial effects:

[0016] 1. The application first provides two novel Cas12a endonucleases Gs12-23 and Gs12-24 mined and identified by combining metagenomics and experimental means.

[0017] 2. The present application discovers the endonuclease Gs12-23 and Gs12-24 which can recognize a wider range of PAM sequences, and the advantage is that it can recognize target DNA sites with PAM as "THTV" or "TTTV" (V = A / C / G, H = A / T / C) in the genome, greatly expanding the coverage of gene editing targets.

[0018] 3. The present application first provides a nucleic acid visualization detection technology mediated by CRISPR / Gs12-23 and Gs12-24 system. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 . Discovery of new gene editing nucleases Gs12-23 and Gs12-24 by bioinformatics methods. A. Analysis of amino acid sequence similarity of Gs12-23 and Gs12-24 with known Cas12a, B. Phylogenetic analysis of Gs12-23 and Gs12-24, C. Schematic diagram of Gs12-23 and Gs12-24 gene locus, D. Domain analysis of Gs12-23 and Gs12-24, E. Prediction of three-dimensional space structure of Gs12-23 and Gs12-24, F. Three-dimensional space structure alignment of Gs12-23 and Gs12-24 and LbCas12a.

[0020] Figure 2 . Conservation analysis of RuvC domain of Gs12-23 and Gs12-24 protein with known LbCas12a, FnCas12a, AsCas12a protein.

[0021] Figure 3 . Identification of PAM recognition characteristics of Gs12-23 and Gs12-24 by PAM library subtraction experiment in bacteria. A. Schematic diagram of PAM library subtraction experiment, B. PAM that can be recognized by Gs12-23 and Gs12-24.

[0022] Figure 4 . Evaluation of the trans-cleavage ability of the new endonuclease Gs12-23 to the guide RNA of non-canonical or canonical PAM. A. Gs12-23 recognizes non-canonical PAM, B. Gs12-23 recognizes canonical PAM.

[0023] Figure 5. Evaluation of Gs12-23 and Gs12-24 reaction temperature and reaction time. A. Trans-cleavage activity of Gs12-23 and Gs12-24 endonucleases at different temperatures for the same time (15 min) blue light results, B. Cis-cleavage activity of Gs12-23 and Gs12-24 endonucleases at different temperatures for the same time (30 min), C. Trans-cleavage activity of Gs12-23 and Gs12-24 endonucleases at different times for the same temperature (37℃), D. Cis-cleavage activity of Gs12-23 and Gs12-24 endonucleases at different times for the same temperature (37℃).

[0024] Figure 6 . Evaluation of the position effect of single base mismatch in the target on the trans-cleavage activity of Gs12-23 and Gs12-24, the target is the amplified fragment of African swine fever p72 gene. A and C. Fluorescence values of Gs12-23 and Gs12-24 single base mismatch pattern and trans-cleavage activity, B and D. Blue light results of evaluating the trans-cleavage activity of Gs12-23 and Gs12-24 under single base mismatch pattern.

[0025] Figure 7 . Detection of pMD18T-ASFV-p72 plasmid by PCR-CRISPR / Gs12-23 / Gs12-24 technology. A. Identification of PCR amplification products by agarose gel electrophoresis, B. Evaluation of detection sensitivity by blue light instrument, C. Evaluation of detection sensitivity by enzyme marker.

[0026] Figure 8 . Detection of pMD18T-ASFV-p72 plasmid by LAMP-CRISPR / Gs12-23 / Gs12-24 technology. A. Identification of LAMP amplification products by agarose gel electrophoresis, B. Evaluation of the sensitivity of LAMP combined with Gs12-23 or Gs12-24 for detecting ASFV-p72 plasmid, C. Evaluation of the specificity of LAMP combined with Gs12-23 or Gs12-24 for detecting ASFV-p72 plasmid. DETAILED DESCRIPTION

[0027] The application will be further described with reference to the following examples. It should be understood that these examples are intended to illustrate the application and are not intended to limit the scope of the application. The experimental methods in the following examples, if not otherwise specified, are generally carried out according to conventional conditions in the art, or according to the conditions recommended by the manufacturer.

[0028] Example 1 Discovery of two novel Cas12a homologous endonucleases Gs12-23 and Gs12-24 by bioinformatics means

[0029] Based on the bioinformatics identification process of the new guide RNA-dependent gene editing nuclease built by the inventors, the massive metagenomic sequencing data in the public databases such as NCBI nr (Non-Redundant Protein Sequence Database) and Global Microbial Gene Catalogue Database (GMGC) are deeply mined for bacterial coding proteins. The approximate analysis process is as follows: for all contig sequences in the target database, the minced software is used to search and locate the CRISPR array, and then the prodigal software is used to predict the proteins expressed adjacent to the CRISPR array. The CD-hit software is used to remove redundancy of all predicted proteins, and the mega software is used for protein clustering analysis, and the hmmer software is used for CRISPR-Cas similarity protein identification and classification, and finally two new unknown bacterial proteins are obtained.

[0030] Through phylogenetic evolution tree analysis, it is found that the two new bacterial proteins are located in different CRISPR-Cas12a system evolution branches Figure 1 B), and it is speculated that they may be new RNA-guided gene editing nucleases. The present application names the new proteins discovered from different bacteria as Genie scissor (Gs) gene editing nucleases. In order to facilitate subsequent research, the inventors further name the two new unknown bacterial proteins as Gs12-23 and Gs12-24 based on the bacterial species source, and the naming rule is "gene editing nuclease + digital number". The amino acid sequence of Gs12-23 is shown as SEQ ID NO. 1, and the amino acid sequence of Gs12-24 is shown as SEQ ID NO. 2.

[0031] Then, the inventors use the localization blast program to perform sequence similarity comparison between the two newly discovered bacterial proteins and the NCBI nr database. The results show that the amino acid sequence similarity of Gs12-23 with the known Cas12a endonuclease (LbCas12a and AsCas12a) is 36.87% and 30.52% respectively; the sequence conservation of Gs12-24 with the two known Cas12a endonucleases (LbCas12a and AsCas12a) is higher, reaching 45.16% and 37.17% respectively Figure 1 A). Further, the inventors analyze the loci of the two proteins using the CRISPRCasFinder software. The results show that Gs12-23 and Gs12-24 have CRISPR array sequences, containing multiple repeats and spacer sequences. The difference is that Gs12-24 contains Cas4, Cas1 and Cas2 proteins, while Gs12-23 does not contain Cas4, Cas1 and Cas2 proteinsFigure 1 C). Hidden Markov Model (HMM) alignment analysis was performed using Hmmer software and the domain sequences in the Pfam database, revealing the REC domain, RuvC nuclease domain, and NUC domain. Figure 1 D) It is speculated that these two new bacterial proteins may have nucleic acid cleavage activity.

[0032] To compare the three-dimensional structural similarity of Gs12-23 and Gs12-24 with the known LbCas12a, the inventors used AlphaFold2 software to predict the three-dimensional structures of these two novel gene-editing nucleases. Figure 1 E) and contrast ( Figure 1 F), the results showed that the spatial structures of Gs12-23 and Gs12-24 were similar to those of the known LbCas12a.

[0033] Finally, the inventors performed amino acid multiple sequence alignment of the RuvC domains of Gs12-23 and Gs12-24 with known LbCas12a, FnCas12a, and AsCas12a proteins. Figure 2 As shown, the amino acid sequence similarity of the Gs12-23 and Gs12-24 protein domains to the known Cas12a protein is significantly different, therefore further experiments are needed to determine whether they have nucleic acid directional cleavage activity.

[0034] Example 2 Characterization of CRISPR / Gs12-23 and Gs12-24 mediated gene editing system 2.1 Identification of PAM sequences recognized by Gs12-23 and Gs12-24 proteins by bacterial PAM library subtraction assay

[0035] PAM sequence recognition by Gs12-23 and Gs12-24 proteins, which have low homology and in vitro target nucleic acid cleavage activity, was identified using bacterial PAM library subtraction experiments. The construction procedure for the randomized mixed PAM vector library was as follows: DNA oligo sequence GGCCAGTGAATTCGAGCTCGGTACCCGGGNNNNNNN GAGAAGTCATTTA ATAAGGCCACTGTTAAAAAGCTTGGCGTAATCATGGTCATAGCTGTTT, wherein N is random deoxynucleotide. After PCR amplification with Oligo-F: GGCCAGTGAATTCGAGCTCGG and Oligo-R: AAACAGCTATGACCATGATTACGCCAA as upstream and downstream primers, it is connected into pUC19 vector by homologous recombination, and after transformation of E. coli, the random mixed PAM vector library can be formed by extracting plasmid. The guide RNA (crRNA) sequence used is: AAUUUCUACUAUUGUAGAU GAGAAGUCAUUUAAUAAGGCCACU (underlined area is the target recognition sequence).

[0036] Bacterial PAM library subtraction experiment process Figure 3 A): The constructed Gs12-23 or Gs12-24 protein and crRNA co-expressed vector pACYC-Duet-1-Gs12-23 / 24-crRNA were transformed into DE3 (BL21) competent cells to prepare a stably expressed bacterial strain. The stably transformed bacterial strain constructed by the expression vector pACYC-Duet-1 without Gs12-23 and Gs12-24 protein was used as a negative control. 100 ng of PAM library plasmid was electroporated into the stably expressed bacterial strain, and the double antibiotic resistant plates were used for screening. After 16 h, the colonies on the plate were scraped for plasmid extraction. 100 ng of extracted plasmid was used as a template for PCR amplification with library sequencing primers Seq-F: GGCCAGTGAATTCGAGCTCGG and Seq-R: CAATTTCACACAGGAAACAGCTATGACC. The products were recovered and the experimental and control groups were subjected to second-generation high-throughput sequencing, and the sequencing results were analyzed and displayed by Weblogo3.0.

[0037] Identification of PAM sequence characteristics recognized by Gs12-23 and Gs12-24 protein: The different types of PAM sequences contained in the initial vector library were counted according to their frequency in the experimental and control groups in high-throughput sequencing, and were standardized by the total number of PAM sequences in each group. The calculation method for each PAM consumption change is log2 (control group standardized value / experimental group standardized value), and when the value is greater than 3.5, it is considered that this PAM is significantly consumed. Then use Weblogo3.0 to visualize the base frequency at each position of the significantly consumed PAM sequence. The results are shown in Figure 3 B, the PAM recognition sequence of Gs12-23 is THTV (H = A / T / C, V = A / C / G), and the PAM recognition sequence of Gs12-14 is TTTV (V = A / C / G), wherein Gs12-23 has the advantage of wider target recognition range.

[0038] 2.2 Trans-cleavage experiment to test the cleavage activity of Gs12-23 protein on different PAMs

[0039] This example tests the trans-cleavage activity of Gs12-23 protein on double-stranded DNA targets in vitro. Six non-canonical PAMs and three canonical PAMs of crRNA were designed on the African swine fever virus (ASFV) p72 gene for experimental detection, the non-canonical PAMs were TCTC, TATA, TCTG, TCTA, TATG, and TATC, and the canonical PAMs were TTTC, TTTA, and TTTC. Gs12-23 was used to test the six non-canonical PAMs and three canonical PAMs of crRNA, respectively, and then the signal-to-noise ratio was evaluated by a blue light excitation imaging system, and the fluorescence signal intensity was quantitatively determined by a multifunctional enzyme label instrument.

[0040] In this example, the target double-stranded DNA (dsDNA) is the African swine fever virus p72 gene (the sequence is shown as SEQ ID NO. 5), and six different PAMs and three canonical PAMs of guide RNA are designed, and the primers and PAMs are shown in Table 1.

[0041] Table 1 crRNA primer sequences for testing PAMs

[0042]

[0043] PCR amplification was performed using PCR-p72-F: CTGTAACGCAGCACAGCTGA and PCR-p72-R: CCATGGTTTATCCCAGGAGT as primers to obtain p72 double-stranded DNA. The trans-cleavage reaction system was as follows: 500 ng of Gs12-23 protein, 600 ng of guide RNA, 2 μL of 10×CutSmart Buffer, 0.75 μM of single-stranded DNA fluorescence-quenching reporter gene (ROX-GTATCCAGTGCG-BHQ2), and 1 μL of PCR amplification product. The reaction was carried out at 37°C for 15 min and inactivated at 98°C for 2 min. The fluorescence intensity and background noise were observed under blue light.

[0044] The results are shown in Figure 4 As shown in FIG. A, for the six non-canonical PAMs of Gs12-23, in addition to TCTC, the other five non-canonical PAMs all have trans-cleavage activity, among which the trans-cleavage activity of TATG and TATC is higher, and the relative trans-cleavage activity of the canonical PAM is still weak Figure 4 B).

[0045] 2.3 Evaluation of Gs12-23 and Gs12-24 protein target cleavage time and reaction temperature characteristics

[0046] To evaluate the target cleavage time and reaction temperature of Gs12-23 and Gs12-24. The selected test target is p72 double-stranded DNA, and the crRNA selected is crRNA8-TTTA. First, test the trans-cleavage activity of the nuclease under different temperature conditions (16°C, 25°C, 37°C, 42°C, 50°C, 60°C) for 15 min, and the results show that the trans-cleavage temperature range of Gs12-23 and Gs12-24 is 16-60°C, among which the optimum temperature is 37-42°C, and compared with LbCas12a, the trans-cleavage temperature range of Gs12-23 and Gs12-24 is wider Figure 5 A). Then test the cis-cleavage activity of the nuclease under different temperature conditions for 30 min, and the results show that the cis-cleavage activity of Gs12-23 is weak, and the cis-cleavage temperature range of Gs12-24 is 25-42°C Figure 5 B). Then test the trans-cleavage effect caused by prolonged time at 37°C, and find that Gs12-23 and Gs12-24 nucleases show trans-cleavage activity at 5 min, and compared with LbCas12a, both nucleases show higher trans-cleavage activity in a short time (5 min) Figure 5 C), which is very suitable for establishing a new CRISPR nucleic acid detection system based on Gs12-23 / Gs12-24. Finally, test the cis-cleavage activity change caused by prolonged time at 37°C, and find that Gs12-23 and Gs12-24 nucleases show cleavage efficiency at 0.5 min, and reach a higher level at 30 min Figure 5 D).

[0047] 2.4 Evaluation of the single nucleotide mismatch target site specificity detection ability of endonuclease Gs12-23 and Gs12-24

[0048] Validation experiments were performed using high-activity crRNA against ASFV-p72. An in vitro transcription template containing a continuous spacer mutation from 1-20 was amplified by PCR, and after successful preparation of mutant crRNA, the CRISPR-Gs12-23 and CRISPR-Gs12-24 detection systems were used, and the fluorescence intensity was quantitatively analyzed by a multi-mode signal acquisition platform (including a blue light excitation imaging system and a multifunctional enzyme marker), to systematically evaluate the recognition specificity of the nuclease Figure 6(A and C). Experimental data showed that in the presence of single nucleotide mismatches, the endonuclease activities of both Gs12-23 and Gs12-24 proteins were inhibited to some extent; Gs12-23 showed a higher degree of inhibition, while Gs12-24 showed a relatively lower degree. This result indicates that Gs12-23 is more sensitive to single nucleotide mismatches, while Gs12-24 has higher compatibility with single nucleotide mismatches. Figure 6 (B and D).

[0049] Example 3: Detection of ASFV-p72 plasmid using PCR-CRISPR / Gs12-23 / Gs12-24 technology

[0050] The plasmid containing the ASFV-p72 gene was serially diluted to 9.63 × 10⁻⁶. 9 -9.63×10 -2 The p72 gene was amplified using pMD18T vectors at different dilutions. Primers were designed to amplify the p72 gene using these different dilutions as templates. The PCR product was then added to a Gs12-23 / Gs12-24 system-mediated nucleic acid detection reaction. The guide RNA was highly active crRNA8-TTTA. The reaction mixture consisted of 500 ng of Gs12-3 / Gs12-24 protein, 600 ng of guide RNA, 2 μL of 10×CutSmart Buffer, 0.75 μM of single-stranded DNA fluorescence-quenched reporter gene (ROX-GTATCCAGTGCG-BHQ2), and 1 μL of the PCR product. The reaction was incubated at 37℃ for 15 min and then inactivated at 98℃ for 2 min. Fluorescence intensity and background noise were observed under blue and ultraviolet light, and the fluorescence intensity was quantitatively detected using a multi-functional microplate reader to verify the sensitivity of the technique.

[0051] The results are as follows Figure 7 As shown in Figure A, the limit of detection after PCR amplification and gel electrophoresis is 10. 2 copies / μL. Simultaneously, combined with blue light visualization detection ( Figure 7 B) and quantitative detection using a multifunctional microplate reader (B) Figure 7 C) The detection limit of PCR-CRISPR / Gs12-23 / Gs12-24 technology for ASFV-p72 plasmid is 9.63 × 10⁻⁶. 2 copies / μL.

[0052] Example 4: Detection of ASFV-p72 plasmid using LAMP-CRISPR / Gs12-23 / Gs12-24 technology

[0053] A highly specific LAMP primer pair targeting the ASFV-p72 gene was designed (SEQ ID NO. 5-10), and the amplification was serially diluted to 9.63 × 10⁻⁶. 9 -9.63×10 -2 The pMD18T-ASFV-p72 recombinant plasmid was prepared in a total volume of 25 μL, containing 1 μL of Bst 3.0 DNA polymerase, 2.5 μL of 10× isothermal buffer, 6 mM MgSO4, 14 mM dNTP Mix, 2.5 μL of primer mixture (1.6 μM FIP / BIP, 0.2 μM F3 / B3, 0.4 μM LF / LB), 2 μL of template, and DEPC water to a final volume of 25 μL. The amplified products were then subjected to nucleic acid electrophoresis gel assays. Figure 8 A).

[0054] To verify the specificity of the LAMP-CRISPR / Gs12-23 / Gs12-24 detection system, cross-reaction validation was performed using multiple porcine viruses. First, conserved genes from various porcine viruses, such as PRRSV-M, PCV2-N, CSFV-E2, PPV-NS1, and JEV-C, were synthesized and constructed into pMD18T, resulting in plasmids pMD18T-PRRSV-M, pMD18T-PCV2-N, pMD18T-CSFV-E2, pMD18T-PPV-NS1, and pMD18T-JEV-C. These plasmids were then used as templates for parallel nucleic acid detection with the pMD18T-ASFV-p72 plasmid containing the conserved ASFV-p72 gene. LAMP amplification was performed first, followed by a Gs12-23 / Gs12-24 system-mediated nucleic acid detection reaction, as shown in Example 3.

[0055] Experimental results showed that the detection system exhibited high sensitivity for the ASFV p72 gene. LMAP amplification combined with gel electrophoresis and blue light visualization showed that the detection limit of the LAMP-CRISPR / Gs12-23 / Gs12-24 technology for ASFV-p72 plasmid was 9.63 × 10⁻⁶. 0 copies / μL ( Figure 8 B), and showed no cross-reactivity with other porcine viruses; the ratio of fluorescence signal to background noise was significantly higher (B). Figure 8 C) confirms the good specificity of the detection method.

Claims

1. A nuclease in the CRISPR / Cas12a system, characterized in that, Including the following proteins: I. Gs12-23 protein with the amino acid sequence shown in SEQ ID NO.1 and Gs12-24 protein with the amino acid sequence shown in SEQ ID NO.2; II. Proteins with more than 80% sequence identity compared to the amino acid sequences shown in SEQ ID NO.1 and SEQ ID NO.2, and which essentially retain the biological functions derived from the sequences; III. Proteins with one or more amino acid substitutions, deletions, or additions compared to the amino acid sequences shown in SEQ ID NO.1 and SEQ ID NO.2, and which substantially retain the biological functions derived from their sequences.

2. A fusion protein, characterized in that, It includes the protein of claim 1 and other modified parts.

3. A polynucleotide, characterized in that, The polynucleotide is a polynucleotide encoding the endonuclease of claim 1, or a polynucleotide encoding the fusion protein of claim 2.

4. A carrier, characterized in that, The vector comprises the polynucleotide of claim 3.

5. The application of the endonuclease of claim 1, the fusion protein of claim 2, the polynucleotide of claim 3, or the vector of claim 4 in nucleic acid detection.

6. A visual nucleic acid detection kit, characterized in that, Includes the endonuclease of claim 1, a single-stranded DNA fluorescence-quenching reporter gene, and a guide RNA that pairs with the target nucleic acid.

7. A kit for visually detecting African swine fever virus nucleic acid, characterized in that, Includes the endonuclease as described in claim 1, a single-stranded DNA fluorescence-quenching reporter gene, and a target nucleic acid p72 Guide RNA for gene pairing.

8. The reagent kit according to claim 7, characterized in that, The guide RNA sequence is shown in SEQ ID NO.

3.

9. The reagent kit according to claim 7 or 8, characterized in that, Also includes p72 The LAMP primers for the gene have the sequences shown in SEQ ID NO.5-10.

Images