Nucleic acid, composition containing nucleic acid, conjugate, preparation method and application

Abstract

The invention provides siRNA capable of inhibiting apolipoprotein C3 (APOC3) gene expression, the siRNA comprises a positive-sense strand and an antisense strand, the positive-sense strand and the antisense strand are respectively composed of a nucleotide sequence I or a nucleotide sequence II composed of 19 modified or unmodified nucleotides, the nucleotide sequence I and the nucleotide sequence II are at least partially reversely complementary to form a double-stranded region, and the double-stranded region is a single-stranded region. The nucleotide sequence II is at least partially reversely complementary with a section of nucleotide sequence in mRNA expressed by the APOC3 gene; at least one of the 3rd to 6th nucleotides of the nucleotide sequence II is a stable modified nucleotide according to the direction from the 5'terminal to the 3 'terminal. The siRNA, the pharmaceutical composition containing the siRNA and the siRNA conjugate provided by the invention can be used for effectively treating and / or preventing diseases or symptoms related to APOC3 gene expression, and has a remarkably reduced off-target effect.

Description

[0001] This application is a divisional application of the invention patent application filed on June 30, 2022, with application number 202280046072.2 and entitled "A nucleic acid, a composition and conjugate containing the nucleic acid, a preparation method and uses thereof". Technical Field

[0002] This disclosure relates to a nucleic acid with reduced off-target effects that can inhibit the expression of the apolipoprotein C3 (APOC3) gene, and compositions and conjugates containing the nucleic acid. This disclosure also relates to methods for preparing and using these nucleic acids, compositions, and conjugates. Background Technology

[0003] Dyslipidemia, also known as hyperlipidemia, is a systemic disease caused by abnormal lipid metabolism or transport, resulting in plasma lipid levels higher than normal. It seriously threatens the health of patients worldwide. Apolipoprotein C3 (APOC3) plays a crucial role in lipid metabolism. Individuals carrying the APOC3 gene mutation show a 46% decrease in circulating APOC3 expression and a 39% decrease in plasma triglyceride levels compared to healthy individuals. Therefore, using small interfering RNA (siRNA) to silence gene expression at the gene level and block APOC3 is undoubtedly an ideal approach for treating APOC3-related dyslipidemia. In recent years, significant progress has been made in the development of siRNA drugs to inhibit APOC3 gene expression.

[0004] In siRNA drug development, off-target effects are a significant toxicity-related side effect. Currently, many siRNAs that have demonstrated excellent pharmaceutical activity in preclinical pharmaceutical studies are difficult to use in actual drug development due to the toxicity caused by their off-target effects. Ideal siRNAs for preparing drugs for actual patient use should undoubtedly possess low toxicity, including low toxicity caused by off-target effects. Therefore, how to obtain siRNAs with low off-target effects requires further in-depth exploration in this field. Summary of the Invention

[0005] In order to develop an siRNA with significantly reduced off-target effects capable of inhibiting the APOC3 gene, the inventors unexpectedly discovered that siRNAs with stabilizing nucleotide modifications at specific sequence positions exhibit significantly lower off-target effects than siRNAs without such modifications at the corresponding positions. Furthermore, some siRNAs with stabilizing nucleotide modifications at specific sequence positions, while exhibiting significantly lower off-target effects, also showed APOC3 gene inhibitory activity that was not significantly reduced or comparable to that of siRNAs without such modifications. Therefore, the inventors made the following invention.

[0006] In one aspect, this disclosure provides an siRNA comprising an antisense strand and a sense strand, the sense strand comprising a nucleotide sequence I, the antisense strand comprising a nucleotide sequence II, both nucleotide sequences I and II consisting of 19 nucleotides, each nucleotide in nucleotide sequence I and nucleotide sequence II being a modified or unmodified nucleotide, nucleotide sequences I and II being at least partially anticomplementary to form a double-stranded region, nucleotide sequence II being at least partially anticomplementary to a first nucleotide sequence, the first nucleotide sequence being a 19-nucleotide sequence in the mRNA expressed by the APOC3 gene, wherein at least one of the 3rd to 6th nucleotides of nucleotide sequence II is a stabilizing modified nucleotide, the stabilizing modified nucleotide referring to a nucleotide in which the 2' hydroxyl group of the ribose is replaced by a stabilizing modified group, and compared with siRNA in which the nucleotide at the corresponding position is an unmodified nucleotide, the siRNA containing the stabilizing modified nucleotide has increased thermal stability, and the steric hindrance of the stabilizing modified group is greater than that of the 2'-O-methyl group.

[0007] In another aspect, this disclosure also provides a pharmaceutical composition comprising the siRNA provided herein and a pharmaceutically acceptable carrier.

[0008] In another aspect, this disclosure also provides an siRNA conjugate containing the siRNA provided in this disclosure and a conjugated group conjugated to the siRNA, the conjugated group comprising a linker and a pharmaceutically acceptable targeting group, wherein the siRNA, the linker and the targeting group are covalently or non-covalently linked in sequence, and each of the targeting groups is selected from ligands capable of binding to cell surface receptors.

[0009] In another aspect, this disclosure also provides the use of the siRNA, pharmaceutical composition and siRNA conjugate of this disclosure in the preparation of medicaments for treating and / or preventing diseases or symptoms associated with the mRNA level of APOC3 gene expression.

[0010] In another aspect, this disclosure also provides a method for treating and / or preventing diseases or symptoms associated with the mRNA level of APOC3 gene expression, the method comprising administering the siRNA, pharmaceutical composition and / or siRNA conjugate of this disclosure to a subject in need.

[0011] In another aspect, this disclosure also provides a method for inhibiting the expression level of the APOC3 gene in cells, the method comprising contacting the cells with an effective dose of the siRNA, pharmaceutical composition and / or siRNA conjugate of this disclosure.

[0012] In addition, this disclosure also provides a kit comprising the siRNA of this disclosure, a pharmaceutical composition and / or an siRNA conjugate.

[0013] Without limitation, some and other technical solutions of this disclosure are shown in the following paragraphs 1 to 49:

[0014] Paragraph 1. An siRNA comprising a sense strand and an antisense strand, the sense strand comprising a nucleotide sequence I, the antisense strand comprising a nucleotide sequence II, both nucleotide sequence I and nucleotide sequence II consisting of 19 nucleotides, each nucleotide in nucleotide sequence I and nucleotide sequence II being a modified or unmodified nucleotide, nucleotide sequence I and nucleotide sequence II being at least partially anticomplementary to form a double-stranded region, nucleotide sequence II being at least partially anticomplementary to a first nucleotide sequence, the first nucleotide sequence being a component of the mRNA expressing the apolipoprotein C3 gene. A nucleotide sequence of 19 nucleotides in length, with the 3rd or 5th nucleotide of the nucleotide sequence II in the direction from the 5' end to the 3' end, is a stabilizing modified nucleotide. The stabilizing modified nucleotide refers to a nucleotide in which the 2' hydroxyl group of the ribose is replaced by a stabilizing modified group. Compared with siRNA in which the nucleotide at the corresponding position is an unmodified nucleotide, the siRNA containing the stabilizing modified nucleotide has increased thermal stability, and the steric hindrance of the stabilizing modified group is greater than that of the 2'-O-methyl group. The increased thermal stability of the siRNA means that the Tm of the siRNA increases by 0.1-6°C.

[0015] Paragraph 2. The siRNA as described in paragraph 1, wherein the increase in the thermal stability of the siRNA refers to an increase in the Tm of the siRNA by 0.5-4°C.

[0016] Paragraph 3. The siRNA as described in paragraph 1 or 2, wherein each of the stabilizing modifying groups independently has the structure shown as -XR, wherein X is O, NR', S, or SiR'2; R is one of C2-C6 alkyl, substituted C2-C6 alkyl, C6-C8 aryl, or substituted C6-C8 aryl, and each R' is independently one of H, C1-C6 alkyl, substituted C1-C6 alkyl, C6-C8 aryl, or substituted C6-C8 aryl, wherein the substituted C2-C6 alkyl, substituted C6-C8 aryl, or substituted C1-C6 alkyl refers to a group formed by substituting one or more hydrogen atoms of C2-C6 alkyl, C6-C8 aryl, or C1-C6 alkyl with a substituent selected from one or more of the following substituents: C1-C3 alkyl, C6-C8 aryl, C1-C3 alkoxy, halogen, oxoyl group, and thioyl group.

[0017] Paragraph 4. The siRNA as described in paragraph 3, wherein each of the stabilizing modifying groups is independently selected from one of 2'-O-methoxyethyl, 2'-O-allyl, 2'-C-allyl, 2'-O-2-N-methylamino-2-oxoylethyl, 2'-O-2-N,N-dimethylaminoethyl, 2'-O-3-aminopropyl, and 2'-O-2,4-dinitrophenyl.

[0018] Paragraph 5. The siRNA as described in any one of paragraphs 1-4, wherein the nucleotide sequence I is of the same length as the nucleotide sequence shown in SEQ ID NO:1 and differs by no more than one nucleotide, and the nucleotide sequence II is of the same length as the nucleotide sequence shown in SEQ ID NO:2 and differs by no more than one nucleotide:

[0019] 5'-CAAUAAAGCUGGACAAGAZ1-3' (SEQ ID NO: 1);

[0020] 5'-Z2UCUUGUCCAGCUUUAUUG-3'(SEQ ID NO:2),

[0021] Wherein, Z1 is A, Z2 is U, nucleotide sequence I contains nucleotide Z3 corresponding to Z1, nucleotide sequence II contains nucleotide Z4 corresponding to Z2, and Z4 is the first nucleotide at the 5' end of the antisense strand; the nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2 includes the difference at the position of Z4, and Z4 is selected from A, G or C;

[0022] Alternatively, the nucleotide sequence I is equal in length to the nucleotide sequence shown in SEQ ID NO:45, and differs by no more than one nucleotide, and the nucleotide sequence II is equal in length to the nucleotide sequence shown in SEQ ID NO:46, and differs by no more than one nucleotide:

[0023] 5'-UUAAAAGGGACAGUAUUCZ5-3' (SEQ ID NO: 45);

[0024] 5'-Z6GAAUACUGUCCCUUUUAA-3'(SEQ ID NO:46),

[0025] Wherein, Z5 is U, Z6 is A, nucleotide sequence I contains nucleotide Z7 corresponding to Z5, nucleotide sequence II contains nucleotide Z8 corresponding to Z6, and Z8 is the first nucleotide at the 5' end of the antisense strand; the nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:46 includes the difference at the Z8 position, and Z8 is selected from G, C or U;

[0026] Alternatively, the nucleotide sequence I is the same length as the nucleotide sequence shown in SEQ ID NO:105, and differs by no more than 3 nucleotides, and the nucleotide sequence II is the same length as the nucleotide sequence shown in SEQ ID NO:106, and differs by no more than 3 nucleotides:

[0027] 5'-GGACAGUAUUCUCAGUGCZ9-3' (SEQ ID NO: 105);

[0028] 5'-Z 10 GCACUGAGAAUACUGUCC-3'(SEQ ID NO:106),

[0029] Where Z9 is U, Z 10 For A, the nucleotide sequence I contains a nucleotide Z at position Z9. 11 The nucleotide sequence II contains a position corresponding to Z. 10 nucleotide Z 12 The Z 12 It is the first nucleotide at the 5' end of the antisense strand; the nucleotide differences between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:106 include Z. 12 The difference in position, and Z 12 Selected from G, C, or U.

[0030] Paragraph 6. The siRNA as described in paragraph 5, wherein the first nucleotide sequence is the nucleotide sequence shown in SEQ ID NO:1; or, the first nucleotide sequence is the nucleotide sequence shown in SEQ ID NO:45; or, the first nucleotide sequence is the nucleotide sequence shown in SEQ ID NO:105.

[0031] Paragraph 7. The siRNA as described in paragraph 5 or 6, wherein Z3 is a nucleotide complementary to Z4; or Z5 is a nucleotide complementary to Z6; or Z8 is a nucleotide complementary to Z7.

[0032] Paragraph 8. The siRNA as described in any one of paragraphs 1-7, wherein the nucleotide sequence II is substantially anticomplementary, substantially anticomplementary, or completely anticomplementary to the first nucleotide sequence; substantially anticomplementary means that there is a mismatch of no more than 3 bases between the two nucleotide sequences; substantially anticomplementary means that there is a mismatch of no more than 1 base between the two nucleotide sequences; completely anticomplementary means that there is no mismatch between the two nucleotide sequences.

[0033] Paragraph 9. The siRNA as described in paragraph 8, wherein, in the direction from the 5' end to the 3' end, the nucleotides at positions 2-19 of the nucleotide sequence II are completely reverse complementary to the nucleotides at positions 1-18 of the first nucleotide sequence.

[0034] Paragraph 10. The siRNA as described in any one of paragraphs 1-9, wherein the nucleotide sequence II is completely inversely complementary to the nucleotide sequence I.

[0035] Paragraph 11. The siRNA as described in any one of paragraphs 1-10, wherein the sense strand and the antisense strand are of the same or different lengths, the sense strand is 19-23 nucleotides in length, and the antisense strand is 19-26 nucleotides in length; and the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:3, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:4:

[0036] 5'-CAAUAAAGCUGGACAAGAZ3-3' (SEQ ID NO: 3);

[0037] 5'-Z4UCUUGUCCAGCUUUAUUG-3'(SEQ ID NO:4),

[0038] Z3 is selected from A, U, G or C, and Z4 is a complementary nucleotide to Z3;

[0039] Alternatively, nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:47, and nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:48:

[0040] 5'-UUAAAAGGGACAGUAUUCZ7-3' (SEQ ID NO: 47);

[0041] 5'-Z8GAAUACUGUCCCUUUUAA-3'(SEQ ID NO:48),

[0042] Z7 is selected from A, U, G or C, and Z8 is a complementary nucleotide to Z7;

[0043] Alternatively, nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:107, and nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:108:

[0044] 5'-GGACAGUAUUCUCAGUGCZ 11 -3'(SEQ ID NO:107);

[0045] 5'-Z 12 GCACUGAGAAUACUGUCC-3'(SEQ ID NO:108),

[0046] Among them, Z 11 Selected from A, U, G, or C, Z 12 Is with Z 11 Complementary nucleotides.

[0047] Paragraph 12. The siRNA as described in any one of paragraphs 1-11, wherein the 2nd, 6th, 14th, and 16th nucleotides of the nucleotide sequence II are 2'-fluorinated nucleotides in the direction from the 5' end to the 3' end.

[0048] Paragraph 13. The siRNA as described in paragraph 12, wherein all nucleotides in nucleotide sequence II are modified nucleotides; all nucleotides in nucleotide sequence II are modified nucleotides in the direction from the 5' end to the 3' end; the 2nd, 6th, 14th, and 16th nucleotides of nucleotide sequence II in the direction from the 5' end to the 3' end are 2'-fluorinated modified nucleotides, and the other nucleotides in nucleotide sequence II are each independently one of non-fluorinated modified nucleotides.

[0049] Paragraph 14. The siRNA as described in any one of paragraphs 1-13, wherein the 7th to 9th nucleotides of the nucleotide sequence I are 2'-fluorinated nucleotides in the direction from the 5' end to the 3' end.

[0050] Paragraph 15. The siRNA as described in paragraph 14, wherein all nucleotides in nucleotide sequence I are modified nucleotides; the 7th to 9th nucleotides of nucleotide sequence I are 2'-fluorinated modified nucleotides in the direction from the 5' end to the 3' end, and the other nucleotides in nucleotide sequence I are each independently one of non-fluorinated modified nucleotides.

[0051] Paragraph 16. The siRNA as described in any one of paragraphs 1-15, wherein the sense strand further contains nucleotide sequence III, the antisense strand further contains nucleotide sequence IV, each nucleotide of nucleotide sequence III and nucleotide sequence IV is independently one of non-fluorinated modified nucleotides and is not the stabilizing modification, the length of nucleotide sequence III is 1, 2, 3 or 4 nucleotides, the length of nucleotide sequence IV and nucleotide sequence III are equal, and the length of nucleotide sequence IV and nucleotide sequence III are substantially anticomplementary or completely anticomplementary, nucleotide sequence III is attached to the 5' end of nucleotide sequence I, the length of nucleotide sequence IV is attached to the 3' end of nucleotide sequence II, and the length of nucleotide sequence IV is substantially anticomplementary or completely anticomplementary to a second nucleotide sequence, the second nucleotide sequence being a nucleotide sequence in the mRNA expressed by the APOC3 gene that is adjacent to the first nucleotide sequence and has the same length as nucleotide sequence IV.

[0052] Paragraph 17. The siRNA as described in Paragraph 16, wherein the nucleotide sequence I is equal in length to the nucleotide sequence shown in SEQ ID NO:1 and differs by no more than 1 nucleotide, and the lengths of nucleotide sequences III and IV are both 1 nucleotide, wherein the base of nucleotide sequence III is C and the base of nucleotide sequence IV is G; or, the lengths of nucleotide sequences III and IV are both 2 nucleotides, wherein the base composition of nucleotide sequence III is CC and the base composition of nucleotide sequence IV is GG; or, the lengths of nucleotide sequences III and IV are both 3 nucleotides, wherein the base composition of nucleotide sequence III is UCC and the base composition of nucleotide IV is GGA; or, the lengths of nucleotide sequences III and IV are both 4 nucleotides, wherein the base composition of nucleotide sequence III is CUCC and the base composition of nucleotide IV is GGAG.

[0053] Paragraph 18. The siRNA as described in paragraph 17, wherein the second nucleotide sequence is 1, 2, 3 or 4 nucleotides in length and has a base composition of C, CC, UCC or CUCC, respectively.

[0054] Paragraph 19. The siRNA as described in Paragraph 16, wherein the nucleotide sequence I is equal in length to the nucleotide sequence shown in SEQ ID NO:45 and differs by no more than 1 nucleotide, and the lengths of nucleotide sequences III and IV are both 1 nucleotide, wherein the base of nucleotide sequence III is C and the base of nucleotide sequence IV is G; or, the lengths of nucleotide sequences III and IV are both 2 nucleotides, wherein the base composition of nucleotide sequence III is GC and the base composition of nucleotide sequence IV is GC; or, the lengths of nucleotide sequences III and IV are both 3 nucleotides, wherein the base composition of nucleotide sequence III is UGC and the base composition of nucleotide sequence IV is GCA; or, the lengths of nucleotide sequences III and IV are both 4 nucleotides, wherein the base composition of nucleotide sequence III is UUGC and the base composition of nucleotide sequence IV is GCAA.

[0055] Paragraph 20. The siRNA as described in paragraph 19, wherein the second nucleotide sequence is 1, 2, 3 or 4 nucleotides in length and has a base composition of C, GC, GCA or GCAA, respectively.

[0056] Paragraph 21. The siRNA as described in paragraph 16, wherein the nucleotide sequence I is equal in length to the nucleotide sequence shown in SEQ ID NO:105 and differs by no more than 1 nucleotide, and the lengths of nucleotide sequences III and IV are both 1 nucleotide, wherein the base of nucleotide sequence III is G and the base of nucleotide sequence IV is C; or, the lengths of nucleotide sequences III and IV are both 2 nucleotides, wherein the base composition of nucleotide sequence III is AG and the base composition of nucleotide sequence IV is CU; or, the lengths of nucleotide sequences III and IV are both 3 nucleotides, wherein the base composition of nucleotide sequence III is AAG and the base composition of nucleotide sequence IV is CUU; or, the lengths of nucleotide sequences III and IV are both 4 nucleotides, wherein the base composition of nucleotide sequence III is AAAG and the base composition of nucleotide sequence IV is CUUU.

[0057] Paragraph 22. The siRNA as described in paragraph 21, wherein the second nucleotide sequence is 1, 2, 3 or 4 nucleotides in length and has the base composition of G, AG, AAG or AAAG, respectively.

[0058] Paragraph 23. The siRNA as described in any one of paragraphs 1-22, wherein the siRNA further comprises an oligonucleotide sequence V, each nucleotide of the oligonucleotide sequence V being independently one of non-fluorinated modified nucleotides and not the stabilizing modified nucleotide, the nucleotide sequence V being 1 to 3 nucleotides in length and being attached to the 3' end of the antisense strand to form a 3' overhang of the antisense strand.

[0059] Paragraph 24. The siRNA as described in paragraph 23, wherein the nucleotide sequence V is 2 nucleotides in length and, in the direction from the 5' end to the 3' end, the nucleotide sequence V is two consecutive thymine deoxyribonucleotides, two consecutive uracil ribonucleotides, or completely reverse complementary to the third nucleotide sequence, wherein the third nucleotide sequence refers to the nucleotide sequence in the mRNA expressed by the APOC3 gene that is adjacent to the first or second nucleotide sequence and has the same length as the nucleotide sequence V.

[0060] Paragraph 25. The siRNA as described in paragraph 24, wherein the first nucleotide sequence has the nucleotide sequence shown in SEQ ID NO:1, and the base composition of the third nucleotide sequence is CC; or, the first nucleotide sequence has the nucleotide sequence shown in SEQ ID NO:45, and the base composition of the third nucleotide sequence is GC; or, the first nucleotide sequence has the nucleotide sequence shown in SEQ ID NO:105, and the base composition of the third nucleotide sequence is AG.

[0061] Paragraph 26. The siRNA as described in any one of paragraphs 1-25, wherein the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:5, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO:6:

[0062] 5'-CAAUAAAGCUGGACAAGAZ3-3' (SEQ ID NO: 5);

[0063] 5'-Z4UCUUGUCCAGCUUUAUUGGG-3'(SEQ ID NO:6),

[0064] Wherein, Z4 is the first nucleotide at the 5' end of the antisense strand, Z3 is selected from A, U, G or C, and Z4 is a nucleotide complementary to Z3;

[0065] Alternatively, the sense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:7, and the antisense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:8.

[0066] 5'-CCCAAUAAAGCUGGACAAGAZ3-3' (SEQ ID NO:7);

[0067] 5'-Z4UCUUGUCCAGCUUUAUUGGGAG-3' (SEQ ID NO:8), wherein Z4 is the first nucleotide at the 5' end of the antisense strand, Z3 is selected from A, U, G or C, and Z4 is a nucleotide complementary to Z3;

[0068] Alternatively, the sense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:49, and the antisense strand contains a nucleotide sequence as shown in SEQ ID NO:50.

[0069] 5'-UUAAAAGGGACAGUAUUCZ7-3' (SEQ ID NO: 49);

[0070] 5'-Z8GAAUACUGUCCCUUUUAAGC-3'(SEQ ID NO:50),

[0071] Wherein, Z8 is the first nucleotide at the 5' end of the antisense strand, Z7 is selected from A, U, G or C, and Z8 is a nucleotide complementary to Z7;

[0072] Alternatively, the sense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:51, and the antisense strand contains a nucleotide sequence as shown in SEQ ID NO:52.

[0073] 5'-GCUUAAAAGGGACAGUAUUCZ7-3' (SEQ ID NO: 51);

[0074] 5'-Z8GAAUACUGUCCCUUUUAAGCAA-3'(SEQ ID NO:52),

[0075] Wherein, Z8 is the first nucleotide at the 5' end of the antisense strand, Z7 is selected from A, U, G or C, and Z8 is a nucleotide complementary to Z7;

[0076] Alternatively, the sense strand of the siRNA may contain a nucleotide sequence as shown in SEQ ID NO:49, and the antisense strand may contain a nucleotide sequence as shown in SEQ ID NO:149.

[0077] 5'-UUAAAAGGGACAGUAUUCZ7-3' (SEQ ID NO: 49);

[0078] 5'-Z8GAAUACUGUCCCUUUUAAUU-3'(SEQ ID NO:149),

[0079] Wherein, Z8 is the first nucleotide at the 5' end of the antisense strand, Z7 is selected from A, U, G or C, and Z8 is a nucleotide complementary to Z7;

[0080] Alternatively, the sense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:, and the antisense strand contains a nucleotide sequence as shown in SEQ ID NO:150:

[0081] 5'-GCUUAAAAGGGACAGUAUUCZ7-3' (SEQ ID NO: 51);

[0082] 5'-Z8GAAUACUGUCCCUUUUAAGCUU-3'(SEQ ID NO:150),

[0083] Wherein, Z8 is the first nucleotide at the 5' end of the antisense strand, Z7 is selected from A, U, G or C, and Z8 is a nucleotide complementary to Z7;

[0084] Alternatively, the sense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:109, and the antisense strand contains a nucleotide sequence as shown in SEQ ID NO:110.

[0085] 5'-GGACAGUAUUCUCAGUGCZ 11 -3'(SEQ ID NO:109);

[0086] 5'-Z 12 GCACUGAGAAUACUGUCCCU-3'(SEQ ID NO:110),

[0087] Wherein, the Z 12 It is the first nucleotide at the 5' end of the antisense strand, Z 11 Choose from A, U, G, or C, and Z 12 Is with Z 11 Complementary nucleotides;

[0088] Alternatively, the sense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:111, and the antisense strand contains a nucleotide sequence as shown in SEQ ID NO:112.

[0089] 5'-AGGGACAGUAUUCUCAGUGCZ 11 -3'(SEQ ID NO:111);

[0090] 5'-Z 12 GCACUGAGAAUACUGUCCCUUU-3'(SEQ ID NO:112),

[0091] Wherein, the Z 12 It is the first nucleotide at the 5' end of the antisense strand, Z 11 Choose from A, U, G, or C, and Z 12 Is with Z 11 Complementary nucleotides.

[0092] Paragraph 27. The siRNA as described in any one of paragraphs 13, 15-26, wherein each non-fluorinated modified nucleotide is independently selected from a nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosyl group with a non-fluorinated group, or a nucleotide analogue.

[0093] Paragraph 28. The siRNA as described in any of paragraphs 27, wherein each non-fluorinated nucleotide is a methoxylated nucleotide, wherein the methoxylated nucleotide refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribosome with a methoxy group.

[0094] Paragraph 29. The siRNA as described in paragraphs 1-28, wherein the siRNA is one of siAPOC3a1-M1, siAPOC3a1-M2, siAPOC3a2-M1, siAPOC3a2-M2, siAPOC3b1-M1, siAPOC3b1-M2, siAPOC3b2-M1, siAPOC3b2-M2, siAPOC3b3-M1, siAPOC3b3-M2, siAPOC3b4-M1, siAPOC3b4-M2, siAPOC3c1-M1, siAPOC3c1-M2, siAPOC3c2-M1, and siAPOC3c2-M2.

[0095] Paragraph 30. The siRNA as described in any one of paragraphs 1-29, wherein at least one phosphate ester group in the phosphate-sugar backbone of at least one single strand of the sense strand and the antisense strand is a phosphate ester group with a modifying group, said phosphate ester group with a modifying group being present at least at one of the following positions:

[0096] Between the first and second nucleotides at the 5' end of the positive strand;

[0097] Between the second and third nucleotides at the 5' end of the positive strand;

[0098] Between the first and second nucleotides at the 3' end of the positive strand;

[0099] Between the second and third nucleotides at the 3' end of the positive strand;

[0100] Between the first and second nucleotides at the 5' end of the antisense strand;

[0101] Between the second and third nucleotides at the 5' end of the antisense strand;

[0102] Between the first and second nucleotides at the 3' end of the antisense strand; and

[0103] Between the second and third nucleotides at the 3' end of the antisense strand.

[0104] Paragraph 31. The siRNA as described in paragraph 30, wherein the siRNA is one of siAPOC3a1-M1S, siAPOC3a1-M2S, siAPOC3a2-M1S, siAPOC3a2-M2S, siAPOC3b1-M1S, siAPOC3b1-M2S, siAPOC3b2-M1S, siAPOC3b2-M2S, siAPOC3b3-M1S, siAPOC3b3-M2S, siAPOC3b4-M1S, siAPOC3b4-M2S, siAPOC3c1-M1S, siAPOC3c1-M2S, siAPOC3c2-M1S, and siAPOC3c2-M2S.

[0105] Paragraph 32. The siRNA as described in any one of paragraphs 1-31, wherein the 5' terminal nucleotide of the antisense strand is a 5'-phosphate nucleotide or a nucleotide modified with a 5'-phosphate analogue.

[0106] Paragraph 33. The siRNA as described in paragraph 32, wherein the siRNA is siAPOC3a1-M1P1, siAPOC3a1-M2P1, siAPOC3a2-M1P1, siAPOC3a2-M2P1, siAPOC3a1-M1SP1, siAPOC3a1-M2SP1, siAPOC3a2-M1 SP1, siAPOC3a2-M2SP1, siAPOC3b1-M1P1, siAPOC3b1-M2P1, siAPOC3b2-M1P1, siAPOC3b2-M2P1, siAPOC3b1-M1SP1, siAPOC3b1-M2SP1, siAPOC3b2-M1SP1, siAPOC3b3-M1P1, siAPOC3b3-M2P1, siAPOC3b4-M1 One of P1, siAPOC3b4-M2P1, siAPOC3b3-M1SP1, siAPOC3b3-M2SP1, siAPOC3b4-M1SP1, siAPOC3b4-M2SP1, siAPOC3c1-M1P1, siAPOC3c1-M2P1, siAPOC3c2-M1P1, siAPOC3c2-M2P1, siAPOC3c1-M1SP1, siAPOC3c1-M2SP1, siAPOC3c2-M1 SP1, and siAPOC3c2-M2SP1.

[0107] Paragraph 34. A pharmaceutical composition comprising the siRNA described in any one of paragraphs 1-33 and a pharmaceutically acceptable carrier.

[0108] Paragraph 35. An siRNA conjugate comprising the siRNA described in any one of paragraphs 1-33 and a conjugate group conjugated to the siRNA, the conjugate group comprising a linker and a pharmaceutically acceptable targeting group, wherein the siRNA, the linker and the targeting group are covalently or non-covalently linked in sequence, and each of the targeting groups is selected from ligands capable of binding to cell surface receptors.

[0109] Paragraph 36. The siRNA conjugate as described in paragraph 35, wherein the conjugate has the structure shown in formula (308):

[0110]

[0111]

[0112] in,

[0113] n1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4; each m1, m2, or m3 is independently an integer selected from 2 to 10; R 10 R 11 R 12 R 13 R 14 or R 15 Each is independently H, or selected from the group consisting of C1-C. 10 Alkyl, C1-C 10 Halogenated alkyl groups and C1-C 10 Alkoxy;

[0114] R3 is a group with the structure shown in formula A59:

[0115]

[0116] Where E1 represents OH, SH, or BH2, and Nu represents siRNA.

[0117] R2 is a straight-chain alkylene group with a length of 1-20 carbon atoms, wherein one or more carbon atoms are optionally replaced by any one or more groups selected from the group consisting of: C(O), NH, O, S, CH=N, S(O)2, C2-C 10 alkenyl, C2-C 10 Ethyne group, C6-C 10 aryl, C3-C 18 Heterocyclic groups and C5-C 10 Heteroaryl; and wherein R2 may optionally have any one or more substituents from the group consisting of: C1-C 10 Alkyl, C6-C 10 Aryl, C5-C 10 heteroaryl, C1-C 10 Halogenated alkyl, -OC1-C 10 Alkyl, -OC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-OH, -OC1-C 10 Halogenated alkyl, -SC1-C 10 Alkyl, -SC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated alkyl groups, halogenated substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2,-N(C1-C) 10 Alkyl) (C1-C 10 alkyl), -NH(C1-C 10 Alkyl), -N(C1-C10 Alkyl) (C1-C 10 alkylphenyl), -NH(C1-C 10 Alkylphenyl), cyano, nitro, -CO2H, -C(O)O(C1-C 10 Alkyl), -CON (C1-C) 10 Alkyl) (C1-C 10 Alkyl), -CONH (C1-C) 10 Alkyl groups, -CONH2, -NHC(O) (C1-C) 10 alkyl), -NHC(O)(phenyl), -N(C1-C 10 Alkyl)C(O)(C1-C 10 Alkyl), -N(C1-C 10 alkyl)C(O)(phenyl), -C(O)C1-C 10 Alkyl, -C(O)C1-C 10 Alkylphenyl, -C(O)C1-C 10 Haloalkyl, -OC(O)Cl-C 10 Alkyl group, -SO2 (C1-C) 10 alkyl), -SO2 (phenyl), -SO2 (C1-C 10 Halogenated alkyl groups), -SO2NH2, -SO2NH (C1-C 10 alkyl), -SO2NH (phenyl), -NHSO2 (C1-C 10 Alkyl), -NHSO2 (phenyl) and -NHSO2 (C1-C) 10 (halogenated alkyl);

[0118] Each L1 is independently a straight-chain alkylene group with a length of 1-70 carbon atoms, wherein one or more carbon atoms are optionally replaced by any one or more groups selected from the group consisting of: C(O), NH, O, S, CH=N, S(O)2, C2-C 10 alkenyl, C2-C 10 Ethyne group, C6-C 10 aryl, C3-C 18 Heterocyclic groups and C5-C 10 Heteroaryl; and wherein L1 may optionally have any one or more substituents from the group consisting of: C1-C 10 Alkyl, C6-C 10 Aryl, C5-C 10 heteroaryl, C1-C 10 Halogenated alkyl, -OC1-C 10 Alkyl, -OC1-C 10 Alkylphenyl, -C1-C 10Alkyl-OH, -OC1-C 10 Halogenated alkyl, -SC1-C 10 Alkyl, -SC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated alkyl groups, halogenated substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2,-N(C1-C) 10 Alkyl) (C1-C 10 alkyl), -NH(C1-C 10 Alkyl), -N(C1-C 10 Alkyl) (C1-C 10 alkylphenyl), -NH(C1-C 10 Alkylphenyl), cyano, nitro, -CO2H, -C(O)O(C1-C 10 Alkyl), -CON (C1-C) 10 Alkyl) (C1-C 10 Alkyl), -CONH (C1-C) 10 Alkyl groups, -CONH2, -NHC(O) (C1-C) 10 alkyl), -NHC(O)(phenyl), -N(C1-C 10 Alkyl)C(O)(C1-C 10 Alkyl), -N(C1-C 10 alkyl)C(O)(phenyl), -C(O)C1-C 10 Alkyl, -C(O)C1-C 10 Alkylphenyl, -C(O)C1-C 10 Haloalkyl, -OC(O)Cl-C 10 Alkyl group, -SO2 (C1-C) 10 alkyl), -SO2 (phenyl), -SO2 (C1-C 10 Halogenated alkyl groups), -SO2NH2, -SO2NH (C1-C 10 alkyl), -SO2NH (phenyl), -NHSO2 (C1-C 10 Alkyl), -NHSO2 (phenyl) and -NHSO2 (C1-C) 10 (halogenated alkyl);

[0119] The site indicates the covalently linked group; each M1 is independently selected from one of the ligands that have affinity for the desialylate glycoprotein receptor on the surface of mammalian liver cells.

[0120] Paragraph 37. The siRNA conjugate as described in paragraph 36, wherein L1 is 3-25 atoms in length, and L1 is selected from at least two linkage combinations of A1, A4, A8, A10, and A11:

[0121]

[0122] Where each j1 is an independent integer from 1 to 20; each j2 is an independent integer from 1 to 20;

[0123] This indicates the site where a group is covalently bonded.

[0124] Paragraph 38. The siRNA conjugate as described in paragraph 6 or 37, wherein n1 is an integer from 1 to 2, n3 is an integer from 0 to 1, and n1 + n3 = 2 - 3.

[0125] Paragraph 39. The siRNA conjugate as described in any one of paragraphs 36-38, wherein each m1, m2 or m3 is independently an integer of 2-5, and / or m1 = m2 = m3.

[0126] Paragraph 40. The siRNA conjugate as described in any one of paragraphs 36-39, wherein each of the target groups is independently a desialylated glycoprotein or a sugar;

[0127] Alternatively, each of the target groups is independently selected from D-mannose, L-mannose, D-arabinose, D-xylfuranose, L-xylfuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannose, β-D-mannose, α-D-mannose, β-D-mannose, α-D-glucose, β-D-glucose, α-D-glucose, β-D-glucose, α-D-glucose, β-D-glucose, α-D-glucose - Furanose, β-D-furanose, α-D-fructose, α-D-fructose pyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactopyranose, β-D-galactopyranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino -3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-carboxamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfonamido-D-glucopyranose, N-ethanolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, 2,3,4- One of the following: tri-O-acetyl-1-thio-6-O-triphenylmethyl-α-D-glucopyranoside methyl ester, 4-thio-β-D-galactopyranose, 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucopyranoside ethyl ester, 2,5-dehydrated-D-alosulfonyl, ribose, D-ribose, D-4-thioribose, L-ribose, and L-4-thioribose;

[0128] Alternatively, at least one or each of the target groups is galactose or N-acetylgalactosamine.

[0129] Paragraph 41. The siRNA conjugate as described in any one of paragraphs 36-40, wherein R 10 R 11 R 12 R 13 R 14 or R 15 It can be H, methyl, or ethyl independently.

[0130] Paragraph 42. The siRNA conjugate as described in any of paragraphs 36-41, wherein R2 contains both a linker site for connecting to N on the nitrogen-containing backbone and a linker site for connecting to P atoms in R3;

[0131] Alternatively, the sites on R2 that are connected to N on the nitrogen-containing skeleton can form amide bonds with N, and the sites that are connected to P atoms in R3 can form phosphate bonds with P.

[0132] Alternatively, R2 may be selected from groups represented by formula (B5), (B6), (B5'), or (B6').

[0133]

[0134] in, Indicates the site where a group is covalently bonded;

[0135] The value of q2 can be an integer from 1 to 10.

[0136] Paragraph 43. The siRNA conjugate as described in any one of paragraphs 36-42, wherein the conjugate has a structure as shown in formula (403), (404), (405), (406), (407), (408), (409), (410), (411), (412), (413), (414), (415), (416), (417), (418), (419), (420), (421), or (422):

[0137]

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145] Paragraph 44. The siRNA conjugate as described in any one of paragraphs 36-43, wherein the P atom in formula A59 is attached to the end of the sense or antisense strand of the siRNA, the end referring to the first 4 nucleotides of the sense or antisense strand counting from one end;

[0146] Alternatively, the P atom in Formula A59 may be attached to the end of the sense or antisense strand of the siRNA; or the P atom in Formula A59 may be attached to the 3' end of the sense strand of the siRNA.

[0147] Alternatively, the P atom in formula A59 can be linked to the 2', 3', or 5' position of a nucleotide in the siRNA via a phosphodiester bond.

[0148] Paragraph 45. The siRNA conjugate as described in any one of paragraphs 36-44, wherein the siRNA conjugate is one of conjugate 1 to conjugate 7.

[0149] Paragraph 46. Use of the siRNA described in any one of paragraphs 1-33, and / or the pharmaceutical composition described in paragraph 34 and / or the siRNA conjugates described in paragraphs 35-45 in the preparation of a medicament for treating and / or preventing diseases or symptoms associated with the mRNA level of APOC3 gene expression.

[0150] Paragraph 47. Uses as described in paragraph 46, wherein the disease or symptom associated with the mRNA level of APOC3 gene expression is dyslipidemia.

[0151] Paragraph 48. A method for inhibiting APOC3 gene expression levels in cells in vitro, the method comprising contacting the cells with an effective dose of any one of paragraphs 1-33 of siRNA, and / or the pharmaceutical composition of paragraph 34 and / or the siRNA conjugates of paragraphs 35-45.

[0152] Paragraph 49. A kit comprising the siRNA described in any one of paragraphs 1-33, and / or the pharmaceutical composition described in paragraph 34 and / or the siRNA conjugates described in paragraphs 35-45.

[0153] Incorporate by reference

[0154] All publications, patents and patent applications mentioned in this specification are incorporated herein by reference to the same extent that each individual publication, patent or patent application is specifically and individually incorporated herein by reference.

[0155] Beneficial effects

[0156] The siRNA, pharmaceutical composition, and / or siRNA conjugate disclosed herein exhibit good stability, low off-target effects, good APOC3 gene expression inhibitory activity, and show good lipid-lowering effects. Specific details are as follows.

[0157] First, the siRNA, pharmaceutical composition, and / or siRNA conjugate of this disclosure exhibit lower off-target effects and / or lower toxicity due to off-target effects, either in vitro or in vivo. In particular, mice administered the siRNA conjugate of this disclosure showed significantly lower blood biochemical results and a marked toxicity advantage compared to the reference siRNA conjugate. For example, in mice administered the siRNA conjugate of this disclosure at a dose of 100 mg / kg, blood biochemical parameters were significantly reduced, showing no significant abnormalities compared to the blank control group; and compared to the reference siRNA conjugate, mice administered the siRNA conjugate of this disclosure did not exhibit moderate to severe inflammatory cell infiltration and necrosis, showing significantly lower toxicity in histopathology. Furthermore, even at a high dose of 300 mg / kg, serum ALT was not significantly different from the blank control group, and compared to the six mice administered the reference conjugate, all of which showed inflammatory cell infiltration in histopathological sections, only three mice administered the conjugate of this disclosure showed inflammatory cell infiltration, representing a significantly reduced number of mice with inflammatory cell infiltration. For example, the siRNA conjugates disclosed herein exhibit low off-target effects. In the in vitro sicheck system, the siRNA conjugates of this disclosure demonstrate excellent on-target inhibitory activity against the target sequence, with IC50 values ​​ranging from 4.50 pM to 11.3 pM. Simultaneously, the inhibition rate against off-target sequences was less than 50% across the entire tested siRNA concentration range, demonstrating low off-target effects. Furthermore, in mice administered the siRNA conjugates of this disclosure weekly at a high dose of 300 mg / kg for three consecutive weeks, serum ALT and AST concentrations were comparable to those in the blank control group. Further, in pathological sections, mice administered the siRNA conjugates of this disclosure also showed responses similar to the blank control group in terms of hepatic steatosis and inflammation, with no significant abnormalities, indicating that the siRNA conjugates of this disclosure have very low hepatotoxicity.

[0158] Second, the siRNAs, pharmaceutical compositions, and / or siRNA conjugates disclosed herein have demonstrated excellent APOC3 gene expression regulatory activity in in vitro and in vivo experiments. For example, the siRNA conjugates provided herein have shown high target sequence inhibitory activity in the in vitro sicheck system, with an IC50 concentration of [missing information]. 50The target sequence inhibitory activity is close to that of the reference siRNA conjugate without stabilizing nucleotides, ranging from 6.89 to 8.55 pM. For example, the siRNA conjugate provided in this disclosure exhibits high target sequence inhibitory activity in the in vitro sicheck system. At a low concentration of 0.01 nM, there is at least a target sequence expression inhibition rate of 38.92 nM, with a maximum of 67.54%; at a concentration of 0.1 nM, the target sequence expression inhibition rate reaches 84.73-89.35%. Simultaneously, compared to the reference siRNA conjugate without stabilizing nucleotides, it has a target sequence inhibitory activity level that is close to or not significantly reduced.

[0159] Third, the siRNA, pharmaceutical composition, and / or siRNA conjugate disclosed herein exhibit good TG-lowering effects in vivo. For example, at different time points after administration, the siRNA conjugate disclosed herein significantly reduced TG and CHO levels in mouse serum, showing a similar or no significant reduction in blood lipid levels compared to the corresponding reference siRNA conjugate without stabilizing modified nucleotides. In particular, at a dose of 3 mg / kg, the siRNA conjugate disclosed herein consistently showed a high TG-lowering effect throughout the entire 50-day administration period, with a maximum inhibition rate of 90.2%. Again, for example, at different time points after administration, the siRNA conjugate disclosed herein significantly reduced TG and CHO levels in mouse serum, showing a similar reduction in blood lipid levels compared to the corresponding reference siRNA conjugate without stabilizing modified nucleotides. In particular, at doses of 3 mg / kg and 1 mg / kg, the siRNA conjugate disclosed herein consistently showed a high TG-lowering effect throughout the entire 50-day administration period, with a maximum inhibition rate of 92.0%. For example, at different time points after administration, different concentrations of the disclosed siRNA conjugate all reduced serum TG levels in mice. In particular, at a dose of 9 mg / kg, a single administration maintained a TG inhibition rate greater than 50% for a prolonged period of 64 days, with a maximum inhibition rate reaching 89.5%, demonstrating excellent lipid-inhibiting ability. Furthermore, at different time points after administration, the disclosed siRNA conjugate significantly reduced serum TG and CHO levels in mice, maintaining a high inhibitory effect throughout the 43-day experimental period. Specifically, a 3 mg / kg dose of the disclosed siRNA conjugate consistently showed excellent lipid-inhibiting effects in mice, with maximum serum TG inhibition rates exceeding 88% and maximum serum CHO inhibition rates ranging from 51.18% to 57.41%. For example, at different time points after administration, the siRNA conjugate of this disclosure significantly reduced the levels of TG and CHO in mouse serum, and maintained a high inhibitory effect throughout the 22-day experimental period, and showed a lipid-lowering effect similar to that of the corresponding reference siRNA conjugate without stabilizing modified nucleotides.

[0160] This demonstrates that the siRNA, pharmaceutical composition, and siRNA conjugates provided in this disclosure can effectively inhibit the expression of the APOC3 gene in vitro and in vivo, while exhibiting significantly lower off-target effects and toxic reactions caused by off-target effects, especially hepatotoxicity, and show good lipid-lowering activity. Therefore, they can effectively treat and / or prevent disease symptoms related to the mRNA level of APOC3 gene expression, especially dyslipidemia, with significantly higher safety, and have good application prospects. Attached Figure Description

[0161] Figure 1A and Figure 1B The images show scatter plots of ALT and AST concentrations in mouse serum after weekly administration of 300 mg / kg of the disclosed siRNA conjugate or PBS for three consecutive weeks.

[0162] Figure 2 This is a bar chart showing the relative expression levels of the target sequence in the in vitro sicheck system after co-transfection of a plasmid containing the target sequence and an siRNA conjugate or a reference siRNA NC.

[0163] Figure 3A and Figure 3B Line graphs showing the changes in serum TG or serum CHO levels over time after administration of the siRNA conjugate, reference siRNA conjugate, or PBS disclosed herein.

[0164] Figure 4A and Figure 4B Line graphs showing the changes in serum TG or serum CHO levels over time after administration of the siRNA conjugate, reference siRNA conjugate, or PBS disclosed herein.

[0165] Figure 5A and Figure 5B Line graphs showing the changes in serum TG or serum CHO levels over time after administration of the siRNA conjugate or PBS disclosed herein.

[0166] Figure 6 Line graphs showing the changes in serum TG levels over time after administration of different concentrations of the siRNA conjugates or PBS of this disclosure.

[0167] Figure 7A and Figure 7B Line graphs showing the changes in serum TG or serum CHO levels over time after administration of the siRNA conjugate or PBS disclosed herein.

[0168] Figure 8A and Figure 8B Line graphs showing the changes in serum TG or serum CHO levels over time after administration of the siRNA conjugate, reference siRNA conjugate, or PBS disclosed herein. Detailed Implementation

[0169] The following provides a detailed description of specific embodiments of this disclosure. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit this disclosure.

[0170] In this disclosure, unless otherwise specified, APOC3 mRNA or “APOC3 gene-expressing mRNA” refers to mRNA having the sequence shown in Genbank accession number NM_000040.3, and APOC3 gene refers to the gene that transcribes the aforementioned APOC3 mRNA.

[0171] definition

[0172] Unless otherwise specified, in the preceding and following text, uppercase letters C, G, U, and A represent the base composition of nucleotides; lowercase letter m indicates that the nucleotide adjacent to the left of letter m is a methoxy-modified nucleotide; lowercase letter f indicates that the nucleotide adjacent to the left of letter f is a fluorinated nucleotide; lowercase letter s indicates that the two nucleotides adjacent to the left and right of letter s are linked by a thiophosphate group; P1 indicates that the nucleotide adjacent to the right of letter P1 is a 5'-phosphate nucleotide or a 5'-phosphate analog nucleotide. In some embodiments, P1 represents the specific modification VP, Ps, or P, wherein the letter combination VP indicates that the nucleotide adjacent to the right of the letter combination VP is a vinyl phosphate (5'-(E)-vinylphosphonate, E-VP) modified nucleotide, the letter combination Ps indicates that the nucleotide adjacent to the right of the letter combination Ps is a thiophosphate modified nucleotide, and the uppercase letter P indicates that the nucleotide adjacent to the right of letter P is a 5'-phosphate nucleotide.

[0173] In the preceding and following text, "fluorinated nucleotides" refers to nucleotides formed by replacing the 2'-hydroxyl group of the ribosome with fluorine, and "non-fluorinated nucleotides" refers to nucleotides or nucleotide analogs formed by replacing the 2'-hydroxyl group of the ribosome with a non-fluorinated group. "Nucleotide analogs" refer to groups that can replace nucleotides in nucleic acids but whose structure differs from adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides, or thymine deoxyribonucleotides. Examples include isonucleotides, bridged nucleic acids (BNAs), or acyclic nucleotides. "Methoxylated nucleotides" refers to nucleotides formed by replacing the 2'-hydroxyl group of the ribosome with a methoxy group.

[0174] In the context of this document, the terms "complementary" and "reverse complementary" are used interchangeably and have the meaning known to those skilled in the art: in a double-stranded nucleic acid molecule, the bases of one strand are paired complementaryly with the bases of the other strand. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair consists of one purine and one pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary, and the sequence of the complementary strand can be inferred from its sequence. Correspondingly, "mismatch" in the art means, in a double-stranded nucleic acid, that the bases at corresponding positions are not paired complementaryly.

[0175] Unless otherwise specified above and below, "substantially anticomplementary" means that there are no more than 3 base mismatches between the two nucleotide sequences involved; "substantially anticomplementary" means that there are no more than 1 base mismatch between the two nucleotide sequences; and "completely anticomplementary" means that there are no base mismatches between the two nucleotide sequences.

[0176] In the foregoing and hereinafter, particularly in the description of the methods for preparing siRNA, pharmaceutical compositions, or siRNA conjugates of this disclosure, unless otherwise specified, the nucleoside monomer refers to the unmodified or modified RNA phosphoramidites (sometimes also called nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis, depending on the type and sequence of nucleotides in the siRNA or siRNA conjugate to be prepared. Phosphoramidite solid-phase synthesis is a method known to those skilled in the art for RNA synthesis. All nucleoside monomers used in this disclosure are commercially available.

[0177] Those skilled in the art will understand that for any group containing one or more substituents, these groups are not intended to introduce any substitution or substitution pattern that is spatially impractical, synthetically infeasible, and / or inherently unstable.

[0178] As used herein, “alkyl” refers to a straight-chain or branched alkyl group having a specified number of carbon atoms, typically from 1 to 20 carbon atoms, such as from 1 to 10 carbon atoms, or from 1 to 8 or 1 to 6 carbon atoms. For example, C1-C6 alkyl groups comprise straight-chain and branched alkyl groups with 1 to 6 carbon atoms. When referring to an alkyl residue having a specific number of carbon atoms, it is intended to encompass all branched and straight-chain forms having that number of carbon atoms; thus, for example, “butyl” means including n-butyl, sec-butyl, isobutyl, and tert-butyl; “propyl” includes n-propyl and isopropyl. Alkylenes are subsets of alkyl groups, referring to residues that are identical to alkyl groups but have two connection sites.

[0179] As used herein, "alkenyl" refers to an unsaturated branched or straight-chain alkyl group having at least one carbon-carbon double bond obtained by removing a hydrogen molecule from an adjacent carbon atom of the parent alkyl group. The group can be in either a cis or trans configuration of the double bond. Typical alkenyl groups include, but are not limited to: vinyl; propenyl, such as propyl-1-en-1-yl, propyl-1-en-2-yl, propyl-2-en-1-yl (allyl), propyl-2-en-2-yl; butenyl, such as buten-1-en-1-yl, buten-1-en-2-yl, 2-methylpropen-1-en-1-yl, buten-2-en-1-yl, buten-2-en-2-yl, buten-1,3-dien-1-yl, buten-1,3-dien-2-yl, etc. In some embodiments, the alkenyl group has 2 to 20 carbon atoms, while in other embodiments, it has 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Subalkenyl groups are a subset of alkenyl groups, referring to residues that are identical to alkenyl groups but have two connection points.

[0180] As used herein, "alkynyl" refers to an unsaturated branched or straight-chain alkyl group having at least one carbon-carbon triple bond obtained by removing two hydrogen molecules from adjacent carbon atoms of the parent alkyl group. Typical alkynyl groups include, but are not limited to: ethynyl; propynyl, such as prop-1-yn-1-yl, prop-2-yn-1-yl; butynyl, such as but-1-yn-1-yl, but-1-yn-3-yl, but-3-yn-1-yl, etc. In some embodiments, the alkynyl group has 2 to 20 carbon atoms, while in other embodiments, it has 2 to 10, 2 to 8, or 2 to 6 carbon atoms. A subset of alkynyl groups refers to residues identical to the alkynyl group but with two linkage sites.

[0181] As used herein, "alkoxy" refers to an alkyl group with a specified number of carbon atoms connected by oxygen bridges, such as methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, pentooxy, 2-pentoxy, isopentoxy, neopentoxy, hexoxy, 2-hexoxy, 3-hexoxy, 3-methylpentoxy, etc. Alkoxy groups typically have 1 to 10, 1 to 8, 1 to 6, or 1 to 4 carbon atoms connected by oxygen bridges.

[0182] As used herein, "aryl" refers to a group derived from an aromatic monocyclic or polycyclic hydrocarbon ring system by removing a hydrogen atom from a ring carbon atom. This aromatic monocyclic or polycyclic hydrocarbon ring system contains only hydrogen and carbon atoms of 6 to 18, wherein at least one ring in the ring system is fully unsaturated, i.e., contains a cyclic, delocalized (4n+2)π-electron system according to Hückel's theory. Aryl groups include, but are not limited to, phenyl, fluorenyl, and naphthyl groups. Alearyl groups are a subset of aryl groups, referring to residues identical to aryl groups but with two connection points.

[0183] "Heteroaryl" refers to a group derived from a 3- to 18-membered aromatic ring radical, comprising 2 to 17 carbon atoms and 1 to 6 heteroatoms selected from nitrogen, oxygen, and sulfur. As used herein, a heteroaryl can be a monocyclic, bicyclic, tricyclic, or tetracyclic system, wherein at least one ring in the ring system is fully unsaturated, i.e., comprising a cyclic delocalized (4n+2) π-electron system according to Hückel's theory. Heteroaryls include fused ring or bridged ring systems. In some embodiments, the heteroatoms in the heteroaryl are oxidized heteroatoms. In some embodiments, the heteroaryl contains one or more nitrogen atoms. In some embodiments, one or more of the nitrogen atoms in the heteroaryl are quaternized nitrogen atoms. The heteroaryl is attached to the remainder of the molecule via any ring atom. Examples of heteroaryl groups include, but are not limited to: aziridine, heptatrienyl, acridine, benzimidazolyl, benzoindolyl, 1,3-benzodioxazolyl, benzofuranyl, benzooxazolyl, benzo[d]thiazolyl, benzo[b][1,4]dioxepinyl, benzo[b][1,4]oxazinyl, 1,4-benzodioxanyl, benzene benzo[a]furanyl, benzo[a]oxazolyl, benzo[a]dioxolyl, benzo[a]dioxinyl, benzo[a]pyranyl, benzo[a]pyranoneyl, benzo[a]furanyl, benzo[a]furanoneyl, benzo[a]thiophenyl, benzo[a]thiophene[3,2-d]pyrimidinyl, benzo[a]triazolyl, benzo[4,6]imidazo[1,2-a]pyridyl, carbazoleyl, cinnolinyl, cyclopentano[d]pyrimidinyl, 6,7-dihydro-5H-cyclopentano[4,5] Thiophene[2,3-d]pyrimidinyl, 5,6-dihydrobenzo[h]quinazolinyl, 5,6-dihydrobenzo[h]cinnolinyl, 6,7-dihydro-5H-benzo[6,7]cycloheptano[1,2-c]pyridazinyl, dibenzofuranyl, dibenzothiophenyl, furanyl, furanoneyl, furano[3,2-c]pyridinyl, 5,6,7,8 9,10-Hexahydrocyclooctano[d]pyrimidinyl, 5,6,7,8,9,10-Hexahydrocyclooctano[d]pyridazinyl, 5,6,7,8,9,10-Hexahydrocyclooctano[d]pyridinyl, isothiazolyl, imidazolyl, indazolyl, indole, isoyindolyl, dihydroindolyl, isodihydroindolyl, isoquinolinyl, indolizinyl, isoxazolyl, 5,8-methanol-5,6,7,8-tetrahydroquinazolinyl (5,8-methano-5,6,7,8-tetrahydroquinazolinyl), naphthyridinyl, 1,6-naphthyridinonyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, oxiranyl, 5,6,6a,7,8,9,10,10a-octahydrobenzo[H]quinazolinyl, 1-phenyl-1H-pyrroleyl, phenazinyl, phenothiazinyl, phenotoxazinyl, phthalazinyl, pteridinyl, purine, pyrroleyl, pyrazolyl, pyrazolo[3,4-d]pyrimidinyl, pyridinyl, pyrido[3,2-d]pyrimidinyl, pyrido[3,4-d]pyrimidinyl Pyrimidinyl, pyrazinyl, pyrimidinyl, pyridazinyl, pyrroleyl, quinazolinyl, quinoxalinyl, quinolinyl, tetrahydroquinolinyl, 5,6,7,8-tetrahydroquinazolinyl, 5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-d]pyrimidinyl, 6,7,8,9-tetrahydro-5H-cycloheptano[4,5]thieno[2,3-d]pyrimidinyl, 5,6,7,8-tetrahydropyridano[4,5-c]pyridazinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, thieno[2,3-c]pyridinyl, thieno[3,2-d]pyrimidinyl, thieno[2,3-c]pyridinyl, and thiophenyl / thienyl. ,

[0184] Various hydroxyl protecting groups may be used in this disclosure. Generally, protecting groups make a chemical function insensitive to specific reaction conditions and can be added to and removed from that function in a molecule without substantially impairing the rest of the molecule. Representative hydroxyl protecting groups are disclosed in Beaucage et al., Tetrahedron 1992, 48, 2223-2311, and Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2ded, John Wiley & Sons, New York, 1991, all of which are incorporated herein by reference in their entirety. In some embodiments, the protecting group is stable under basic conditions but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxyl protecting groups that may be used herein include dimethoxytriphenylmethyl (DMT), monomethoxytriphenylmethyl, 9-phenyloxanthracene-9-yl (Pixyl), and 9-(p-methoxyphenyl)oxanthracene-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxyl protecting groups that may be used herein include Tr (triphenylmethyl), MMTr (4-methoxytriphenylmethyl), DMTr (4,4'-dimethoxytriphenylmethyl), and TMTr (4,4',4”-trimethoxytriphenylmethyl).

[0185] The term “subject” as used herein refers to any animal, such as a mammal or marsupial. Subjects of this disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cattle, rabbits, sheep, rats, and any kind of poultry.

[0186] As used herein, “treatment” refers to a method of achieving a beneficial or desired outcome, including but not limited to treatment benefits. A “treatment benefit” means the eradication or improvement of the underlying disorder being treated. Furthermore, a treatment benefit is achieved by eradicating or improving one or more physical symptoms associated with the underlying disorder, thereby observing improvement in the subject, even though the subject may still be suffering from the underlying disorder.

[0187] As used herein, “prevention” refers to methods for obtaining a beneficial or desired outcome, including but not limited to preventive benefits. To obtain a “preventive benefit,” double-stranded siRNA, pharmaceutical compositions, or siRNA conjugates may be given to subjects at risk of developing a specific disease, or to subjects who report one or more physiological symptoms of a disease, even if a diagnosis of the disease may not have been made.

[0188] This disclosed siRNA

[0189] On one hand, this disclosure provides an siRNA with high APOC3 gene repression activity and low off-target effects.

[0190] The siRNA disclosed herein contains nucleotide groups as basic structural units, as is known to those skilled in the art. These nucleotide groups contain phosphate groups, ribose groups, and bases, which will not be described again.

[0191] The disclosed siRNA comprises a sense strand and an antisense strand. The sense strand comprises nucleotide sequence I, and the antisense strand comprises nucleotide sequence II. Both nucleotide sequences I and II consist of 19 nucleotides. Each nucleotide in nucleotide sequences I and II is a modified or unmodified nucleotide. Nucleotide sequences I and II are at least partially anticomplementary to form a double-stranded region. Nucleotide sequence II is at least partially anticomplementary to a first nucleotide sequence, which is a 19-nucleotide sequence in the mRNA expressed by the APOC3 gene. At least one of the 3rd to 6th nucleotides of nucleotide sequence II is a stabilizing modified nucleotide, which is a nucleotide in which the 2' hydroxyl group of the ribose is replaced by a stabilizing modified group. Compared with siRNA in which the nucleotide at the corresponding position is an unmodified nucleotide, siRNA containing the stabilizing modified nucleotide has increased thermal stability, and the steric hindrance of the stabilizing modified group is greater than that of the 2'-O-methyl group.

[0192] In some embodiments, the third or fifth nucleotide of nucleotide sequence II, in the direction from the 5' end to the 3' end, is the stabilizing modified nucleotide. In some embodiments, no more than two nucleotides from the third to the ninth nucleotide of nucleotide sequence II, in the direction from the 5' end to the 3' end, are the stabilizing modified nucleotides. By limiting the number of stabilizing modified nucleotides at specific positions, the siRNA of this disclosure achieves an optimal balance between pharmaceutical activity and low off-target effects, while also exhibiting excellent stability. In some embodiments, the third and / or fifth nucleotide of nucleotide sequence II, in the direction from the 5' end to the 3' end, is the stabilizing modified nucleotide. In some embodiments, the third nucleotide of nucleotide sequence II, in the direction from the 5' end to the 3' end, is the stabilizing modified nucleotide. In some embodiments, the fifth nucleotide of nucleotide sequence II, in the direction from the 5' end to the 3' end, is the stabilizing modified nucleotide.

[0193] In the siRNA disclosed herein, all nucleotides other than the 3rd to 9th nucleotides in nucleotide sequence II, from the 5' end to the 3' end, are not stabilizing nucleotides. If at least one of the 3rd to 6th nucleotides in nucleotide sequence II is a stabilizing nucleotide, and stabilizing nucleotides are also present outside the 3rd to 9th nucleotides, it may significantly affect the regulatory ability of the siRNA to target sequence expression levels.

[0194] In some embodiments, "increased thermal stability of siRNA" refers to an increase in the thermal dissociation temperature (Tm) of the siRNA. In some embodiments, "increased thermal stability of double-stranded siRNA" means an increase in the Tm of the siRNA of at least 0.05°C, in some embodiments it means an increase of 0.1-6°C, and in some embodiments it means an increase of 0.5-4°C. Without being limited by theoretical explanations, by including stabilizing modified nucleotides at specific positions, the binding ability of the antisense strand of the siRNA disclosed herein to the mRNA expressed by the APOC3 gene is essentially unaffected, while the binding to off-target mRNA is significantly reduced, thereby reducing or even eliminating off-target effects.

[0195] In some embodiments, each of the stabilizing modifying groups independently has the structure shown as -XR, wherein X is O, NR', S, or SiR'2; R is one of C2-C6 alkyl, substituted C2-C6 alkyl, C6-C8 aryl, or substituted C6-C8 aryl; each R' is independently one of H, C1-C6 alkyl, substituted C1-C6 alkyl, C6-C8 aryl, or substituted C6-C8 aryl, wherein the substituted C2-C6 alkyl, substituted C6-C8 aryl, or substituted C1-C6 alkyl refers to a group formed by replacing one or more hydrogen atoms of C2-C6 alkyl, C6-C8 aryl, or C1-C6 alkyl with a substituent selected from one or more of the following substituents: C1-C3 alkyl, C6-C8 aryl, C1-C3 alkoxy, halogen, oxoyl group, and thioyl group. It should be noted that this disclosure is not intended to cover all modifying groups conforming to the above structure, but only to those stabilizing modifying groups that can achieve increased thermostability of siRNA. In some embodiments, each of the stabilizing modifying groups is independently selected from one of 2'-O-methoxyethyl, 2'-O-allyl, 2'-C-allyl, 2'-O-2-N-methylamino-2-oxomethyleneethyl, 2'-O-2-N,N-dimethylaminoethyl, 2'-O-3-aminopropyl, and 2'-O-2,4-dinitrophenyl. In some embodiments, each of the stabilizing modifying groups is 2'-O-methoxyethyl.

[0196] In some embodiments, the siRNA with stabilizing nucleotides disclosed herein may be the first, second, or third type of siRNA, each of which will be described below.

[0197] The first type of siRNA

[0198] In some embodiments, the siRNA disclosed herein is a first type of siRNA. Specifically, nucleotide sequence I is equal in length to the nucleotide sequence shown in SEQ ID NO:1, and differs by no more than 3 nucleotides, and nucleotide sequence II is equal in length to the nucleotide sequence shown in SEQ ID NO:2, and differs by no more than 3 nucleotides.

[0199] 5'-CAAUAAAGCUGGACAAGAZ1-3' (SEQ ID NO: 1);

[0200] 5'-Z2UCUUGUCCAGCUUUAUUG-3'(SEQ ID NO:2),

[0201] Where Z1 is A and Z2 is U;

[0202] Furthermore, nucleotide sequence I contains nucleotide Z3 at position Z1, and nucleotide sequence II contains nucleotide Z4 at position Z2, wherein Z4 is the first nucleotide at the 5' end of the antisense strand. The first nucleotide sequence is as shown in SEQ ID NO:1. Each U can be arbitrarily replaced by T. In the preceding and following text of this disclosure, "positional correspondence" means that the nucleotides are located at the same position in the nucleotide sequence, counting from the same end. For example, the first nucleotide at the 3' end of nucleotide sequence I is the nucleotide corresponding to the first nucleotide in SEQ ID NO:1.

[0203] In some embodiments, the sense strand contains only nucleotide sequence I, and the antisense strand contains only nucleotide sequence II.

[0204] In some embodiments, the nucleotide sequence I differs from the nucleotide sequence shown in SEQ ID NO:1 by no more than one nucleotide, and / or the nucleotide sequence II differs from the nucleotide sequence shown in SEQ ID NO:2 by no more than one nucleotide.

[0205] In some embodiments, the nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2 includes a difference at the Z4 position, where Z4 is selected from A, G, or C. In some embodiments, the nucleotide difference is a difference at the Z4 position, where Z4 is selected from A, G, or C. In some embodiments, Z3 is a nucleotide complementary to Z4. These nucleotide differences do not significantly reduce the target gene repression ability of the siRNA or increase the off-target effects of the siRNA, and these siRNAs containing nucleotide differences are also within the scope of protection of this disclosure.

[0206] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are substantially anticomplementary, substantially anticomplementary, or completely anticomplementary; substantially anticomplementary means that there is no more than 3 base mismatches between the two nucleotide sequences; substantially anticomplementary means that there is no more than 1 base mismatch between the two nucleotide sequences; completely anticomplementary means that there is no mismatch between the two nucleotide sequences.

[0207] In some embodiments, nucleotides 2-19 of nucleotide sequence II are completely anticomplementary to nucleotides 1-18 of the first nucleotide sequence in the 5' to 3' direction. In some embodiments, nucleotide sequence II is completely anticomplementary to nucleotide sequence I, or there is a base mismatch between the second nucleotide of nucleotide sequence II and the second nucleotide of nucleotide sequence I in the 3' to 5' direction. By including this base mismatch, the target gene expression repression activity of the siRNA disclosed herein can be further enhanced while maintaining low off-target effects.

[0208] In some embodiments, nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:3, and nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:4.

[0209] 5'-CAAUAAAGCUGGACAAGAZ3-3' (SEQ ID NO: 3);

[0210] 5'-Z4UCUUGUCCAGCUUUAUUG-3'(SEQ ID NO:4),

[0211] Z3 is selected from A, U, G or C, and Z4 is a complementary nucleotide to Z3; in some embodiments, Z3 is A and Z4 is U.

[0212] Furthermore, the sense and antisense strands may be the same or different in length, with the sense strand being 19-23 nucleotides long and the antisense strand being 19-26 nucleotides long. Thus, the length ratio of the sense and antisense strands of the siRNA provided in this disclosure can be 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 20, 20 / 21, or 20 / 22. The possible values ​​are: 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 20, 21 / 21, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 20, 23 / 21, 23 / 22, 23 / 23, 23 / 24, 23 / 25, or 23 / 26. In some embodiments, the length ratio of the siRNA's sense strand to its antisense strand is 19 / 21, 21 / 23, or 23 / 25.

[0213] In some embodiments, the sense strand further contains nucleotide sequence III, and the antisense strand further contains nucleotide sequence IV. Each nucleotide of nucleotide sequence III and nucleotide sequence IV is independently one of non-fluorinated modified nucleotides and is not the stabilizing modification. Nucleotide sequence III and nucleotide sequence IV are each 1-4 nucleotides in length, and nucleotide sequence IV and nucleotide sequence III are of equal length. Furthermore, nucleotide sequence IV and nucleotide sequence III are substantially anticomplementary or completely anticomplementary. Nucleotide sequence III is attached to the 5' end of nucleotide sequence I, and nucleotide sequence IV is attached to the 3' end of nucleotide sequence II. Additionally, nucleotide sequence IV is substantially anticomplementary or completely anticomplementary to a second nucleotide sequence, which refers to a nucleotide sequence in the APOC3 gene-expressed mRNA that is adjacent to the aforementioned first nucleotide sequence and has the same length as nucleotide sequence IV.

[0214] In some embodiments, nucleotide sequences III and IV are each 1 nucleotide in length, with nucleotide sequence III having a base of C and nucleotide sequence IV having a base of G; the second nucleotide sequence also has a base of C; in this case, the length ratio of the sense strand to the antisense strand is 20 / 20; or, nucleotide sequences III and IV are each 2 nucleotides in length, with nucleotide sequence III having a base composition of CC and nucleotide sequence IV having a base composition of GG; the second nucleotide sequence has a composition of CC; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21; or, Both nucleotide sequences III and IV are 3 nucleotides in length, with nucleotide sequence III having the base composition UCC and nucleotide IV having the base composition GGA; the second nucleotide sequence has the composition UCC; in this case, the length ratio of the sense strand to the antisense strand is 22 / 22; or, both nucleotide sequences III and IV are 4 nucleotides in length, with nucleotide sequence III having the base composition CUCC and nucleotide IV having the base composition GGAG; the second nucleotide sequence has the base composition CUCC; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21.

[0215] In some implementations, nucleotide sequence III and nucleotide sequence IV are completely anticomplementary; therefore, if the base composition of nucleotide sequence III is given, the base composition of nucleotide sequence IV is also determined.

[0216] The second type of siRNA

[0217] In some embodiments, the siRNA disclosed herein is a second type of siRNA. Specifically, nucleotide sequence I is equal in length to the nucleotide sequence shown in SEQ ID NO:45, and differs by no more than 3 nucleotides, and nucleotide sequence II is equal in length to the nucleotide sequence shown in SEQ ID NO:46, and differs by no more than 3 nucleotides.

[0218] 5'-UUAAAAGGGACAGUAUUCZ5-3' (SEQ ID NO: 45);

[0219] 5'-Z6GAAUACUGUCCCUUUUAA-3'(SEQ ID NO:46),

[0220] Where Z5 is U and Z6 is A;

[0221] Furthermore, nucleotide sequence I contains nucleotide Z7 at position Z5, and nucleotide sequence II contains nucleotide Z8 at position Z6, wherein Z8 is the first nucleotide at the 5' end of the antisense strand. The first nucleotide sequence is as shown in SEQ ID NO:45. Each U can be arbitrarily replaced by T.

[0222] In some embodiments, the sense strand contains only nucleotide sequence I, and the antisense strand contains only nucleotide sequence II.

[0223] In some embodiments, the nucleotide sequence I differs from the nucleotide sequence shown in SEQ ID NO:45 by no more than one nucleotide, and / or the nucleotide sequence II differs from the nucleotide sequence shown in SEQ ID NO:46 by no more than one nucleotide.

[0224] In some embodiments, the nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:46 includes a difference at the Z8 position, where Z8 is selected from U, G, or C. In some embodiments, the nucleotide difference is a difference at the Z8 position, where Z8 is selected from U, G, or C. In some embodiments, Z7 is a nucleotide complementary to Z8. These nucleotide differences do not significantly reduce the target gene repression ability of the siRNA or increase the off-target effects of the siRNA, and these siRNAs containing nucleotide differences are also within the scope of protection of this disclosure.

[0225] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are substantially anticomplementary, substantially anticomplementary, or completely anticomplementary; substantially anticomplementary means that there is no more than 3 base mismatches between the two nucleotide sequences; substantially anticomplementary means that there is no more than 1 base mismatch between the two nucleotide sequences; completely anticomplementary means that there is no mismatch between the two nucleotide sequences.

[0226] In some embodiments, nucleotides 2-19 of nucleotide sequence II are completely anticomplementary to nucleotides 1-18 of the first nucleotide sequence in the 5' to 3' direction. In some embodiments, nucleotide sequence II is completely anticomplementary to nucleotide sequence I, or there is a base mismatch between the second nucleotide of nucleotide sequence II and the second nucleotide of nucleotide sequence I in the 3' to 5' direction. By including this base mismatch, the target gene expression repression activity of the siRNA disclosed herein can be further enhanced while maintaining low off-target effects.

[0227] In some embodiments, nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:47, and nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:48.

[0228] 5'-UUAAAAGGGACAGUAUUCZ7-3' (SEQ ID NO: 47);

[0229] 5'-Z8GAAUACUGUCCCUUUUAA-3'(SEQ ID NO:48),

[0230] Z7 is selected from A, U, G or C, and Z8 is a complementary nucleotide to Z7; in some embodiments, Z7 is U and Z8 is A.

[0231] Furthermore, the sense and antisense strands may be the same or different in length, with the sense strand being 19-23 nucleotides long and the antisense strand being 19-26 nucleotides long. Thus, the length ratio of the sense and antisense strands of the siRNA provided in this disclosure can be 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 20, 20 / 21, or 20 / 22. The possible values ​​are: 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 20, 21 / 21, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 20, 23 / 21, 23 / 22, 23 / 23, 23 / 24, 23 / 25, or 23 / 26. In some embodiments, the length ratio of the siRNA's sense strand to its antisense strand is 19 / 21, 21 / 23, or 23 / 25.

[0232] In some embodiments, the sense strand further contains nucleotide sequence III, and the antisense strand further contains nucleotide sequence IV. Each nucleotide of nucleotide sequence III and nucleotide sequence IV is independently one of non-fluorinated modified nucleotides and is not the stabilizing modification. Nucleotide sequence III and nucleotide sequence IV are each 1-4 nucleotides in length, and nucleotide sequence IV and nucleotide sequence III are of equal length. Furthermore, nucleotide sequence IV and nucleotide sequence III are substantially anticomplementary or completely anticomplementary. Nucleotide sequence III is attached to the 5' end of nucleotide sequence I, and nucleotide sequence IV is attached to the 3' end of nucleotide sequence II. Additionally, nucleotide sequence IV is substantially anticomplementary or completely anticomplementary to a second nucleotide sequence, which refers to a nucleotide sequence in the APOC3 gene-expressed mRNA that is adjacent to the aforementioned first nucleotide sequence and has the same length as nucleotide sequence IV.

[0233] In some embodiments, nucleotide sequences III and IV are each 1 nucleotide in length, with nucleotide sequence III having a base of C and nucleotide sequence IV having a base of G; the second nucleotide sequence also has a base of C; in this case, the length ratio of the sense strand to the antisense strand is 20 / 20; or, nucleotide sequences III and IV are each 2 nucleotides in length, with nucleotide sequence III having a base composition of GC and nucleotide sequence IV having a base composition of GC; the second nucleotide sequence also has a composition of GC; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21; or, Both nucleotide sequences III and IV are 3 nucleotides in length, with nucleotide sequence III having the base composition UGC and nucleotide IV having the base composition GCA; the second nucleotide sequence has the composition GCA; in this case, the length ratio of the sense strand to the antisense strand is 22 / 22; or, both nucleotide sequences III and IV are 4 nucleotides in length, with nucleotide sequence III having the base composition UUGC and nucleotide IV having the base composition GCAA; the second nucleotide sequence has the base composition GCAA; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21.

[0234] In some implementations, nucleotide sequence III and nucleotide sequence IV are completely anticomplementary; therefore, if the base composition of nucleotide sequence III is given, the base composition of nucleotide sequence IV is also determined.

[0235] The third type of siRNA

[0236] In some embodiments, the siRNA disclosed herein is a second type of siRNA. Specifically, nucleotide sequence I is equal in length to the nucleotide sequence shown in SEQ ID NO:105, and differs by no more than 3 nucleotides, and nucleotide sequence II is equal in length to the nucleotide sequence shown in SEQ ID NO:106, and differs by no more than 3 nucleotides.

[0237] 5'-GGACAGUAUUCUCAGUGCZ9-3' (SEQ ID NO: 105);

[0238] 5'-Z 10 GCACUGAGAAUACUGUCC-3'(SEQ ID NO:106),

[0239] Where Z9 is U, Z 10 A;

[0240] Furthermore, nucleotide sequence I contains nucleotide Z at position Z9. 11 The nucleotide sequence II contains a position corresponding to Z. 10 nucleotide Z 12 The Z 12 It is the first nucleotide at the 5' end of the antisense strand. The first nucleotide sequence is the nucleotide sequence shown in SEQ ID NO:105. Each U can be arbitrarily replaced by a T.

[0241] In some embodiments, the sense strand contains only nucleotide sequence I, and the antisense strand contains only nucleotide sequence II.

[0242] In some embodiments, the nucleotide sequence I differs from the nucleotide sequence shown in SEQ ID NO:105 by no more than one nucleotide, and / or the nucleotide sequence II differs from the nucleotide sequence shown in SEQ ID NO:106 by no more than one nucleotide.

[0243] In some embodiments, the nucleotide differences between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:106 include Z. 12 The difference in position, and Z 12 Selected from G, C, or U. In some embodiments, the nucleotide difference is Z. 12 The difference in position, and Z 12 Selected from G, C, or U. In some embodiments, Z 11 Is with Z 12Complementary nucleotides. These nucleotide differences do not significantly reduce the target gene repression ability of siRNA or increase the off-target effect of siRNA, and these siRNAs containing nucleotide differences are also within the protection scope of this disclosure.

[0244] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are substantially anticomplementary, substantially anticomplementary, or completely anticomplementary; substantially anticomplementary means that there is no more than 3 base mismatches between the two nucleotide sequences; substantially anticomplementary means that there is no more than 1 base mismatch between the two nucleotide sequences; completely anticomplementary means that there is no mismatch between the two nucleotide sequences.

[0245] In some embodiments, nucleotides 2-19 of nucleotide sequence II are completely anticomplementary to nucleotides 1-18 of the first nucleotide sequence in the 5' to 3' direction. In some embodiments, nucleotide sequence II is completely anticomplementary to nucleotide sequence I, or there is a base mismatch between the second nucleotide of nucleotide sequence II and the second nucleotide of nucleotide sequence I in the 3' to 5' direction. By including this base mismatch, the target gene expression repression activity of the siRNA disclosed herein can be further enhanced while maintaining low off-target effects.

[0246] In some embodiments, nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:107, and nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:108.

[0247] 5'-GGACAGUAUUCUCAGUGCZ11-3' (SEQ ID NO: 107);

[0248] 5'-Z12GCACUGAGAAUACUGUCC-3'(SEQ ID NO:108),

[0249] Among them, Z 11 Selected from A, U, G, or C, Z 12 Is with Z 11 Complementary nucleotides; in some embodiments, Z 11 For U, Z 12 The answer is A.

[0250] Furthermore, the sense and antisense strands may be the same or different in length, with the sense strand being 19-23 nucleotides long and the antisense strand being 19-26 nucleotides long. Thus, the length ratio of the sense and antisense strands of the siRNA provided in this disclosure can be 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 20, 20 / 21, or 20 / 22. The possible values ​​are: 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 20, 21 / 21, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 20, 23 / 21, 23 / 22, 23 / 23, 23 / 24, 23 / 25, or 23 / 26. In some embodiments, the length ratio of the siRNA's sense strand to its antisense strand is 19 / 21, 21 / 23, or 23 / 25.

[0251] In some embodiments, the sense strand further contains nucleotide sequence III, and the antisense strand further contains nucleotide sequence IV. Each nucleotide of nucleotide sequence III and nucleotide sequence IV is independently one of non-fluorinated modified nucleotides and is not the stabilizing modification. Nucleotide sequence III and nucleotide sequence IV are each 1-4 nucleotides in length, and nucleotide sequence IV and nucleotide sequence III are of equal length. Furthermore, nucleotide sequence IV and nucleotide sequence III are substantially anticomplementary or completely anticomplementary. Nucleotide sequence III is attached to the 5' end of nucleotide sequence I, and nucleotide sequence IV is attached to the 3' end of nucleotide sequence II. Additionally, nucleotide sequence IV is substantially anticomplementary or completely anticomplementary to a second nucleotide sequence, which refers to a nucleotide sequence in the APOC3 gene-expressed mRNA that is adjacent to the aforementioned first nucleotide sequence and has the same length as nucleotide sequence IV.

[0252] In some embodiments, nucleotide sequences III and IV are each 1 nucleotide in length, with nucleotide sequence III having a base of C and nucleotide sequence IV having a base of G; the second nucleotide sequence has a base of C; in this case, the length ratio of the sense strand to the antisense strand is 20 / 20; or, nucleotide sequences III and IV are each 2 nucleotides in length, with nucleotide sequence III having a base composition of AG and nucleotide sequence IV having a base composition of CU; the second nucleotide sequence has a composition of AG; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21; or, Both nucleotide sequences III and IV are 3 nucleotides in length, with nucleotide sequence III having the base composition AAG and nucleotide IV having the base composition CUU; the second nucleotide sequence has the composition AAG; in this case, the length ratio of the sense strand to the antisense strand is 22 / 22; or, both nucleotide sequences III and IV are 4 nucleotides in length, with nucleotide sequence III having the base composition AAAG and nucleotide IV having the base composition CUUU; the second nucleotide sequence has the base composition AAAG; in this case, the length ratio of the sense strand to the antisense strand is 21 / 21.

[0253] In some implementations, nucleotide sequence III and nucleotide sequence IV are completely inversely complementary; therefore, given the bases of nucleotide sequence III, the bases of nucleotide sequence IV are determined.

[0254] The following descriptions of nucleotide sequence V, nucleotide modifications in siRNA, and modified sequences apply to the siRNAs disclosed herein, such as the first, second, or third siRNA. That is, unless otherwise specified, the following descriptions of siRNA should be considered as descriptions of each of the siRNAs disclosed herein, such as the first, second, and third siRNAs. For example, unless a specific siRNA is specifically specified, "the siRNA further contains nucleotide sequence V" means "the siRNA of this disclosure, such as the first, second, or third siRNA described above, further contains nucleotide sequence V."

[0255] In some embodiments, the sense and antisense strands have different lengths. The antisense strand further contains a nucleotide sequence V, where each nucleotide of the nucleotide sequence V is independently one of the non-fluorinated modified nucleotides and is not the stabilizing modified nucleotide. The length of the nucleotide sequence V is 1 to 3 nucleotides, attached to the 3' end of the antisense strand to form the 3' overhang of the antisense strand. Therefore, the length ratio of the sense and antisense strands of the siRNA provided in this disclosure can be 19 / 20, 19 / 21, 19 / 22, 20 / 21, 20 / 22, 20 / 23, 21 / 22, 21 / 23, 21 / 24, 22 / 23, 22 / 24, 22 / 25, 23 / 24, 23 / 25, or 23 / 26. In some embodiments, the length of the nucleotide sequence V is 2 nucleotides, thus, the length ratio of the sense and antisense strands of the siRNA provided in this disclosure can be 19 / 21, 21 / 23, or 23 / 25.

[0256] Each nucleotide in the nucleotide sequence V can be any nucleotide. For ease of synthesis and cost savings, the nucleotide sequence V is two consecutive thymine deoxyribonucleotides (dTdT) and two consecutive uracil ribonucleotides (UU). Alternatively, to improve the affinity of the siRNA antisense strand to the target mRNA, the nucleotide sequence V is completely anticomplementary to the third nucleotide sequence. The third nucleotide sequence refers to the nucleotide sequence in the APOC3 gene-expressed mRNA that is adjacent to the first or second nucleotide sequence and has the same length as the nucleotide sequence V. Therefore, in some embodiments, the ratio of the length of the sense strand to the antisense strand of the siRNA disclosed herein is 19 / 21 or 21 / 23. In this case, the siRNA disclosed herein has better mRNA silencing activity.

[0257] In some embodiments, for the first siRNA, the first nucleotide sequence has the nucleotide sequence shown in SEQ ID NO:1, and the base composition of the third nucleotide sequence is C / C; the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:5, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:6.

[0258] 5'-CAAUAAAGCUGGACAAGAZ3-3' (SEQ ID NO: 5);

[0259] 5'-Z4UCUUGUCCAGCUUUAUUGGG-3'(SEQ ID NO:6),

[0260] Alternatively, the sense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:7, and the antisense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:8.

[0261] 5'-CCCAAUAAAGCUGGACAAGAZ3-3' (SEQ ID NO:7);

[0262] 5'-Z4UCUUGUCCAGCUUUAUUGGGAG-3'(SEQ ID NO:8),

[0263] Wherein, Z4 is the first nucleotide at the 5' end of the antisense strand, Z3 is selected from A, U, G or C, and Z4 is a nucleotide complementary to Z3.

[0264] In some embodiments, the sense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:9, and the antisense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:10.

[0265] 5'-CAAUAAAGCUGGACAAGAA-3' (SEQ ID NO:9);

[0266] 5'-UUCUUGUCCAGCUUUAUUGGG-3'(SEQ ID NO:10),

[0267] Alternatively, the sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:11, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:12.

[0268] 5'-CCCAAUAAAGCUGGACAAGAA-3' (SEQ ID NO: 11);

[0269] 5'-UUCUUGUCCAGCUUUAUUGGGAG-3' (SEQ ID NO: 12).

[0270] In some embodiments, for the second siRNA, the first nucleotide sequence has the nucleotide sequence shown in SEQ ID NO:45, and the base composition of the third nucleotide sequence is GC. The sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:49, and the antisense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:50.

[0271] 5'-UUAAAAGGGACAGUAUUCZ7-3' (SEQ ID NO: 49);

[0272] 5'-Z8GAAUACUGUCCCUUUUAAGC-3'(SEQ ID NO:50),

[0273] Alternatively, the sense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:51, and the antisense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:52.

[0274] 5'-GCUUAAAAGGGACAGUAUUCZ7-3' (SEQ ID NO: 51);

[0275] 5'-Z8GAAUACUGUCCCUUUUAAGCAA-3'(SEQ ID NO:52),

[0276] Alternatively, the sense strand of the siRNA may contain a nucleotide sequence as shown in SEQ ID NO:49, and the antisense strand may contain a nucleotide sequence as shown in SEQ ID NO:149.

[0277] 5'-UUAAAAGGGACAGUAUUCZ7-3' (SEQ ID NO: 49);

[0278] 5'-Z8GAAUACUGUCCCUUUUAAUU-3'(SEQ ID NO:149),

[0279] Alternatively, the sense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:51, and the antisense strand contains a nucleotide sequence as shown in SEQ ID NO:150.

[0280] 5'-GCUUAAAAGGGACAGUAUUCZ7-3' (SEQ ID NO: 51);

[0281] 5'-Z8GAAUACUGUCCCUUUUAAGCUU-3'(SEQ ID NO:150),

[0282] Wherein, Z8 is the first nucleotide at the 5' end of the antisense strand, Z7 is selected from A, U, G or C, and Z8 is a nucleotide complementary to Z7.

[0283] In some embodiments, the sense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:53, and the antisense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:54.

[0284] 5'-UUAAAAGGGACAGUAUUCU-3' (SEQ ID NO: 53);

[0285] 5'-AGAAUACUGUCCCUUUUAAGC-3'(SEQ ID NO:54),

[0286] Alternatively, the sense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:55, and the antisense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:56.

[0287] 5'-GCUUAAAAGGGACAGUAUUCU-3' (SEQ ID NO: 55);

[0288] 5'-AGAAUACUGUCCCUUUUAAGCAA-3' (SEQ ID NO: 56).

[0289] In some embodiments, for the third siRNA, the first nucleotide sequence has the nucleotide sequence shown in SEQ ID NO:105, and the base composition of the third nucleotide sequence is AG. The sense strand of the siRNA contains the nucleotide sequence shown in SEQ ID NO:109, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO:110.

[0290] 5'-GGACAGUAUUCUCAGUGCZ 11 -3'(SEQ ID NO:109);

[0291] 5'-Z 12 GCACUGAGAAUACUGUCCCU-3'(SEQ ID NO:110),

[0292] Alternatively, the sense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:111, and the antisense strand contains a nucleotide sequence as shown in SEQ ID NO:112.

[0293] 5'-AGGGACAGUAUUCUCAGUGCZ 11 -3'(SEQ ID NO:111);

[0294] 5'-Z 12 GCACUGAGAAUACUGUCCCUUU-3'(SEQ ID NO:112),

[0295] Wherein, the Z 12 It is the first nucleotide at the 5' end of the antisense strand, Z11 Choose from A, U, G, or C, and Z 12 Is with Z 11 Complementary nucleotides.

[0296] In some embodiments, the sense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:113, and the antisense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:114.

[0297] 5'-GGACAGUAUUCUCAGUGCU-3' (SEQ ID NO: 113);

[0298] 5'-AGCACUGAGAAUACUGUCCCU-3'(SEQ ID NO:114),

[0299] Alternatively, the sense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:115, and the antisense strand of the siRNA contains a nucleotide sequence as shown in SEQ ID NO:116.

[0300] 5'-AGGGACAGUAUUCUCAGUGCU-3' (SEQ ID NO: 115);

[0301] 5'-AGCACUGAGAAUACUGUCCCUUU-3' (SEQ ID NO: 116).

[0302] As previously stated, the nucleotides in the siRNA disclosed herein are each independently modified or unmodified nucleotides. In some embodiments, some or all of the nucleotides in the siRNA disclosed herein are modified nucleotides. These modifications on the nucleotide groups do not cause the siRNA disclosed herein to significantly weaken or lose its function of inhibiting APOC3 gene expression.

[0303] In the context of this disclosure, the term "modified nucleotide" as used refers to a nucleotide or nucleotide analog formed by replacing the 2' hydroxyl group of the ribosyl group with another group, or a nucleotide in which the bases of the nucleotide are modified. The modified nucleotide does not result in a significant reduction or loss of the siRNA's ability to repress gene expression. For example, the modified nucleotides disclosed in JK Watts, G.F. Deleavey, and MJ Damha, Chemically Modified siRNA: Tools and Applications. Drug Discov Today, 2008, 13(19-20):842-55, may be selected.

[0304] In some embodiments, nucleotides 2, 6, 14, and 16 of nucleotide sequence II, if not the stabilizing modified nucleotide, are 2'-fluorinated modified nucleotides in the 5'-to-3' direction. In some embodiments, all nucleotides in nucleotide sequence II are modified nucleotides; nucleotides 2, 6, 14, and 16 of nucleotide sequence II, if not the stabilizing modified nucleotide, are 2'-fluorinated modified nucleotides in the 5'-to-3' direction, and the other nucleotides in nucleotide sequence II are each independently a type of non-fluorinated modified nucleotide. In some embodiments, nucleotides 7-9 of nucleotide sequence I, in the 5'-to-3' direction, are 2'-fluorinated modified nucleotides. In some embodiments, all nucleotides in nucleotide sequence I are modified nucleotides; nucleotides 7-9 of nucleotide sequence I, in the 5'-to-3' direction, are 2'-fluorinated modified nucleotides, and the other nucleotides in nucleotide sequence I are each independently a type of non-fluorinated modified nucleotide. The siRNA disclosed herein, through the above modifications, can achieve a good balance between gene expression regulatory activity and in vivo stability.

[0305] In the context of this disclosure, a "fluorinated nucleotide" refers to a nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosyl group with fluorine, having the structure shown in formula (7). A "non-fluorinated nucleotide" refers to a nucleotide or nucleotide analog formed by replacing the hydroxyl group at the 2' position of the ribosyl group with a non-fluorinated group. In some embodiments, each non-fluorinated nucleotide is independently selected from one of the nucleotides or nucleotide analogs formed by replacing the hydroxyl group at the 2' position of the ribosyl group with a non-fluorinated group.

[0306] The nucleotides formed by replacing the hydroxyl group at the 2' position of the ribosyl group with a non-fluorinated group are well known to those skilled in the art, and these nucleotides may be selected from one of the following: 2'-alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, and 2'-deoxynucleotides.

[0307] In some embodiments, the 2'-alkoxy-modified nucleotide is a methoxy-modified nucleotide (2'-OMe), as shown in formula (8). In some embodiments, the 2'-amino-modified nucleotide (2'-NH2) is shown in formula (9). In some embodiments, the 2'-deoxynucleotide (DNA) is shown in formula (10).

[0308] Nucleotide analogs are groups that can replace nucleotides in nucleic acids, but whose structure differs from that of adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides, or thymine deoxyribonucleotides. In some embodiments, nucleotide analogs can be isonucleotides, bridged nucleic acids (BNAs), or acyclic nucleotides.

[0309] BNA refers to a restricted or inaccessible nucleotide. BNA can contain a bridging structure with a "fixed" C3'-endoglucan condensation, consisting of a five-membered, six-membered, or seven-membered ring. This bridge is typically incorporated into the 2'-, 4'-position of the ribose to provide a 2',4'-BNA nucleotide. In some embodiments, BNA can be LNA, ENA, cET BNA, etc., where LNA is shown in formula (12), ENA in formula (13), and cET BNA in formula (14).

[0310]

[0311] Acyclic nucleotides are a class of nucleotides formed by opening the sugar ring of a nucleotide. In some embodiments, acyclic nucleotides can be unblocking nucleic acids (UNA) or glycerol nucleic acids (GNA), wherein UNA is shown in formula (15) and GNA is shown in formula (16):

[0312]

[0313] In formulas (15) and (16) above, R is selected from H, OH or alkoxy (O-alkyl).

[0314] Isonucleotides are compounds formed by altering the position of a base on the ribose ring in a nucleotide. In some embodiments, an isonucleotide can be a compound formed by moving a base from the 1'-position to the 2'-position or 3'-position on the ribose ring, as shown in formula (17) or (18).

[0315]

[0316] In the compounds of formulas (17)-(18) above, Base represents a nucleic acid base, such as A, U, G, C or T; R is selected from H, OH, F or non-fluorine groups as described above.

[0317] In some embodiments, the nucleotide analogue is selected from one of the following: isonucleotides, LNA, ENA, cET, UNA, and GNA. In some embodiments, each non-fluorinated nucleotide is a methoxylated nucleotide, and in the preceding and following text, the methoxylated nucleotide refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribosome with a methoxy group.

[0318] In the preceding and following text, “fluorinated nucleotides,” “2’-fluorinated nucleotides,” “nucleotides in which the 2’-hydroxyl group of the ribose group is replaced by fluorine,” and “nucleotides with a 2’-fluorinated ribose group” have the same meaning, all referring to compounds in which the 2’-hydroxyl group of the nucleotide is replaced by fluorine, resulting in compounds with the structure shown in formula (7); “methoxylated nucleotides,” “2’-methoxylated nucleotides,” “nucleotides in which the 2’-hydroxyl group of the ribose group is replaced by methoxyl,” and “nucleotides with a 2’-methoxy ribose group” have the same meaning, all referring to compounds in which the 2’-hydroxyl group of the ribose group of the nucleotide is replaced by methoxyl, resulting in compounds with the structure shown in formula (8).

[0319] In some embodiments, the siRNA containing stabilizing modified nucleotides disclosed herein is an siRNA having the following modifications: in the positive strand, the nucleotides at positions 7, 8, 9 or 5, 7, 8, 9 of nucleotide sequence I are fluorinated nucleotides, and the nucleotides at the remaining positions in the positive strand are methoxylated nucleotides; in the negative strand, the nucleotides at positions 2, 6, 14, 16 or 2, 6, 8, 9, 14, 16 of nucleotide sequence II are fluorinated nucleotides, the nucleotide at position 3 or 5 of the negative strand is a stabilizing modified nucleotide, and the nucleotides at the remaining positions in the negative strand are methoxylated nucleotides.

[0320] The modified siRNAs are not only low-cost, but also make it more difficult for ribonucleases in the blood to cleave nucleic acids, thereby increasing the stability of nucleic acids and making them more resistant to nuclease hydrolysis. At the same time, these modifications reduce the off-target effects of siRNAs without significantly reducing their inhibitory performance.

[0321] In some embodiments, the siRNA provided in this disclosure is one of siAPOC3a1-M1, siAPOC3a1-M2, siAPOC3a2-M1, siAPOC3a2-M2, siAPOC3b1-M1, siAPOC3b1-M2, siAPOC3b2-M1, siAPOC3b2-M2, siAPOC3b3-M1, siAPOC3b3-M2, siAPOC3b4-M1, siAPOC3b4-M2, siAPOC3c1-M1, siAPOC3c1-M2, siAPOC3c2-M1, and siAPOC3c2-M2.

[0322] In some embodiments, at least a portion of the phosphate ester groups in the phosphate-sugar backbone of at least one single strand of the sense and antisense strands of the siRNA provided in this disclosure are phosphate ester groups with modifying groups. In some embodiments, the phosphate ester group with modifying groups is a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphodiester bond of the phosphate ester group with a sulfur atom; in some embodiments, the phosphate ester group with modifying groups is a thiophosphate ester group having the structure shown in formula (1):

[0323]

[0324] This modification stabilizes the double-stranded structure of siRNA, maintaining high specificity and high affinity for base pairing.

[0325] In some embodiments, the siRNA provided in this disclosure has a thiophosphate group linker present at least one of the following positions: between the first and second nucleotides at either end of the sense or antisense strand; between the second and third nucleotides at either end of the sense or antisense strand; or any combination thereof. In some embodiments, the thiophosphate group linker is present at all of the above positions except for the 5' end of the sense strand. In some embodiments, the thiophosphate group linker is present at all of the above positions except for the 3' end of the sense strand. In some embodiments, the thiophosphate group linker is present at at least one of the following positions:

[0326] Between the first and second nucleotides at the 5' end of the positive strand;

[0327] Between the second and third nucleotides at the 5' end of the positive strand;

[0328] Between the first and second nucleotides at the 3' end of the positive strand;

[0329] Between the second and third nucleotides at the 3' end of the positive strand;

[0330] Between the first and second nucleotides at the 5' end of the antisense strand;

[0331] Between the second and third nucleotides at the 5' end of the antisense strand;

[0332] Between the first and second nucleotides at the 3' end of the antisense strand; and

[0333] Between the second and third nucleotides at the 3' end of the antisense strand.

[0334] In some embodiments, the siRNA provided in this disclosure is one of the siAPOC3a1-M1S, siAPOC3a1-M2S, siAPOC3a2-M1S, siAPOC3a2-M2S, siAPOC3b1-M1S, siAPOC3b1-M2S, siAPOC3b2-M1S, siAPOC3b2-M2S, siAPOC3b3-M1S, siAPOC3b3-M2S, siAPOC3b4-M1S, siAPOC3b4-M2S, siAPOC3c1-M1S, siAPOC3c1-M2S, siAPOC3c2-M1S, and siAPOC3c2-M2S listed in Tables 1a-1c.

[0335] In some embodiments, the 5' terminal nucleotide of the siRNA antisense strand is a 5'-phosphate nucleotide or a nucleotide modified with a 5'-phosphate analogue.

[0336] Commonly used 5'-phosphate nucleotides or 5'-phosphate analogues modified nucleotides are well known to those skilled in the art. For example, 5'-phosphate nucleotides may have the following structures:

[0337]

[0338] For example, Anastasia Khvorova and Jonathan K. Watts, The chemical evolution of oligonucleotide therapies of clinical utility. Nature Biotechnology, 2017, 35(3):238-48, discloses the following four 5'-phosphate analog-modified nucleotides:

[0339]

[0340] In this context, R is selected from H, OH, methoxy, and fluorine; Base represents a nucleic acid base, selected from A, U, C, G, or T.

[0341] In some embodiments, the 5'-phosphate nucleotide is a nucleotide containing 5'-phosphate modification as shown in formula (2), the 5'-phosphate analog modified nucleotide is a nucleotide containing vinyl phosphate (5'-(E)-vinylphosphonate, E-VP) modification as shown in formula (3), or a nucleotide modified with thiophosphate as shown in formula (5).

[0342] In some embodiments, the siRNA of this disclosure is one of the following listed in Tables 1a-1c: siAPOC3a1-M1P1, siAPOC3a1-M2P1, siAPOC3a2-M1P1, siAPOC3a2-M2P1, siAPOC3a1-M1SP1, siAPOC3a1-M2SP1, siAPOC3a2-M1SP1, siAPOC3a2-M2SP1, siAPOC3b1-M1P1, siAPOC3b1-M2P1, siAPOC3b2-M1P1, siAPOC3b2-M2P1, siAPOC3b1-M1SP1, siAPOC3b1-M2SP1, siAPOC3b2-M1SP1, siAPOC3b2-M1SP1, siAPOC3b1-M1SP1, siAPOC3b1-M2SP1, siAPOC3b2-M1SP1, siAPOC3b2-M1SP1, siAPOC3b1-M1SP1, siAPOC3b1-M2SP1, siAPOC3b2-M1SP1, siAPOC3b1 ... One of APOC3b2-M2SP1, siAPOC3b3-M1P1, siAPOC3b3-M2P1, siAPOC3b4-M1P1, siAPOC3b4-M2P1, siAPOC3b3-M1SP1, siAPOC3b3-M2SP1, siAPOC3b4-M1SP1, siAPOC3b4-M2SP1, siAPOC3c1-M1P1, siAPOC3c1-M2P1, siAPOC3c2-M1P1, siAPOC3c2-M2P1, siAPOC3c1-M1SP1, siAPOC3c1-M2SP1, siAPOC3c2-M1SP1, and siAPOC3c2-M2SP1.

[0343] The inventors of this disclosure unexpectedly discovered that the siRNA provided in this disclosure not only has significantly enhanced plasma and lysosomal stability and significantly low off-target effects, but also retains high gene repressive activity.

[0344] The siRNA provided in this disclosure can be obtained using conventional siRNA preparation methods in the art (e.g., solid-phase synthesis and liquid-phase synthesis). Solid-phase synthesis is already available as a commercially available custom service. Modified nucleotide groups can be introduced into the siRNA described in this disclosure using appropriately modified nucleoside monomers. Methods for preparing appropriately modified nucleoside monomers and for introducing modified nucleotide groups into siRNA are also well known to those skilled in the art.

[0345] Pharmaceutical Composition

[0346] This disclosure provides a pharmaceutical composition comprising siRNA as an active ingredient and a pharmaceutically acceptable carrier as described above.

[0347] The pharmaceutically acceptable carrier can be a carrier conventionally used in the field of siRNA delivery, such as, but not limited to, magnetic nanoparticles (e.g., Fe3O4 or Fe2O3-based nanoparticles), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), and poly(2-aminoethylethylene) phosphate. One or more of the following: phosphate), PPEEA, and poly(2-dimethylaminoethylmethacrylate), PDMAEMA, and their derivatives.

[0348] In some embodiments, there are no particular requirements for the content of siRNA and pharmaceutically acceptable carrier in the pharmaceutical composition. In some embodiments, the weight ratio of siRNA to pharmaceutically acceptable carrier can be 1:(1-500), and in some embodiments, the weight ratio is 1:(1-50).

[0349] In some embodiments, the pharmaceutical composition may also contain other pharmaceutically acceptable excipients, which may be one or more of a variety of formulations or compounds conventionally used in the art. For example, the other pharmaceutically acceptable excipients may include at least one of pH buffers, protectants, and osmotic pressure regulators.

[0350] The pH buffer solution can be a tris(hydroxymethyl)aminomethane hydrochloride buffer with a pH of 7.5-8.5 and / or a phosphate buffer with a pH of 5.5-8.5, for example, a phosphate buffer with a pH of 5.5-8.5.

[0351] The protective agent may be at least one selected from inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose. Based on the total weight of the pharmaceutical composition, the content of the protective agent may be 0.01-30% by weight.

[0352] The osmotic pressure regulator may be sodium chloride and / or potassium chloride. The content of the osmotic pressure regulator results in an osmotic pressure of 200-700 milliosm / kg (mOsm / kg) for the pharmaceutical composition. The content of the osmotic pressure regulator can be readily determined by those skilled in the art based on the desired osmotic pressure. In some embodiments, the dosage of the formulation made from the pharmaceutical composition may be adjusted during administration depending on the route of administration.

[0353] In some embodiments, the pharmaceutical composition may be a liquid formulation, such as an injection; or it may be a lyophilized powder for injection, which is mixed with liquid excipients to form a liquid formulation for administration. The liquid formulation may be used, but is not limited to, for subcutaneous, intramuscular, or intravenous administration, or may be delivered via, but is not limited to, aerosol administration to the lungs, aerosol administration to other organs (such as the liver), or oral inhalation, or nasal administration. In some embodiments, the pharmaceutical composition is used for aerosol administration.

[0354] In some embodiments, the pharmaceutical composition may be in the form of a liposomal formulation. In some embodiments, the pharmaceutically acceptable carrier used in the liposomal formulation comprises an amine-containing transfection compound (hereinafter also referred to as an organic amine), a cofactor lipid, and / or a polyethylene glycol-modified lipid. The organic amine, cofactor lipid, and polyethylene glycol-modified lipid may be selected from one or more of the amine-containing transfection compounds or their pharmaceutically acceptable salts or derivatives, cofactor lipids, and polyethylene glycol-modified lipids described in Chinese patent application CN103380113A (which is incorporated herein by reference in its entirety).

[0355] In some embodiments, the organic amine may be a compound of formula (201) as described in Chinese patent application CN103380113A, or a pharmaceutically acceptable salt thereof:

[0356]

[0357] in:

[0358] X 101 and X 102 Each can be independently O, S, NA, or CA, where A is hydrogen or C1-C. 20 hydrocarbon chain;

[0359] Y 101 and Z 101Each can be independently C=O, C=S, S=O, CH-OH, or SO2;

[0360] R 101 R 102 R 103 R 104 R 105 R 106 and R 107 Each is independently hydrogen, cyclic or acyclic, substituted or unsubstituted, branched or straight aliphatic group, cyclic or acyclic, substituted or unsubstituted, branched or straight heteroaliphatic group, substituted or unsubstituted, branched or straight acyl group, substituted or unsubstituted, branched or straight aryl group, substituted or unsubstituted, branched or straight heteroaryl group;

[0361] x is an integer from 1 to 10;

[0362] n is an integer from 1 to 3, m is an integer from 0 to 20, and p is 0 or 1; where, if m = p = 0, then R 102 It is hydrogen;

[0363] Furthermore, if at least one of n or m is 2, then R 103 The nitrogen in formula (201) forms a structure as shown in formula (202) or formula (203):

[0364]

[0365] In this context, g, e, and f are each an integer from 1 to 6, "HCC" represents a hydrocarbon chain, and each *N represents a nitrogen atom in formula (201).

[0366] In some implementations, R 103 It is a polyamine. In other embodiments, R 103 It is a ketal. In some embodiments, R in formula (201) 101 and R 102 Each of them is independently an arbitrary substituted or unsubstituted, branched or straight-chain alkyl or alkenyl group having 3 to 20 carbon atoms, such as 8 to 18 carbon atoms, and 0 to 4 double bonds, such as 0 to 2 double bonds.

[0367] In some implementations, if each of n and m independently has a value of 1 or 3, then R 103 It can be any one of the following equations (204)-(213):

[0368]

[0369]

[0370] In equations (204)-(213), g, e, and f are each independent integers from 1 to 6, each "HCC" represents a hydrocarbon chain, and each * indicates R. 103 Possible connection points with nitrogen atoms in equation (201), wherein each H at any * position can be replaced to achieve connection with nitrogen atoms in equation (201).

[0371] The compound shown in formula (201) can be prepared according to the description in Chinese patent application CN103380113A.

[0372] In some embodiments, the organic amine is an organic amine as shown in formula (214) and / or an organic amine as shown in formula (215):

[0373]

[0374] The auxiliary lipid is cholesterol, cholesterol analogues and / or cholesterol derivatives;

[0375] The PEGylated lipid is 1,2-dipalmitamide-sn-glycerol-3-phosphatidylethanolamine-N-[methoxy(polyethylene glycol)]-2000.

[0376] In some embodiments, the molar ratio of the organic amine, the auxiliary lipid, and the polyethylene glycol-modified lipid in the pharmaceutical composition is (19.7-80):(19.7-80):(0.3-50), for example, (50-70):(20-40):(3-20).

[0377] In some embodiments, the pharmaceutical composition particles formed from the siRNA of this disclosure and the above-mentioned amine-containing transfection reagent have an average diameter of about 30 nm to about 200 nm, typically about 40 nm to about 135 nm, and more typically, the average diameter of the liposome particles is about 50 nm to about 120 nm, about 50 nm to about 100 nm, about 60 nm to about 90 nm, or about 70 nm to about 90 nm. For example, the average diameter of the liposome particles is about 30, 40, 50, 60, 70, 75, 80, 85, 90, 100, 110, 120, 130, 140, 150, or 160 nm.

[0378] In some embodiments, in the pharmaceutical composition formed from the siRNA of this disclosure and the above-mentioned amine-containing transfection reagent, the weight ratio (weight / weight ratio) of siRNA to all lipids (e.g., organic amines, auxiliary lipids and / or polyethylene glycol-modified lipids) is in the range of about 1:1 to about 1:50, about 1:1 to about 1:30, about 1:3 to about 1:20, about 1:4 to about 1:18, about 1:5 to about 1:17, about 1:5 to about 1:15, about 1:5 to about 1:12, about 1:6 to about 1:12 or about 1:6 to about 1:10. For example, the weight ratio of siRNA to all lipids of this disclosure is about 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17 or 1:18.

[0379] In some embodiments, the components of the pharmaceutical composition may exist independently when sold, and may be in liquid form when used. In some embodiments, the pharmaceutical composition formed by the siRNA provided in this disclosure and the pharmaceutically acceptable carrier described above can be prepared according to various known methods, simply by replacing existing siRNAs with the siRNA provided in this disclosure; in some embodiments, it can be prepared according to the following method:

[0380] An organic amine, auxiliary lipid, and polyethylene glycol-modified lipid are suspended in an alcohol at the above molar ratio and mixed to obtain a lipid solution. The amount of alcohol used is such that the total mass concentration of the resulting lipid solution is 2-25 mg / mL, for example, 8-18 mg / mL. The alcohol is selected from pharmaceutically acceptable alcohols, such as alcohols that are liquid near room temperature, for example, one or more of ethanol, propylene glycol, benzyl alcohol, glycerol, polyethylene glycol 200, polyethylene glycol 300, and polyethylene glycol 400, for example, ethanol.

[0381] The siRNA provided in this disclosure is dissolved in a buffer salt solution to obtain an aqueous siRNA solution. The concentration of the buffer salt solution is 0.05-0.5M, for example, 0.1-0.2M. The pH of the buffer salt solution is adjusted to 4.0-5.5, for example, 5.0-5.2. The amount of buffer salt solution used is such that the concentration of siRNA does not exceed 0.6 mg / mL, for example, 0.2-0.4 mg / mL. The buffer salt is selected from one or more of soluble acetate and soluble citrate, for example, sodium acetate and / or potassium acetate.

[0382] The lipid solution and siRNA aqueous solution are mixed, and the resulting product is incubated at 40-60°C for at least 2 minutes, for example, 5-30 minutes, to obtain the incubated liposome formulation. The volume ratio of lipid solution to siRNA aqueous solution is 1:(2-5), for example, 1:4.

[0383] The incubated liposome formulation is concentrated or diluted, impurities are removed, and sterilization is performed to obtain the pharmaceutical composition provided in this disclosure. Its physicochemical parameters are: pH value of 6.5-8, encapsulation efficiency of not less than 80%, particle size of 40-200 nm, polydispersity index of not more than 0.30, and osmotic pressure of 250-400 mOsm / kg; for example, the physicochemical parameters can be: pH value of 7.2-7.6, encapsulation efficiency of not less than 90%, particle size of 60-100 nm, polydispersity index of not more than 0.20, and osmotic pressure of 300-400 mOsm / kg.

[0384] Concentration or dilution can be performed before, after, or simultaneously with impurity removal. Impurity removal can be achieved using various existing methods, such as ultrafiltration at 100 kDa using a tangential flow system, hollow fiber column, and phosphate-buffered saline (PBS) at pH 7.4. Sterilization can be achieved using various existing methods, such as filtration sterilization through a 0.22 μm filter.

[0385] siRNA conjugates

[0386] This disclosure provides an siRNA conjugate containing the siRNA provided herein, and a conjugating group conjugated to the siRNA. In some embodiments, the conjugating group comprises a linker and a pharmaceutically acceptable targeting group and / or a delivery aid group, and the siRNA, the linker, and the targeting group or the delivery aid group are sequentially covalently or non-covalently linked, each targeting group being selected from ligands capable of binding to cell surface receptors, and each delivery aid group being selected from groups capable of increasing the biocompatibility of the siRNA conjugate in the target organ or tissue.

[0387] In the context of this disclosure, unless otherwise stated, "conjugation" refers to the covalent connection between two or more chemical parts, each having a specific function; correspondingly, "conjugation" refers to a compound formed by the covalent connection of these chemical parts. Further, "siRNA conjugate" refers to a compound formed by the covalent attachment of one or more chemical parts having a specific function to siRNA. siRNA conjugates should be understood, depending on the context, as a collective term for multiple siRNA conjugates or a siRNA conjugate represented by a specific chemical formula. In the context of this disclosure, "conjugated molecule" should be understood as a specific compound that can be reactively conjugated to siRNA to ultimately form the siRNA conjugates of this disclosure.

[0388] Generally, the conjugation group comprises at least one pharmaceutically acceptable target group and an optional linker, and the siRNA, the linker, and the target group are sequentially linked. In some embodiments, there are 1-6 target groups. In some embodiments, there are 2-4 target groups. The siRNA molecule can be non-covalently or covalently conjugated to the conjugation group, for example, it can be covalently conjugated to the conjugation group. The conjugation site of the siRNA and the conjugation group can be at the 3' or 5' end of the siRNA's sense strand, at the 5' end of the antisense strand, or within the siRNA's internal sequence. In some embodiments, the conjugation site of the siRNA and the conjugation group is at the 3' end of the siRNA's sense strand.

[0389] In some embodiments, the conjugate group may be attached to a phosphate group, a 2'-hydroxyl group, or a base of a nucleotide. In some embodiments, the conjugate group may also be attached to a 3'-hydroxyl group, in which case the nucleotides are linked by a 2'-5' phosphodiester bond. When the conjugate group is attached to the end of the siRNA chain, it is usually attached to a phosphate group of the nucleotide; when the conjugate group is attached to the inner sequence of the siRNA, it is usually attached to a ribose ring or a base. Various connection methods can be found in the reference: Muthiah Manoharan et al. siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivoinhepatocytes. ACS Chemicalbiology, 2015, 10(5): 1181-7.

[0390] The targeting group can be linked to the siRNA molecule via a suitable adapter. Those skilled in the art can select an appropriate adapter based on the specific type of the targeting group. For details on these adapters, types of targeting groups, and methods of linking them to siRNA, please refer to the disclosure of WO2015006740A2, the entire contents of which are incorporated herein by reference.

[0391] In some embodiments, the targeting group may be a ligand commonly used in the field of siRNA drug delivery, such as the various ligands described in WO2009082607A2, the entire disclosure of which is incorporated herein by reference.

[0392] In some embodiments, at least one or each of the target groups is selected from ligands capable of binding to cell surface receptors expressing the APOC3 gene.

[0393] In some embodiments, at least one or each of the target groups is selected from ligands capable of binding to mammalian hepatocyte surface receptors (ASGPRs). In some embodiments, each of the target groups is independently a ligand with affinity for desialylate glycoprotein receptors on the surface of mammalian hepatocytes. In some embodiments, each of the target groups is independently a desialylate glycoprotein or a sugar. In some embodiments, each of the target groups is independently a desialylate glycoprotein, such as asialostromococcusoid (ASOR) or asialofetuin (ASF). In some embodiments, each of the target groups is independently selected from D-mannose, L-mannose, D-arabinose, D-xylfuranose, L-xylfuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannose, β-D-mannose, α-D-mannose, β-D-mannose, α-D-glucose, β-D-glucose, α-D-glucose, β-D-glucose α-D-Furfural, β-D-Furfural, α-D-Fructose, α-D-Galactopyranose, α-D-Galactopyranose, β-D-Galactopyranose, α-D-Galactopyranose, β-D-Galactopyranose, Glucosamine, Sialic acid, Galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, N-isobutyrylgalactosamine, 2 -Amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-carboxamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfonamido-D-glucopyranose, N-ethanolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, 2,3,4 One of the following: tri-O-acetyl-1-thio-6-O-triphenylmethyl-α-D-glucopyranoside methyl ester, 4-thio-β-D-galactopyranose, 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucopyranoside ethyl ester, 2,5-dehydrated-D-alosulfonyl, ribose, D-ribose, D-4-thioribose, L-ribose, and L-4-thioribose. In some embodiments, at least one or each of the target groups is galactose or N-acetylgalactosamine.

[0394] In some embodiments, the linker in the siRNA conjugate of this disclosure has a structure as shown in formula (301):

[0395]

[0396] Where k is an integer from 1 to 3;

[0397] L A Having a structure containing amide bonds as shown in formula (302), L B Having a structure containing N-acylpyrrolidine as shown in formula (303), containing a carbonyl group and an oxygen atom, L C It is a linking group based on hydroxymethylaminomethane, dihydroxymethylaminomethane, or trihydroxymethylaminomethane;

[0398]

[0399] Where, n 302 q 302 and p 302 Each is an independent integer from 2 to 6; optionally, n 302 q 302 and p 302 Each is independently 2 or 3; n 303 n is an integer between 4 and 16, optionally n 303 For integers between 8 and 12, This indicates the site where the group is covalently linked.

[0400] In the aforementioned connector, each L A Each of the target groups is connected via an ether bond and via L C The oxygen atom of the hydroxyl group in some of the middle groups is related to L. C Partially linked by ether bonds; L B Through the carbonyl group in formula (303) and L C The nitrogen atom of the amino group in the middle is linked by an amide bond, and is linked to the siRNA by an oxygen atom in formula (303) through a phosphate ester bond or a thiophosphate ester bond.

[0401] In some embodiments, the siRNA conjugates provided in this disclosure have a structure as shown in formula (305):

[0402]

[0403]

[0404] Nu represents the siRNA provided in this disclosure.

[0405] In some embodiments, the linker in the siRNA conjugate of this disclosure has the structure shown in formula (306):

[0406]

[0407] Where, n 306 For each p, the integer is between 0 and 3. 306 Independently, integers from 1 to 6. The site indicates a covalently linked group; the linking group is connected to the target group by an ether bond formed by an oxygen atom marked with *; the linking group is connected to the siRNA by at least one of the oxygen atoms marked with # forming a phosphate ester bond or a thiophosphate ester bond, and the remaining oxygen atoms marked with # are connected to hydrogen atoms to form hydroxyl groups, or connected to C1-C3 alkyl groups to form C1-C3 alkoxy groups;

[0408] In some embodiments, the siRNA conjugates of this disclosure have a structure as shown in formula (307):

[0409]

[0410] Nu represents the siRNA provided in this disclosure.

[0411] In some embodiments, the siRNA conjugates of this disclosure have the structure shown in formula (308):

[0412]

[0413] in,

[0414] n1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4;

[0415] Each m1, m2, or m3 is an independent integer selected from 2 to 10;

[0416] R 10 R 11 R 12 R 13 R 14 or R 15 Each is independently H, or selected from the group consisting of C1-C. 10 Alkyl, C1-C 10 Halogenated alkyl groups and C1-C 10 Alkoxy;

[0417] R3 has the structure shown in Equation A59:

[0418]

[0419] Wherein, E1 represents OH, SH, or BH2, and Nu represents the siRNA provided in this disclosure;

[0420] R2 is a straight-chain alkylene group with a length of 1-20 carbon atoms, wherein one or more carbon atoms are optionally replaced by any one or more groups selected from the group consisting of: C(O), NH, O, S, CH=N, S(O)2, C2-C 10 alkenyl, C2-C 10 Ethyne group, C6-C 10 aryl, C3-C 18 Heterocyclic groups and C5-C 10 Heteroaryl; and wherein R2 may optionally have any one or more substituents from the group consisting of: C1-C 10 Alkyl, C6-C 10 Aryl, C5-C 10 heteroaryl, C1-C 10 Halogenated alkyl, -OC1-C 10 Alkyl, -OC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-OH, -OC1-C 10 Halogenated alkyl, -SC1-C 10 Alkyl, -SC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated alkyl groups, halogenated substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2,-N(C1-C) 10 Alkyl) (C1-C 10 alkyl), -NH(C1-C 10 Alkyl), -N(C1-C 10 Alkyl) (C1-C 10 alkylphenyl), -NH(C1-C 10 Alkylphenyl), cyano, nitro, -CO2H, -C(O)O(C1-C 10 Alkyl), -CON (C1-C) 10 Alkyl) (C1-C 10 Alkyl), -CONH (C1-C) 10 Alkyl groups, -CONH2, -NHC(O) (C1-C) 10 alkyl), -NHC(O)(phenyl), -N(C1-C 10 Alkyl)C(O)(C1-C 10 Alkyl), -N(C1-C 10 alkyl)C(O)(phenyl), -C(O)C1-C 10 Alkyl, -C(O)C1-C 10 Alkylphenyl, -C(O)C1-C 10Haloalkyl, -OC(O)Cl-C 10 Alkyl group, -SO2 (C1-C) 10 alkyl), -SO2 (phenyl), -SO2 (C1-C 10 Halogenated alkyl groups), -SO2NH2, -SO2NH (C1-C 10 alkyl), -SO2NH (phenyl), -NHSO2 (C1-C 10 Alkyl), -NHSO2 (phenyl) and -NHSO2 (C1-C) 10 (halogenated alkyl);

[0421] Each L1 is independently a straight-chain alkylene group with a length of 1-70 carbon atoms, wherein one or more carbon atoms are optionally replaced by any one or more groups selected from the group consisting of: C(O), NH, O, S, CH=N, S(O)2, C2-C 10 alkenyl, C2-C 10 Ethyne group, C6-C 10 aryl, C3-C 18 Heterocyclic groups and C5-C 10 Heteroaryl; and wherein L1 may optionally have any one or more substituents from the group consisting of: C1-C 10 Alkyl, C6-C 10 Aryl, C5-C 10 heteroaryl, C1-C 10 Halogenated alkyl, -OC1-C 10 Alkyl, -OC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-OH, -OC1-C 10 Halogenated alkyl, -SC1-C 10 Alkyl, -SC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated alkyl groups, halogenated substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2,-N(C1-C) 10 Alkyl) (C1-C 10 alkyl), -NH(C1-C 10 Alkyl), -N(C1-C 10 Alkyl) (C1-C 10 alkylphenyl), -NH(C1-C 10 Alkylphenyl), cyano, nitro, -CO2H, -C(O)O(C1-C 10 Alkyl), -CON (C1-C) 10 Alkyl) (C1-C10 Alkyl), -CONH (C1-C) 10 Alkyl group), -CONH2, -NHC(O) (C1-C 10 alkyl), -NHC(O)(phenyl), -N(C1-C 10 Alkyl)C(O)(C1-C 10 Alkyl), -N(C1-C 10 alkyl)C(O)(phenyl), -C(O)C1-C 10 Alkyl, -C(O)C1-C 10 Alkylphenyl, -C(O)C1-C 10 Haloalkyl, -OC(O)Cl-C 10 Alkyl group, -SO2 (C1-C) 10 alkyl), -SO2 (phenyl), -SO2 (C1-C 10 Halogenated alkyl groups), -SO2NH2, -SO2NH (C1-C 10 alkyl), -SO2NH (phenyl), -NHSO2 (C1-C 10 Alkyl), -NHSO2 (phenyl) and -NHSO2 (C1-C) 10 (halogenated alkyl);

[0422] Indicates the site where groups are covalently linked;

[0423] M1 represents a targeting group, the definition of which and the range of possible selections are the same as described above. In some embodiments, each M1 is independently selected from a group of ligands that have affinity for desialylate glycoprotein receptors on the surface of mammalian liver cells.

[0424] Those skilled in the art will understand that, although L1 is defined as a linear alkyl group for convenience, it may not be a linear group or may have a different name, such as an amine or alkenyl group resulting from the above substitutions and / or replacements. For the purposes of this disclosure, the length of L1 is the number of atoms in the chain connecting the two attachment points. For this purpose, the ring (such as a heterocyclic or heteroaryl group) obtained by replacing a carbon atom of the linear alkylene group is counted as one atom.

[0425] When M1 is a ligand with affinity for the desialyl glycoprotein receptor on the surface of mammalian liver cells, in some embodiments, n1 can be an integer from 1 to 3, and n3 can be an integer from 0 to 4, ensuring that the number of M1 ligands in the conjugate is at least 2; in some embodiments, n1 + n3 ≥ 2, which ensures that the number of M1 ligands is at least 3, making it easier for the M1 ligand to bind to the desialyl glycoprotein receptor on the liver surface, thereby promoting the conjugate's entry into the cell via endocytosis. Experiments show that when the number of M1 ligands is greater than 3, the ease of binding of the M1 ligand to the desialyl glycoprotein receptor on the liver surface does not increase significantly. Therefore, considering factors such as ease of synthesis, structural / process cost, and delivery efficiency, in some embodiments, n1 is an integer from 1 to 2, n3 is an integer from 0 to 1, and n1 + n3 = 2 - 3.

[0426] In some embodiments, when m1, m2, and m3 are independently selected from integers of 2 to 10, the spatial positions between the multiple M1 ligands can be adapted to the binding of the M1 ligand to the liver surface desialylate glycoprotein receptor. In order to make the conjugates provided in this disclosure simpler, easier to synthesize, and / or reduce costs, in some embodiments, m1, m2, and m3 are each independently an integer of 2 to 5, and in some embodiments, m1 = m2 = m3.

[0427] Those skilled in the art will understand that when R 10 R 11 R 12 R 13 R 14 and R 15 Each is independently selected from H, C1-C 10 Alkyl, C1-C 10 Halogenated alkyl groups and C1-C 10 Using one of the alkoxy groups will not change the properties of the conjugates disclosed herein, and the objectives of this disclosure can still be achieved. In some embodiments, R 10 R 11 R 12 R 13 R 14 and R 15 Each is independently selected from H, methyl, and ethyl. In some embodiments, R 10 R 11 R 12 R 13 R 14 and R 15 All are H.

[0428] According to the siRNA conjugate provided in this disclosure, R3 is a group with the structure shown in Formula A59, wherein E1 is OH, SH or BH2. Based on the consideration of the availability of raw materials, in some embodiments, E1 is OH or SH.

[0429] In some implementations, R2 is chosen to enable the connection between N and A59 on the nitrogen-containing framework. In the context of this disclosure, "nitrogen-containing framework" refers to a framework connected to R. 10 R 11 R 12 R 13 R 14 and R 15 The carbon atoms of R2 are interconnected with nitrogen atoms in a chain-like structure. Therefore, R2 can be any linking group capable of connecting the A59 group to the nitrogen-containing backbone in a suitable manner. In some embodiments, when the siRNA conjugates of this disclosure are prepared by solid-phase synthesis, the R2 group needs to contain both a linking site for the nitrogen-containing backbone and a linking site for the phosphorus (P) in R3. In some embodiments, the site in R2 that links to the nitrogen-containing backbone forms an amide bond with the nitrogen, and the site that links to the phosphorus (P) in R3 forms a phosphate ester bond with the phosphorus (P). In some embodiments, R2 is B5, B6, B5', or B6'.

[0430]

[0431] in, This indicates the site where a group is covalently bonded.

[0432] The value of q2 can be an integer from 1 to 10. In some implementations, q2 is an integer from 1 to 5.

[0433] The function of L1 is to link the M1 ligand to the N on the nitrogen-containing backbone, providing targeting functionality for the siRNA conjugate of this disclosure. In some embodiments, L1 is selected from one or more linkage combinations of groups of formulas A1-A26. In some embodiments, L1 is selected from one or more linkage combinations of A1, A4, A5, A6, A8, A10, A11, and A13; in some embodiments, L1 is selected from a linkage combination of at least two of A1, A4, A8, A10, and A11; in some embodiments, L1 is selected from a linkage combination of at least two of A1, A8, and A10.

[0434]

[0435] In some embodiments, the length of L1 can be 3-25 atoms, 3-20 atoms, 4-15 atoms, or 5-12 atoms. In some embodiments, the length of L1 is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, or 60 atoms.

[0436] In some embodiments, j1 is an integer from 2 to 10, and in some embodiments, j1 is an integer from 3 to 5. In some embodiments, j2 is an integer from 2 to 10, and in some embodiments, j2 is an integer from 3 to 5. R' is a C1-C4 alkyl group, and in some embodiments, R' is one of methyl, ethyl, and isopropyl. Ra is one of A27, A28, A29, A30, and A31, and in some embodiments, Ra is A27 or A28. Rb is a C1-C5 alkyl group, and in some embodiments, Rb is one of methyl, ethyl, isopropyl, and butyl. In some embodiments, j1, j2, R', Ra, and Rb in formulas A1-A26 are selected respectively to achieve N-linking of the M1 ligand to the nitrogen-containing backbone and to make the spatial positions between the M1 ligands more suitable for the binding of the M1 ligand to the liver surface desialyl glycoprotein receptor.

[0437]

[0438] In some embodiments, the siRNA conjugates of this disclosure have structures shown in formulas (403), (404), (405), (406), (407), (408), (409), (410), (411), (412), (413), (414), (415), (416), (417), (418), (419), (420), (421), or (422):

[0439]

[0440]

[0441]

[0442]

[0443]

[0444]

[0445]

[0446]

[0447] In some embodiments, P in Formula A59 can be attached to any possible position in the siRNA sequence; for example, P in Formula A59 can be attached to any nucleotide of the siRNA's sense or antisense strand. In some embodiments, P in Formula A59 is attached to any nucleotide of the siRNA's sense strand. In some embodiments, P in Formula A59 is attached to the end of the siRNA's sense or antisense strand; in some embodiments, P in Formula A59 is attached to the end of the siRNA's sense strand. The end refers to the first four nucleotides of the sense or antisense strand counted from one end. In some embodiments, P in Formula A59 is attached to the end of the siRNA's sense or antisense strand; in some embodiments, P in Formula A59 is attached to the 3' end of the siRNA's sense strand. When attached to the above-described positions on the sense strand of the siRNA, the conjugate provided in this disclosure, upon entering the cell and unwinding, can release the individual siRNA antisense strand to inhibit target gene expression via an RNAi mechanism.

[0448] The P in Formula A59 can be attached to any possible position on a nucleotide in the siRNA, such as the 5' position, 2' position, 3' position, or base of the nucleotide. In some embodiments, the P in Formula A59 can be attached to the 2', 3', or 5' position of the nucleotide in the siRNA by forming a phosphodiester bond. In some embodiments, the P in Formula A59 is attached to the oxygen atom formed after the dehydrogenation of the 3'-hydroxyl group of the 3'-terminal nucleotide of the siRNA positive strand, or the P in Formula A59 is attached to the nucleotide by substituting a hydrogen atom in the 2'-hydroxyl group of a nucleotide in the siRNA positive strand, or the P in Formula A59 is attached to the nucleotide by substituting a hydrogen atom in the 5'-hydroxyl group of the 5'-terminal nucleotide of the siRNA positive strand.

[0449] In some embodiments, the siRNA conjugates of this disclosure may contain any of the siRNAs listed in, for example, Tables 1a, 1b, or 1c. siRNA conjugates containing these siRNAs exhibit low off-target effects and high mRNA repressive activity against APOC3 gene expression.

[0450] Table 1a shows the first siRNA sequence disclosed herein.

[0451]

[0452]

[0453] Table 1b shows the second siRNA sequence disclosed herein.

[0454]

[0455]

[0456]

[0457] Table 1c shows the third siRNA sequence disclosed herein.

[0458]

[0459]

[0460] In this context, uppercase letters C, G, U, and A represent the base composition of a nucleotide; lowercase letter m indicates that the nucleotide adjacent to the left of m is methoxylated; lowercase letter f indicates that the nucleotide adjacent to the left of f is fluorinated; and underlined uppercase letters... S This indicates the letter S The nucleotide adjacent to the left is a stabilizing modified nucleotide; the lowercase letter 's' indicates that the two nucleotides to the left and right of 's' are linked by a phosphate thioester group; P1 indicates that the nucleotide adjacent to the right of 'P1' is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide. In some embodiments, S This indicates specific stabilization modifications, such as... moe The underlined letter combination moe Indicates that in the letter combination moe The nucleotide adjacent to the left is a nucleotide modified with 2'-O-methoxyethyl. In some embodiments, P1 represents a specific modification VP, Ps, or P, where the letter combination VP indicates that the nucleotide adjacent to the right of the letter combination VP is a nucleotide modified with vinyl phosphate (5'-(E)-vinylphosphonate, E-VP), the letter combination Ps indicates that the nucleotide adjacent to the right of the letter combination Ps is a nucleotide modified with thiophosphate, and the capital letter P indicates that the nucleotide adjacent to the right of the letter P is a 5'-phosphate nucleotide. Furthermore, each U in the sequences listed in Tables 1a-1c above can be arbitrarily replaced with T without significantly affecting the activity or off-target effects of the siRNA.

[0461] This disclosure discloses the preparation of siRNA conjugates.

[0462] The aforementioned siRNA conjugates can be synthesized using methods already described in detail in the prior art. For example, WO2015006740A2 describes in detail various methods for preparing siRNA conjugates. The siRNA conjugates disclosed herein can also be obtained through methods well known to those skilled in the art. For instance, WO2014025805A1 describes a method for preparing the structure shown in formula (305), and Rajeev et al. describe a method for preparing the structure shown in formula (307) in ChemBioChem 2015, 16, 903-908. Chinese patent application CN110959011A also discloses in detail a method for preparing the siRNA conjugate shown in formula (308). The entire contents of the above-mentioned documents are incorporated herein by reference.

[0463] The siRNA conjugates disclosed herein can also be used in combination with other pharmaceutically acceptable excipients, which can be one or more of a variety of formulations or compounds conventionally used in the art, as detailed in the above description of the pharmaceutical compositions disclosed herein.

[0464] Applications of the siRNA, pharmaceutical compositions, and siRNA conjugates disclosed herein

[0465] In some embodiments, this disclosure provides the use of the siRNA of this disclosure, and / or pharmaceutical compositions and / or siRNA conjugates, in the preparation of medicaments for treating and / or preventing diseases or symptoms associated with APOC3 gene expression mRNA levels. Throughout some embodiments, the disease or symptom associated with APOC3 gene expression mRNA levels is dyslipidemia. In some embodiments, the dyslipidemia is hypercholesterolemia, hypertriglyceridemia, or atherosclerosis.

[0466] In some embodiments, this disclosure provides a method for treating and / or preventing diseases or symptoms associated with APOC3 gene expression mRNA levels, the method comprising administering to a subject in need the disclosed siRNA, and / or pharmaceutical composition, and / or siRNA conjugate. In some embodiments, the disease or symptom associated with APOC3 gene expression mRNA levels is dyslipidemia. In some embodiments, the dyslipidemia is hypercholesterolemia, hypertriglyceridemia, or atherosclerosis.

[0467] In some embodiments, this disclosure also provides a method for inhibiting the expression level of the APOC3 gene in cells, the method comprising contacting the cells with an effective dose of the siRNA of this disclosure, and / or a pharmaceutical composition and / or siRNA.

[0468] By administering the siRNA, pharmaceutical compositions, and / or siRNA conjugates provided in this disclosure to subjects in need, the prevention and / or treatment of pathological conditions or diseases caused by the expression of specific genes in cells can be achieved through mechanisms that regulate gene expression. Therefore, the siRNA, pharmaceutical compositions, and / or siRNA conjugates provided in this disclosure can be used for the prevention and / or treatment of said pathological conditions or diseases, or for the preparation of medicaments for the prevention and / or treatment of the pathological conditions or diseases described herein.

[0469] As used herein, the term "administration" refers to the placement of siRNA, pharmaceutical composition, and / or siRNA conjugates into a subject by means of a method or route that at least partially targets the siRNA, pharmaceutical composition, and / or siRNA conjugate at a desired site to produce a desired effect. Routes of administration suitable for the methods of this disclosure include local administration and systemic administration. Generally, local administration results in the delivery of more siRNA, pharmaceutical composition, and / or siRNA conjugates to a specific site compared to the entire body of the subject; while systemic administration results in the delivery of said siRNA, pharmaceutical composition, and / or siRNA conjugates to substantially the entire body of the subject. Given that this disclosure aims to provide means for the prevention and / or treatment of pathological conditions or diseases caused by the expression of specific genes in hepatocytes, some embodiments are administration methods capable of delivering the drug to the liver.

[0470] The medication may be administered to the subject via any suitable route known in the art, including but not limited to: oral or parenteral routes, such as intravenous administration, intramuscular administration, subcutaneous administration, transdermal administration, airway administration (aerosol), pulmonary administration, nasal administration, rectal administration, and local administration (including oral and sublingual administration). Administration frequency may be once or more daily, weekly, bi-weekly, bi-weekly, monthly, or annually.

[0471] The dosages of the siRNA, pharmaceutical compositions, and / or siRNA conjugates described in this disclosure are conventional dosages in the art, which can be determined based on various parameters, particularly the age, weight, and sex of the subject. Toxicity and efficacy can be determined in cell culture or laboratory animals using standard pharmaceutical procedures, such as determining the LD50 (the dose that causes 50% of the population to die) and ED50 (the dose that elicits 50% of the maximum response intensity in a quantitative response, and the dose that elicits a positive response in 50% of the subjects in a qualitative response). The range of human dosages can be derived based on data obtained from cell culture analysis and animal studies.

[0472] When administering the siRNA, pharmaceutical composition, and / or siRNA conjugates described in this disclosure, for example, to male or female C57BL / 6J or C3H / HeNCrlVr mice, 6-12 weeks old, weighing 18-25 g, the amount of siRNA in the siRNA, pharmaceutical composition, and / or siRNA conjugate is as follows: for siRNA conjugates formed by siRNA and pharmaceutically acceptable conjugate molecules, the amount of siRNA may be 0.001-100 mg / kg body weight, in some embodiments 0.01-50 mg / kg body weight, in further embodiments 0.05-20 mg / kg body weight, in even further embodiments 0.1-15 mg / kg body weight, and in still further embodiments 0.1-10 mg / kg body weight. The above amounts are preferred when administering the siRNA, pharmaceutical composition, and / or siRNA conjugates described in this disclosure.

[0473] Furthermore, by introducing the siRNA, pharmaceutical composition, and / or siRNA conjugate disclosed herein into cells with abnormal gene expression, the expression of that specific gene in the cells can also be inhibited through gene expression regulation mechanisms. In some embodiments, the cells are hepatocytes. In some embodiments, the hepatocytes may be cells selected from hepatocellular carcinoma cell lines such as Hep3B, HepG2, and Huh7, or isolated primary hepatocytes; in some embodiments, they are primary hepatocytes.

[0474] The methods provided in this disclosure for inhibiting the expression of specific genes in cells involve siRNAs, pharmaceutical compositions, and / or siRNA conjugates, the amount of siRNA used of which is readily determined by those skilled in the art based on the desired effect. For example, in some embodiments, the amount of siRNA in the provided siRNA conjugate is sufficient to reduce the expression of the target gene and result in an extracellular concentration of 1 pM to 1 μM, or 0.01 nM to 100 nM, or 0.05 nM to 50 nM, or about 5 nM at the surface of the target cells. The amount required to achieve this local concentration will vary depending on various factors, including the delivery method, delivery site, the number of cell layers between the delivery site and the target cells or tissue, and whether the delivery is local or systemic. The concentration at the delivery site can be significantly higher than the concentration at the surface of the target cells or tissue.

[0475] Reagent test kit

[0476] This disclosure provides a kit comprising siRNA, pharmaceutical composition and / or siRNA conjugate provided in this disclosure.

[0477] In some embodiments, the kit described herein may provide siRNA, pharmaceutical composition, and / or conjugate in a single container. In some embodiments, the kit described herein may include a container providing pharmaceutically acceptable excipients. In some embodiments, the kit may also contain other components, such as stabilizers or preservatives. In some embodiments, the kit described herein may contain at least one other therapeutic agent in a container other than the one providing the siRNA, pharmaceutical composition, and / or conjugate described herein. In some embodiments, the kit may include instructions for mixing the siRNA, pharmaceutical composition, and / or conjugate with pharmaceutically acceptable carriers and / or excipients or other components (if any).

[0478] In the kits disclosed herein, the siRNA and pharmaceutically acceptable carriers and / or excipients, as well as the pharmaceutical compositions and / or conjugates, and / or pharmaceutically acceptable excipients, may be provided in any form, such as liquid, dry, or lyophilized. In some embodiments, the siRNA and pharmaceutically acceptable carriers and / or excipients, as well as the pharmaceutical compositions and / or conjugates and optional pharmaceutically acceptable excipients, are substantially pure and / or sterile. In some embodiments, sterile water may be provided in the kits disclosed herein.

[0479] The present disclosure will be further illustrated by the following examples, but the present disclosure is not limited thereto.

[0480] Example

[0481] Unless otherwise specified, the reagents and culture media used in the following examples are all commercially available products, and the nucleic acid electrophoresis, real-time PCR and other operations used are all performed in accordance with the methods described in Molecular Cloning (Cold Spline Harbor Laboratory Press (1989)).

[0482] Preparation Examples 1-7: Synthesis of the siRNA conjugates disclosed herein

[0483] Following the preparation method described in Example 1 of CN110959011A, conjugates 1-7 as shown in Table 2 were prepared, differing only in that the sense and antisense strands of the siRNA contained in each conjugate are as shown in Table 2; for nucleic acid sequences containing the following, the sense and antisense strands of the siRNA were synthesized according to the nucleic acid sequences of the siRNAs numbered 1-7 in Table 2. Each siRNA conjugate was diluted to a concentration of 0.2 mg / mL (based on siRNA) using ultrapure water (Milli-Q ultrapure water system, resistivity 18.2 MΩ*cm (25℃)), and the molecular weight was determined using liquid chromatography-mass spectrometry (LC-MS, Waters Corporation, model: LCT Premier). The measured values ​​were consistent with the theoretical values, indicating that the synthesized conjugates 1-7 are the target designed double-stranded nucleic acid sequences. Each siRNA conjugate has the structure shown in formula (403), and the siRNA contained in the siRNA conjugate has the siRNA sequences corresponding to conjugates 1-7 in Table 2. For example, the molecular weight (mw) of conjugate 5 is: theoretical value of the sense strand: 7581.42; measured value: 7581.22; theoretical value of the antisense strand: 6948.55; measured value: 6948.72. The measured values ​​are consistent with the theoretical values, indicating that the conjugate has the structure shown in formula (403), and the conjugate has the siRNA sequence corresponding to conjugate 5 in Table 2.

[0484] Table 2. siRNA sequences in siRNA conjugates

[0485]

[0486]

[0487]

[0488] In this context, uppercase letters C, G, U, A, and T represent the base composition of the nucleotide; lowercase letter m indicates that the nucleotide adjacent to the left of letter m is methoxylated; lowercase letter f indicates that the nucleotide adjacent to the left of letter f is fluorinated; and underlined letter combinations... moe The letter combination "moe" indicates that the nucleotide adjacent to the left of the letter combination "moe" is a nucleotide modified with ribose 2'-O-methoxyethyl; the lowercase letter "s" indicates that the two nucleotides to the left and right of the letter "s" are linked by a thiophosphate group; and "P" indicates that the nucleotide to the right of the letter "P" is a 5'-phosphate nucleotide.

[0489] Synthesis of reference siRNA conjugates in Comparative Preparation Examples 1-3

[0490] Following the preparation method described in Example 1 of CN110959011A, reference siRNA conjugates numbered 1-3 in Table 2 were prepared, with the only difference being that the sense and antisense strands of the siRNA contained in each reference siRNA conjugate are shown in Table 2. The sense and antisense strands of the siRNAs numbered 1-3 in Table 2 were synthesized according to their nucleic acid sequences. Each reference siRNA conjugate was diluted to a concentration of 0.2 mg / mL (based on siRNA) using ultrapure water (Milli-Q ultrapure water system, resistivity 18.2 MΩ*cm (25℃)). Molecular weight was then determined using liquid chromatography-mass spectrometry (LC-MS, Waters Corporation, model: LCT Premier). The measured values ​​were consistent with the theoretical values, indicating that the synthesized reference conjugates 1-3 each possess the designed double-stranded nucleic acid sequence. Each reference siRNA conjugate has the structure shown in formula (403), and the siRNA contained therein has the siRNA sequence corresponding to reference conjugates 1-3 in Table 2, and these siRNA sequences do not contain stabilizing nucleotides.

[0491] Comparative Preparation Example 4: Synthesis of Reference siRNA NC

[0492] Following the method described in Preparation Example 1 of WO2019105418(A1), the following reference siRNA NC was synthesized by solid-phase synthesis, the only difference being that equimolar complementary sense strands as shown in SEQ ID NO:161 and antisense strands as shown in SEQ ID NO:162 were dissolved in DEPC water, followed by annealing to obtain the reference siRNA NC:

[0493] 5'-UmsUmsCmUmCmCmGfAfAfCmGmUmGmUmCmAmCmGmUm-3'

[0494] (SEQ ID NO:161); 5'-AmsCfsGmUmGmAfCmAmCmGmUmUmCmGfGmAfGmAmAmsCmsUm-3'

[0495] (SEQ ID NO:162).

[0496] Preparation Examples 8-14: Synthesis of the siRNA disclosed herein

[0497] Following the method described in Preparation Example 1 of WO2019105418(A1), the siRNA sequences listed in Table 2 were synthesized by solid-phase synthesis, with the only difference being that equimolar amounts of the complementary sense and antisense strands in Table 2 were dissolved in DEPC water, followed by annealing to obtain siRNA1-siRNA7 provided in this disclosure, the sequences of which are shown in Table 2.

[0498] Comparative preparation examples 4-10

[0499] The reference siRNA-reference siRNA7 was prepared using the same method as in Preparation Examples 8-14.

[0500] Example 1: Toxicity of siRNA conjugates in mice

[0501] Conjugate 1, Conjugate 2, and Reference Conjugate 1 were each dissolved in PBS to prepare a 10 mg / ml solution (based on siRNA conjugates). ICR mice (half male and half female, 18-22 g weight, 5-6 weeks old, purchased from Spiering Biotechnology) were randomly divided into groups of 6 mice each (half male and half female), and numbered accordingly. Each mouse was administered the above siRNA conjugate solution via subcutaneous injection in the neck and back, with an administration volume of 10 mL / kg, serving as the test group. Another group of mice was administered PBS to each mouse, with an administration volume of 10 mL / kg, serving as the blank control group.

[0502] Taking the drug administration point as day 1, on day 8, 0.6 mL of blood was collected from the orbital sinus of each mouse in both the test group and the blank control group. After incubation at 37°C for 60 min, the blood was centrifuged at 3000 rpm for 15 min at 4°C to obtain serum. The concentrations of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the serum were further detected using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy). The results are shown in Table 1.

[0503] Further, after blood collection on day 8, mice were euthanized and necropsies were performed. Pathological sections were prepared by preserving the samples in 10% neutral buffered formalin. The severity of hepatic steatosis and inflammation in the pathological sections was evaluated and graded.

[0504] Table 1. Blood biochemical results in mice treated with siRNA conjugates.

[0505] experimental group Reference conjugate 1 Conjugate 1 Conjugate 2 dose 100mg / kg 100mg / kg 100mg / kg ALT 420％ 116％ 118％ AST 126％ - 32％

[0506] In Table 1, the percentage and preceding numbers represent the difference between the concentration of alanine aminotransferase (ALT) or aspartate aminotransferase (AST) in mouse serum and the concentration in the blank control group, as a percentage of the concentration in the blank control group. For example, 420% in Table 1 represents that the concentration of alanine aminotransferase in mice given reference conjugate 1 at 100 mg / kg was 420% higher than that in the blank control group.

[0507] As shown in Table 1, compared with the blank control, mice given reference conjugate 1 without stabilizing nucleotides showed significant changes in blood biochemical parameters, with ALT concentration increasing by 420% and AST concentration increasing by 126%. In mice given siRNA conjugates 1 or 2 of this disclosure, ALT concentration increased by only 116% and 118%, respectively, and AST concentration increased by only 32%, showing significantly reduced blood biochemical parameters.

[0508] Pathological examination revealed that, compared to the blank control, among the six mice administered reference conjugate 1 (without stabilizing modified nucleotides), one mouse exhibited moderate hepatocellular inflammation, specifically characterized by diffuse, low-level inflammatory cell infiltration in its hepatic lobules and diffuse proliferation of fibroblasts in the sinusoids; three mice showed mild hepatocellular inflammation, with focal inflammatory cell infiltration in localized hepatic lobules; and one mouse showed localized inflammatory necrosis in its hepatic lobules and punctate necrosis of individual hepatocytes. In contrast, among the mice administered conjugate 1, only two mice showed mild hepatocellular inflammation, characterized by low-level inflammatory cell infiltration, without moderate to severe inflammation or necrosis. Among the mice administered conjugate 2, only one mouse showed mild hepatocellular inflammation, without moderate to severe inflammation or necrosis. Compared to reference conjugate 1, conjugates 1 and 2 exhibited significantly lower toxicity.

[0509] The above results indicate that, compared with the reference conjugate, the siRNA conjugate disclosed herein can effectively reduce hepatotoxicity caused by off-target effects, thus showing significantly higher safety in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms, and has excellent development prospects.

[0510] Experimental Example 2: Toxicity of siRNA conjugates in mice

[0511] Conjugate 6, conjugate 7, and reference conjugate 3 were dissolved in PBS to prepare solutions of 10 mg / ml and 30 mg / ml (based on siRNA conjugates), respectively. ICR mice (half male and half female, 18-22 g in weight, 5-6 weeks old, purchased from Spiering Biotechnology) were randomly assigned to groups and numbered. For each conjugate at each concentration, two groups of animals were formed: a 2-week group and a 4-week group, with 6 mice (half male and half female) in each group. Each mouse was administered the above siRNA conjugate solution via subcutaneous injection in the neck and back, with an administration volume of 10 mL / kg, serving as the test group. Additionally, each mouse in both groups was administered PBS, with an administration volume of 10 mL / kg, serving as the blank control group (2-week or 4-week group, respectively).

[0512] Taking the drug administration point as day 1, six mice in the 2-week group (300 mg / kg conjugate concentration) were sacrificed and necropsy was performed after day 15. The tissue samples were fixed in 10% neutral buffered formalin and prepared for pathological sections. On day 29, 0.6 mL of blood was collected from the orbital sinus of six mice in both the test and control groups (4-week group). After incubation at 37°C for 60 min, the blood was centrifuged at 3000 rpm for 15 min at 4°C to obtain serum. The concentrations of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the serum were further measured using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy) and compared with the blank control group. The results are shown in Table 2. The severity of inflammatory cell infiltration and hepatocyte necrosis in the pathological sections was evaluated and graded, and relative comparisons were made.

[0513] Table 2. Blood biochemical results in mice treated with siRNA conjugates.

[0514]

[0515] In Table 2, F represents female mice, and the percentage and preceding numbers represent the difference between the serum concentrations of alanine aminotransferase (ALT) or aspartate aminotransferase (AST) in the mice and the serum concentrations in the blank control group, as a percentage of the serum concentrations in the blank control group. For example, F: 212% in Table 2 means that the concentration of alanine aminotransferase in female mice given reference conjugate 3 at 300 mg / kg was 212% higher than that in the blank control group.

[0516] As shown in Table 2, compared with the blank control, mice given reference conjugate 3 (without stabilizing modified nucleotides) exhibited significant changes in blood biochemical parameters. At a high dose of 300 mg / kg, the concentrations of ALT and AST in female mice increased by 212% and 36%, respectively. At the same dose, the concentrations of ALT and AST in female mice given conjugate 7 increased by 130% and 32%, respectively, with a significant decrease in ALT concentration compared to reference conjugate 3. No increase in ALT and AST concentrations was observed in mice given conjugate 6, and the degree of change in blood biochemical parameters was significantly reduced compared to reference conjugate 3.

[0517] Pathological examination revealed that, compared to the blank control, mice treated with reference conjugate 3 (without stabilizing modified nucleotides) showed a significant liver inflammatory response, with all six mice exhibiting inflammatory cell infiltration. In contrast, only three mice treated with conjugate 6 showed inflammatory cell infiltration, and only three mice treated with conjugate 7 also showed inflammatory cell infiltration. Compared to the reference conjugate, the conjugates disclosed herein also significantly reduced the number of mice exhibiting inflammatory cell infiltration in histopathological examination.

[0518] The above results indicate that, compared with the reference conjugate, the siRNA conjugate disclosed herein can effectively reduce hepatotoxicity caused by off-target effects, thus showing significantly higher safety in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms, and has excellent development prospects.

[0519] Example 3: Toxicity of siRNA conjugates in mice

[0520] The toxicity of siRNA conjugates in mice was verified following the method in Example 2, with the only difference being that conjugate 3 and reference conjugate 2 were used in the experiment. Each conjugate was dissolved in PBS to a concentration of 10 mg / ml (based on the siRNA conjugate). Three male mice were used in each of the 2-week and 4-week groups (labeled as D15 and D29 in Table 19, respectively). In other words, the toxicity of conjugate 13 and reference conjugate 2 in mice at a dose of 100 mg / kg was tested.

[0521] Table 3. Blood biochemical results in mice treated with siRNA conjugates.

[0522]

[0523] In Table 3, the percentage and the number preceding it represent the difference between the concentration of alanine aminotransferase (ALT) or aspartate aminotransferase (AST) in mouse serum and the concentration in the blank control group serum, and the percentage of the concentration in the blank control group serum.

[0524] As shown in Table 3, compared with the blank control, mice given reference conjugate 2 (without the stabilizing modified nucleotide) exhibited significant changes in blood biochemical parameters. On day 15 after administration, serum ALT and AST concentrations increased by 71% and 54%, respectively, and on day 29 after administration, serum ALT and AST concentrations increased by 118% and 94%, respectively. In contrast, no increase in serum ALT and AST concentrations was observed in mice given the same dose of conjugate 3. Conjugate 3 of this disclosure exhibited significantly lower blood biochemical parameters.

[0525] Pathological examination revealed that, compared to the blank control, in mice administered reference conjugate 2 (without stabilizing nucleotides), one mouse exhibited severe hepatocellular degeneration in histopathological results, specifically characterized by widespread hepatocyte swelling, loose and pale cytoplasm, and vacuolar degeneration in some hepatocytes with small, round vacuoles visible in the cytoplasm. Two mice showed moderate hepatocellular degeneration, specifically characterized by numerous to widespread hepatocytes with loose cytoplasm, and vacuolar degeneration in some hepatocytes with small, round vacuoles visible in the cytoplasm. In mice administered the disclosed siRNA conjugate 3, three mice showed mild hepatocellular degeneration, with even fewer hepatocytes exhibiting loose cytoplasm. Compared to the reference conjugate, the degree of hepatocellular degeneration was significantly reduced in histopathology, indicating a significantly lower toxicity.

[0526] The above results indicate that, compared with the reference conjugate, the siRNA conjugate disclosed herein can effectively reduce hepatotoxicity caused by off-target effects, thus showing significantly higher safety in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms, and has excellent development prospects.

[0527] Experimental Example 4: Toxicity of siRNA conjugates in mice

[0528] Conjugates 3 and 5 were dissolved in PBS to prepare solutions of 30 mg / ml (based on siRNA conjugates). ICR mice (half male and half female, 18-22 g weight, 5-6 weeks old, purchased from Spiering Biotechnology) were randomly divided into groups of 10 mice each, numbered accordingly. Each mouse was administered the siRNA conjugate solution via subcutaneous injection in the neck or back, at a volume of 10 mL / kg, serving as the test group. Another group of mice was administered PBS to each mouse, at a volume of 10 mL / kg, serving as the blank control group.

[0529] Using the initial administration date as day 1, mice were administered the drug again on days 8 and 15, using the same concentration and volume of siRNA conjugate solution (or PBS) as the initial administration. On day 16, 0.6 mL of blood was collected from the orbital sinus of each mouse in both the test and control groups. After incubation at 37°C for 60 min, the blood was centrifuged at 3000 rpm for 15 min at 4°C to obtain serum. The concentrations of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in serum were further detected using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy). Results are shown below. Figure 1A , Figure 1B .

[0530] Figure 1A , Figure 1B The images show scatter plots of ALT and AST concentrations in mouse serum after weekly administration of 300 mg / kg of the disclosed siRNA conjugate or PBS for three consecutive weeks. Figure 1A and Figure 1B As can be seen, compared with the blank control group, the serum ALT and AST concentrations after administration of the siRNA conjugate of this disclosure were comparable to those of the blank control group, indicating that the siRNA conjugate of this disclosure has very low hepatotoxicity.

[0531] Furthermore, after blood collection, mice were euthanized and necropsies performed. Pathological sections were prepared by fixing the samples in 10% neutral buffered formalin and making relative comparisons. The pathological sections showed that mice administered siRNA conjugates 3 or 5 of this disclosure exhibited responses similar to the blank control group in terms of hepatic steatosis and inflammation, with no significant abnormalities. This also demonstrates that the siRNA conjugates of this disclosure have very low hepatotoxicity.

[0532] The above results indicate that the siRNA conjugate disclosed herein can effectively reduce hepatotoxicity caused by off-target effects, thus showing significantly higher safety in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms, and has excellent development prospects.

[0533] Experimental Example 4: Inhibitory activity of siRNA conjugates in the in vitro sicheck system

[0534] In this experimental example, the in vitro sicheck system was used to detect the inhibitory activity of conjugate 1, conjugate 2, conjugate 3, conjugate 4, conjugate 6, conjugate 7, reference conjugate 1, reference conjugate 2, reference conjugate 3, or reference siRNA NC on the target sequence in the in vitro sicheck system.

[0535] [1] Constructing detection plasmids

[0536] Using psiCHECK TM -2(Promega TM A detection plasmid was constructed, containing a target sequence 1, i.e., the siRNA target sequence. For the siRNA conjugate to be tested, target sequence 1 is shown below:

[0537] (SEQ ID NO:163)

[0538] The target sequence 1 is a nucleotide sequence in the mRNA of the human APOC3 gene targeted by the detected siRNA. Therefore, the inhibitory effect of each siRNA conjugate on the target sequence 1 can reflect the inhibitory ability of the siRNA in the detected siRNA conjugate on APOC3 gene expression. The target sequence 1 and its complementary sequence were cloned into psiCHECK. TM -2 Xho I / Not I sites on the plasmid.

[0539] [2] Transfection

[0540] HEK293A cells (purchased from Nanjing Kebai Biotechnology Co., Ltd.) were cultured at 37°C in an incubator containing 5% CO2 / 95% air in DMEM complete medium (Hyclone) supplemented with 20% fetal bovine serum (FBS, Hyclone) and 0.2% (v / v) penicillin-streptomycin (Gibco, Invitrogen).

[0541] HEK293A cells were used at a rate of 8 × 10⁸ 3 Cells were seeded in 96-well plates. After 16 hours, when the cell growth density reached 70-80%, the H-DMEM complete medium in the culture wells was aspirated, and 80 μL of Opti-MEM medium (GIBCO) was added to each well for further culture for 1.5 hours.

[0542] The above detection plasmid was diluted with DEPC-treated water to a working solution of 200 ng / μL. Each of the following siRNA conjugates or the reference siRNA NC was prepared with DEPC-treated water to form three different concentrations (based on siRNA): 10 nM, 3 nM, and 1 nM, respectively, of the siRNA conjugate working solution or the reference siRNA NC working solution. The siRNA conjugates used were conjugate 1, conjugate 2, conjugate 3, conjugate 4, conjugate 6, conjugate 7, reference conjugate 1, reference conjugate 2, and reference conjugate 3, respectively.

[0543] For each siRNA conjugate or reference siRNA NC, prepare solutions 1A1-1A3. Each solution contains 1 μL of the above three concentrations of siRNA conjugate working solution or reference siRNA NC working solution, 0.05 μL of detection plasmid working solution (containing 10 ng of detection plasmid), and 10 μL of Opti-MEM medium.

[0544] Prepare 1B solution, each serving containing 0.2 μL of Lipofectamine. TM 2000 and 10 μL of Opti-MEM medium.

[0545] Prepare 1C solutions, each containing 0.05 μL of the detection plasmid working solution (containing 10 ng of the detection plasmid) and 10 μL of Opti-MEM medium.

[0546] Mix one portion of solution 1B with one portion of solution 1A1-1A3 of each siRNA conjugate or reference siRNA NC obtained separately, and incubate at room temperature for 20 min to obtain transfection complexes 1X1-1X3 of each siRNA conjugate or reference siRNA NC.

[0547] Mix one part of solution 1B with one part of solution 1C and incubate at room temperature for 20 min to obtain 1 x 4 blank transfection complexes.

[0548] Add 1X1-1X3 of each siRNA conjugate or reference siRNA NC transfection complex to the culture wells, mix thoroughly, and add 20 μL / well to obtain transfection complexes with final concentrations of approximately 0.1 nM, 0.03 nM, and 0.01 nM (based on siRNA) for each siRNA conjugate or reference siRNA NC transfection complex 1X1-1X3. Transfect 3 culture wells with each siRNA conjugate or reference siRNA NC transfection complex to obtain a co-transfection mixture containing siRNA conjugate or reference siRNA NC, which is designated as the test group.

[0549] For each siRNA conjugate or reference siRNA NC, 1 x 4 transfection complexes were added to 3 other wells at a volume of 20 μL / well to obtain a transfection mixture without siRNA, which was designated as the blank control group.

[0550] After transfecting the siRNA-containing co-transfection mixture and the siRNA-free co-transfection mixture into the culture wells for 4 hours, 100 μL of H-DMEM complete medium containing 20% ​​FBS was added to each well. The 96-well plate was then incubated in a CO2 incubator for another 24 hours.

[0551] [3] Detection

[0552] Remove the culture medium from each well and add 150 μL of [unspecified ingredient] to each well. Mix Luciferase reagent and H-DMEM solution (1:1 volume ratio) thoroughly and incubate at room temperature for 10 min. Then, transfer 120 μL of the mixture to a 96-well microplate and read the chemiluminescence value (Fir) of Firefly in each well using a Synergy II multi-mode microplate reader (BioTek). Add 60 μL of [unspecified ingredient] to each well of the 96-well microplate. Stop & After thoroughly mixing the reagents and incubating at room temperature for 10 minutes, use a microplate reader to read the chemiluminescence value (Ren) of Renilla in each well of the 96-well microplate according to the Fir reading arrangement.

[0553] The luminescence ratio (Ratio = Ren / Fir) per well on a 96-well microplate was calculated. The luminescence ratio (Ratio for test) or (Ratio for control) of each test group or control group was the average of the Ratios of the three culture wells. Using the luminescence ratio of the control group as a benchmark, the luminescence ratios of each test group were normalized to obtain the ratio R of (test) / Rati (control), which represents the relative expression level of the Renilla reporter gene, i.e., residual activity. The inhibition rate of each siRNA conjugate or reference siRNA NC against target sequence 1 was calculated as (1-R)×100%.

[0554] For the inhibitory effect of each siRNA conjugate or reference siRNA NC on the target sequence 1, please refer to [link to relevant documentation]. Figure 2 . Figure 2 This is a bar chart showing the relative expression level of target sequence 1 in the in vitro sicheck system after co-transfection of a plasmid containing target sequence 1 and the test siRNA conjugate or reference siRNA NC. Furthermore, the inhibition rate of target sequence 1 expression by each siRNA conjugate or reference siRNA NC is summarized in Table 3.

[0555] Table 4. Expression inhibition rate of target sequence 1 in the in vitro sicheck system.

[0556]

[0557] according to Figure 2 As shown in Table 4, the siRNA conjugates provided in this disclosure exhibit high target sequence inhibition activity in the in vitro sicheck system. At a low concentration of 0.01 nM, the expression inhibition rate of target sequence 1 is at least 38.92 nM, with a maximum of 67.54%; at a concentration of 0.1 nM, the expression inhibition rate of target sequence 1 is at least 84.73%, with a maximum of 89.35%. Furthermore, they exhibit similar levels of target sequence inhibition activity to reference conjugates 1, 2, or 3, which do not contain stabilizing modified nucleotides.

[0558] Experimental Example 6: Inhibitory activity of siRNA conjugates in the in vitro sicheck system

[0559] In this experimental example, the inhibitory activity of conjugate 6, conjugate 7, or reference conjugate 3 on the target sequence was detected using the in vitro sicheck system.

[0560] According to the method described in Kumico Ui-Tei et al., Functional dissection of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammalian gene silencing with significantly reduced off-target effect. Nucleic Acids Research, 2008, 36(7), 2136-2151, a detection plasmid was constructed. The detection plasmid and the test conjugate were co-transfected into HEK293A cells. The expression level of the dual luciferase reporter gene was used to reflect the target sequence inhibitory activity of the siRNA. The specific steps are as follows:

[0561] [1] Constructing detection plasmids

[0562] Using psiCHECK TM -2(Promega TM A detection plasmid was constructed, containing a target sequence 2, which is the target sequence of the siRNA conjugate. For the siRNA conjugate to be tested, target sequence 2 is shown below:

[0563] TTGCTTAAAAGGGACAGTATTCTCAGTGCTCTCCTACC(SEQ ID NO:164)

[0564] The target sequence 2 is the complete complementary sequence to the antisense strand in the detected siRNA conjugates. Therefore, the inhibitory effect of each siRNA conjugate on target sequence 1 can reflect the inhibitory ability of the detected siRNA conjugates on the expression of the target gene. Target sequence 2 and its complementary sequence were cloned into psiCHECK. TM -2 Xho I / Not I sites on the plasmid.

[0565] [2] Transfection

[0566] HEK293A cells (purchased from Nanjing Kebai Biotechnology Co., Ltd.) were cultured at 37°C in an incubator containing 5% CO2 / 95% air in DMEM complete medium (Hyclone) supplemented with 20% fetal bovine serum (FBS, Hyclone) and 0.2% (v / v) penicillin-streptomycin (Gibco, Invitrogen).

[0567] HEK293A cells were used at a rate of 8 × 10⁸ 3 Cells were seeded in 96-well plates. After 16 hours, when the cell growth density reached 70-80%, the H-DMEM complete medium in the culture wells was aspirated, and 80 μL of Opti-MEM medium (GIBCO) was added to each well for further culture for 1.5 hours.

[0568] The above-mentioned detection plasmid was diluted with DEPC-treated water to prepare a working solution of 200 ng / μL. Eleven different concentrations of siRNA conjugate working solutions (1.00 μM, 0.330 μM, 0.110 μM, 0.0370 μM, 0.0123 μM, 0.00412 μM, 0.00137 μM, 0.000457 μM, 0.000152 μM, 0.0000508 μM, and 0.0000169 μM, respectively, were prepared using DEPC-treated water. The siRNA conjugates used were conjugate 6, conjugate 7, and reference conjugate 3, respectively, prepared above.

[0569] For each siRNA conjugate, 2A1-2A11 solutions were prepared. Each 2A1-2A11 solution contained 1 μL of the above 11 concentrations of siRNA working solution, 0.05 μL of detection plasmid working solution (containing 10 ng of detection plasmid), and 10 μL of Opti-MEM medium, respectively.

[0570] Prepare 2B solution, each serving containing 0.2 μL of Lipofectamine. TM 2000 and 10 μL of Opti-MEM medium.

[0571] Prepare 2C solutions, each containing 0.05 μL of the detection plasmid working solution (containing 10 ng of the detection plasmid) and 10 μL of Opti-MEM medium.

[0572] Mix one portion of solution 2B with one portion of solution 2A1-2A11 of each siRNA conjugate, and incubate at room temperature for 20 min to obtain transfection complexes 2X1-2X11 of each siRNA conjugate.

[0573] Mix one portion of solution 2B with one portion of solution 2C, and incubate at room temperature for 20 min to obtain 2 x 12 blank transfection complexes.

[0574] Add 2X1-2X11 of each siRNA conjugate transfection complex to the culture wells, mix thoroughly, and add 20 μL / well to obtain transfection complexes with final concentrations of approximately 0.01 μM, 0.0033 μM, 0.0011 μM, 0.00037 μM, 0.000123 μM, 0.0000412 μM, 0.0000137 μM, 0.00000457 μM, 0.00000152 μM, 0.000000508 μM, and 0.000000169 μM (based on the amount of siRNA in the siRNA conjugate). Transfect 3 culture wells with each siRNA conjugate transfection complex 2X1-2X11 to obtain a co-transfection mixture containing siRNA conjugates, which is designated as the test group.

[0575] For each siRNA conjugate, 2 x 12 transfection complexes were added to three other wells at a rate of 20 μL per well to obtain a transfection mixture without siRNA conjugates, which was designated as the blank control group.

[0576] After transfecting the co-transfection mixture containing siRNA conjugates and the co-transfection mixture without siRNA conjugates into culture wells for 4 hours, 100 μL of H-DMEM complete medium containing 20% ​​FBS was added to each well. The 96-well plates were then incubated in a CO2 incubator for another 24 hours.

[0577] [3] Detection

[0578] Remove the culture medium from each well and add 150 μL of Dual-120 solution to each well. Mix Luciferase reagent and H-DMEM solution (1:1, volume ratio) thoroughly and incubate at room temperature for 10 min. Then transfer 120 μL of the mixture to a 96-well microplate. Use a Synergy II multi-plate reader (BioTek) to read the chemiluminescence value (Fir) of Firefly in each well of the 96-well microplate. Next, add 60 μL of Dual-DMEM solution to each well of the 96-well microplate. Stop & After thoroughly mixing the reagents and incubating at room temperature for 10 minutes, use a microplate reader to read the chemiluminescence value (Ren) of Renilla in each well of the 96-well microplate according to the Fir reading arrangement.

[0579] The luminescence ratio (Ratio = Ren / Fir) per well on a 96-well microplate was calculated. The luminescence ratio (Ratio for test) or (Ratio for control) of each test group or control group was the average of the Ratios of the three culture wells. Using the luminescence ratio of the control group as a benchmark, the luminescence ratios of each test group were normalized to obtain the Ratio (Ratio) / Ratio (Ratio for control), which represents the relative expression level of the Renilla reporter gene, i.e., residual activity. The inhibition rate of siRNA against the target sequence was calculated as (1-R)×100%.

[0580] Based on the relative residual activity of Renilla in HEK293A cells after transfection with different concentrations of the target siRNA, the nonlinear regression analysis function of Graphpad 5.0 software was used to fit the log (inhibitor) vs. response-variable slope (four parameters) dose-response curve.

[0581] Based on the function corresponding to the fitted dose-response curve, calculate the IC50 of the target sequence of the siRNA to be tested. 50 The value, the function is as follows,

[0582]

[0583] In the formula:

[0584] Y is the ratio R, which represents the relative residual activity of Renilla.

[0585] X represents the logarithm of the siRNA transfection concentration.

[0586] Bot is the Y value at the bottom of the steady-state period.

[0587] Top is the Y value at the peak of the steady-state period.

[0588] X' is the X value when Y is halfway between the bottom and the top, while HillSlope is the slope of the curve at X'.

[0589] Based on the dose-response curve and the corresponding function, determine X when Y = 50%. 50 The IC50 value of each siRNA was calculated. 50 Value = 10^X 50 (nM), IC 50 The values ​​are summarized in Table 5.

[0590] Table 5 shows the IC50 values ​​of siRNA conjugates in the pscheck system. 50

[0591] Conjugate Number <![CDATA[IC 50 ]]> Conjugate 6 8.55pM Conjugate 7 6.89pM Reference conjugate 3 6.68pM

[0592] As shown in Table 5, the siRNA conjugates disclosed herein exhibit high target sequence inhibitory activity in the in vitro sicheck system, with an IC50 value of [missing value]. 50 The concentration ranged from 6.89 to 8.55 pM. Meanwhile, reference conjugate 3, which has the same sequence as the others but does not contain stabilizing modified nucleotides, exhibited similar inhibitory activity against the target sequence.

[0593] Experimental Example 7: Inhibitory activity of siRNA conjugates in the in vitro sicheck system

[0594] Following the method in Example 6, the off-target sequence inhibitory activities of conjugates 3 and 6 in the in vitro sicheck system were tested. The only difference was that conjugate 3 or conjugate 6 was used instead of the tested siRNA conjugate; for conjugate 6, target sequence 2 was used, or target sequences 3-5 as shown below were used instead of target sequence 2; for conjugate 3, target sequence 2 was used, or target sequences 6-8 as shown below were used instead of target sequence 2.

[0595] Target sequence 3:

[0596] TAGGCCCCTTTCAAGTATTCT(SEQ ID NO:165)

[0597] Target sequence 4:

[0598] AGAATACTGTCCCTTTTAAGC(SEQ ID NO:166)

[0599] Target sequence 5:

[0600] CTCCGCAGTGAAATTTTAAGC(SEQ ID NO:167)

[0601] Target sequence 6:

[0602] CTTTCACTGCGGATCAGTGCT(SEQ ID NO:168)

[0603] Target sequence 7:

[0604] AGCACTGAGAATACTGTCCCT(SEQ ID NO:169)

[0605] Target sequence 8:

[0606] CTACAGTCTCCGCCTGTCCCT(SEQ ID NO:170)

[0607] Target sequence 2 contains a completely complementary sequence to the antisense strand of the siRNA in conjugates 3 and 6. Therefore, the inhibitory effect of conjugates 3 or 6 on target sequence 2 reflects the ApoC3 mRNA inhibitory activity of conjugates 3 or 6. Target sequence 3 contains a partially complementary sequence to the antisense strand of the siRNA in conjugate 6, target sequence 4 contains a completely complementary sequence to the sense strand of the siRNA in conjugate 6, and target sequence 5 contains a partially complementary sequence to the sense strand of the siRNA in conjugate 6. Therefore, the inhibitory effect of conjugate 6 on target sequences 3, 4, or 5 reflects the degree of off-target effect. That is, the higher the inhibitory effect, the more likely conjugate 6 is to be off-target. Similarly, target sequence 6 contains a partially complementary sequence to the antisense strand of the siRNA in conjugate 3, target sequence 7 contains a completely complementary sequence to the sense strand of the siRNA in conjugate 3, and target sequence 8 contains a partially complementary sequence to the sense strand of the siRNA in conjugate 3. Therefore, the inhibitory effect of conjugate 3 on target sequences 6, 7, or 8 reflects the degree of off-target effect. That is, the higher the inhibitory effect, the more likely conjugate 3 is to be off-target.

[0608] As a result, in the in vitro sicheck system, conjugate 6 had an IC50 of 11.3 pM for inhibiting target sequence 2, and its inhibition rate for target sequences 3, 4, or 5 was less than 50% across the entire range of tested siRNA concentrations, meaning that no off-target effects occurred. Conjugate 3 had an IC50 of 4.50 pM for inhibiting target sequence 2, and its inhibition rate for target sequences 6, 7, or 8 was less than 50% across the entire range of tested siRNA concentrations, meaning that no off-target effects occurred.

[0609] As can be seen, in the in vitro sicheck system, the siRNA conjugates disclosed herein exhibit excellent on-target inhibitory activity against the target sequence, with IC50 values ​​of 4.50 pM-11.3 pM; at the same time, the siRNA conjugates disclosed herein have low off-target effects.

[0610] Experimental Example 8: Inhibitory activity of siRNA conjugates in the in vitro sicheck system

[0611] Following the method in Example 6, the inhibitory activity of conjugate 5 in the in vitro sicheck system was tested, the only difference being that conjugate 5 was used instead of the tested siRNA conjugate for detection. The results showed that conjugate 5 exhibited high target sequence inhibitory activity in the in vitro sicheck system, with an IC50 of [missing value]. 50 It is 49.8pM.

[0612] Example 9: The effect of siRNA conjugates on lowering blood lipids in mice (in vivo).

[0613] Human APOC3 transgenic mice (Tg(APOC3)3707Bres, purchased from Jackson Laboratories, USA) with serum TG levels >2 mmol / L were randomly divided into groups of six, half male and half female. Each group of mice was administered conjugate 6, reference conjugate 3, and a PBS blank control. Dosage was calculated based on body weight, and all mice were administered a single subcutaneous injection. The dosage of each siRNA conjugate (based on siRNA content) was 3 mg / kg mouse body weight, with an administration volume of 5 ml / kg. Each siRNA conjugate was provided in PBS aqueous solution, and the required concentration of the conjugate was calculated based on the dosage and administration volume. An additional group of mice was administered 1×PBS at an administration volume of 5 ml / kg as a blank control.

[0614] Blood was collected from the orbital venous plexus of mice on days 1, 9, and 15, with 100 μL collected each time. After collection, the blood was left at room temperature for 30 min, and then centrifuged at 3000 rpm for 15 min at 4°C to obtain serum. The levels of total cholesterol (CHO) and triglycerides (TG) in the serum were further detected using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy).

[0615] Standardized blood lipid level = (blood lipid level in the test group after drug administration / blood lipid level in the test group before drug administration) × 100%.

[0616] The inhibition rate of blood lipid levels = (1 - blood lipid content of the test group after administration / blood lipid content of the test group before administration) × 100%.

[0617] Blood lipids refer to total cholesterol (CHO) or triglycerides (TG).

[0618] Figure 3A and Figure 3B Line graphs showing the changes in serum TG or serum CHO levels over time after administration of the siRNA conjugate, reference siRNA conjugate, or PBS disclosed herein. Further, the serum TG inhibition rate and serum CHO inhibition rate at each time point are summarized in Tables 6A and 6B below:

[0619] Table 6A. Serum TG inhibition rate of siRNA conjugates in transgenic mice

[0620]

[0621] Table 6B Serum CHO inhibition rate of siRNA conjugates in transgenic mice

[0622]

[0623] Figure 3A , Figure 3B The results in Tables 6A and 6B indicate that at different time points after administration, conjugate 6 significantly reduced the levels of TG and CHO in mouse serum and showed a lipid-lowering effect of no more than 11% compared with the corresponding reference conjugate 3, which does not include the stabilizing modified nucleotides.

[0624] Experimental Example 10: The effect of siRNA conjugates on lowering blood lipids in mice (in vivo)

[0625] The lipid-lowering effect of conjugate 7 of this disclosure in mice was investigated using the method described in Example 9. The only difference was that each group of mice was administered conjugate 7, reference conjugate 3, and a PBS blank control, respectively. All animals were given a single subcutaneous injection based on their body weight. The dosage of each siRNA conjugate (based on the amount of siRNA) was 3 mg / kg and 1 mg / kg of mouse body weight, with an administration volume of 5 ml / kg. The time point of administration was designated as day 1, and blood samples were collected from the orbital venous plexus of mice on days 1, 9, 15, 22, 29, 36, and 50.

[0626] Figure 4A and Figure 4B Line graphs showing the changes in serum TG or serum CHO levels over time after administration of the siRNA conjugate, reference siRNA conjugate, or PBS disclosed herein. Further, the serum TG inhibition rate and serum CHO inhibition rate at each time point are summarized in Tables 7A and 7B below:

[0627] Table 7A. Serum TG inhibition rate of siRNA conjugates in transgenic mice

[0628]

[0629] Table 7B Serum CHO inhibition rate of siRNA conjugates in transgenic mice

[0630]

[0631]

[0632] Figure 4A , Figure 4B The results in Tables 7A and 7B indicate that, at different time points after administration, conjugate 7 significantly reduced serum TG and CHO levels in mice, demonstrating a lipid-lowering effect comparable to or even superior to that of the corresponding reference conjugate 3, which does not contain stabilizing modified nucleotides. In particular, at a dose of 3 mg / kg, conjugate 7 consistently showed a high TG-lowering effect throughout the entire 50-day administration period, with a maximum inhibition rate of 90.2%.

[0633] Experimental Example 11: siRNA conjugates in mice ( in vivo The effect of lowering blood lipids Following the method in Example 9, the lipid-lowering effect of siRNA conjugates in mice was examined, with the only difference being that either conjugate 3 or conjugate 4 was used. The results are as follows... Figure 5A and Figure 5B As shown.

[0634] Figure 5A and Figure 5B Line graphs showing the changes in serum TG or serum CHO levels over time after administration of the siRNA conjugate or PBS disclosed herein. Further, the serum TG inhibition rate and serum CHO inhibition rate at each time point are summarized in Tables 8A and 8B below: Table 8A. Serum TG inhibition rate of siRNA conjugates in transgenic mice

[0636] Table 8A. Serum TG inhibition rate of siRNA conjugates in transgenic mice

[0637]

[0638] Table 8B Serum CHO inhibition rate of siRNA conjugates in transgenic mice

[0639]

[0640] Figure 5A , Figure 5B The results in Tables 8A and 8B indicate that conjugates 3 and 4 significantly reduced serum TG and CHO levels in mice at different time points after administration. In particular, at doses of 3 mg / kg and 1 mg / kg, conjugate 4 consistently showed a high TG-reducing effect throughout the entire 50-day administration period, with a maximum inhibition rate of 92.0%.

[0641] Experimental Example 12: The effect of siRNA conjugates on lowering blood lipids in mice (in vivo)

[0642] Following the method in Example 9, the lipid-lowering effect of siRNA conjugates in mice was investigated. The only difference was that conjugate 3 was used. The dosages (based on siRNA content) of each siRNA conjugate were 9 mg / kg, 3 mg / kg, 1 mg / kg, 0.5 mg / kg, 0.25 mg / kg, 0.1 mg / kg, or 0.05 mg / kg mouse body weight, with a dosage volume of 5 ml / kg. Each siRNA conjugate was provided in PBS aqueous solution, and the required concentration of the conjugate was calculated based on the dosage and dosage volume. Taking the administration time point as day 1, serum TG levels were measured by collecting blood samples from the orbital venous plexus of mice on days 1, 8, 15, 22, 29, 36, 43, 50, 57, and 64. The results are as follows... Figure 6 As shown.

[0643] Figure 6 To illustrate the changes in serum TG levels over time after administration of different concentrations of conjugate 3 or PBS, a line graph was created. Furthermore, the serum TG inhibition rates at each time point are summarized in Table 9 below:

[0644] Table 9. Serum TG inhibition rate of siRNA conjugates in transgenic mice.

[0645]

[0646] Figure 6 The results in Table 9 show that at different time points after administration, different concentrations of conjugate 3 can reduce the TG level in mouse serum. In particular, at a dose of 9 mg / kg, after only one administration, the siRNA conjugate of this disclosure can maintain a TG level inhibition rate of more than 50% for a long period of 64 days, and the inhibition rate can reach up to 89.5%, showing excellent lipid inhibition ability.

[0647] Example 13: Effect of siRNA conjugates on lipid-lowering effects in mice. Human APOC3 transgenic mice (Tg(APOC3)3707Bres, purchased from Jackson Laboratories, USA) with serum TG levels >2 mmol / L were randomly divided into groups of 8 mice each, half male and half female. Conjugate 3, conjugate 5, and a PBS blank control were administered to each group, respectively. Dosage was calculated based on body weight for all animals, and administration was done subcutaneously as a single dose. The dosage of each siRNA conjugate (based on siRNA content) was 3 mg / kg and 1 mg / kg mouse body weight, with an administration volume of 5 ml / kg. Each siRNA conjugate was provided in PBS aqueous solution, and the required concentration of the conjugate was calculated based on the dosage and administration volume. Another group of mice was administered 1×PBS at an administration volume of 5 ml / kg as a blank control.

[0648] Taking the administration date as day 1, blood samples (100 μL each) were collected from the orbital venous plexus of mice on days 1, 8, 15, 22, 29, 36, and 43. After collection, the blood was left at room temperature for 30 min, then centrifuged at 3000 rpm for 15 min at 4°C to obtain serum. The levels of total cholesterol (CHO) and triglycerides (TG) in the serum were further detected using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy).

[0649] Standardized blood lipid level = (blood lipid level in the test group after drug administration / blood lipid level in the test group before drug administration) × 100%.

[0650] The inhibition rate of blood lipid levels = (1 - blood lipid content of the test group after administration / blood lipid content of the test group before administration) × 100%.

[0651] Blood lipids refer to total cholesterol (CHO) or triglycerides (TG).

[0652] Figure 7A and Figure 7B Line graphs showing the changes in serum TG or serum CHO levels over time after administration of the siRNA conjugate or PBS of this disclosure are provided. Further, the inhibition rates of serum TG and serum CHO in mice at each time point after administration of the siRNA conjugate of this disclosure are summarized in Tables 10A and 10B below:

[0653] Table 10A Serum TG inhibition rate of siRNA conjugates in transgenic mice

[0654]

[0655] Table 10B Serum CHO inhibition rate of siRNA conjugates in transgenic mice

[0656]

[0657] analyze Figure 7A , Figure 7B As shown in Tables 10A and 10B, conjugates 3 and 5 significantly reduced serum TG and CHO levels in mice at different time points after administration. Furthermore, they maintained a high inhibitory effect throughout the 43-day experimental period. In particular, both conjugates 3 and 5 at a dose of 3 mg / kg exhibited excellent lipid-lowering effects in mice, with maximum inhibition rates of serum TG exceeding 88%; and maximum inhibition rates of serum CHO of 51.18% and 57.41%, respectively. These results indicate that the siRNA conjugates disclosed herein can effectively reduce lipid levels over a prolonged period, demonstrating excellent development potential in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms.

[0658] Experimental Example 14: The effect of siRNA conjugates on lowering blood lipids in mice (in vivo)

[0659] Human APOC3 transgenic mice (Tg(APOC3)3707Bres, purchased from Jackson Laboratories, USA) with serum TG levels >2 mmol / L were randomly divided into groups of six, half male and half female. Each group of mice was administered conjugate 1, conjugate 2, reference conjugate 1, and a PBS blank control, respectively. Dosage was calculated based on body weight for all animals, and administration was done subcutaneously as a single dose. The dosage (based on siRNA content) for each siRNA conjugate was 3 mg / kg and 1 mg / kg mouse body weight, with an administration volume of 5 ml / kg. Each siRNA conjugate was provided in PBS aqueous solution, and the required concentration of the conjugate was calculated based on the dosage and administration volume. An additional group of mice was administered 1×PBS to each mouse, with an administration volume of 5 ml / kg, serving as a blank control group.

[0660] Blood was collected from the orbital venous plexus of mice on days 1, 8, 15, and 22, with 100 μL collected each time. After collection, the blood was left at room temperature for 30 min, and then centrifuged at 3000 rpm for 15 min at 4°C to obtain serum. The levels of total cholesterol (CHO) and triglycerides (TG) in the serum were further detected using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy).

[0661] Standardized blood lipid level = (blood lipid level in the test group after drug administration / blood lipid level in the test group before drug administration) × 100%.

[0662] The inhibition rate of blood lipid levels = (1 - blood lipid content of the test group after administration / blood lipid content of the test group before administration) × 100%.

[0663] Blood lipids refer to total cholesterol (CHO) or triglycerides (TG).

[0664] Figure 8A and Figure 8B Line graphs showing the changes in serum TG or serum CHO levels over time after administration of the siRNA conjugate of this disclosure, the reference siRNA conjugate, or PBS are provided. Further, the inhibition rates of serum TG and serum CHO in mice at each time point after administration of the siRNA conjugate of this disclosure are summarized in Tables 11A and 11B below:

[0665] Table 11A Serum TG inhibition rate of siRNA conjugates in transgenic mice

[0666]

[0667] Table 11B Serum CHO inhibition rate of siRNA conjugates in transgenic mice

[0668]

[0669] Figure 8A , Figure 8B The results in Tables 11A and 11B indicate that conjugate 1 and conjugate 2 significantly reduced serum TG and CHO levels in mice at different time points after administration. Furthermore, they maintained a high inhibitory effect throughout the 22-day experimental period and showed a similar lipid-lowering effect to the corresponding reference conjugate 1 (excluding the stabilizing modified nucleotides).

[0670] In particular, both conjugate 1 and conjugate 2 at a dose of 3 mg / kg showed excellent lipid-lowering effects in mice, with maximum inhibition rates of serum TG exceeding 92%; and maximum inhibition rates of serum CHO of 57.5% and 54.9%, respectively. These results indicate that the siRNA conjugates disclosed herein can effectively reduce lipid levels over a prolonged period, showing excellent development potential in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms.

[0671] Experimental Example 15: Determination of the thermal dissociation temperature Tm of the double-chain

[0672] Each of the prepared siRNA1-siRNA7 and reference siRNA1-reference siRNA7 was prepared to a concentration of 0.02 mg / mL using 1XPBS buffer and used as the test solution. The test solution was added to a 10 mm path length quartz cuvette on an Agilent Cary 300UV spectrophotometer equipped with a thermal program. The temperature-absorbance curve was monitored at 260 nm, with a heating rate of 0.5 °C / min, starting at 20.0 °C and increasing to 95 °C. The double-strand thermal dissociation temperature Tm was calculated from the first derivative of the temperature-absorbance curve according to the spectrophotometer's instruction manual. The Tm values ​​are shown in Table 12 below.

[0673] Table 12 Double-chain thermal dissociation temperature Tm

[0674] siRNA Tm (°C) Reference siRNA Tm (°C) ΔTm (°C) siRNA1 80.97 Reference siRNA1 78.06 2.91 siRNA2 80.02 Reference siRNA2 78.12 1.90 siRNA3 79.07 Reference siRNA3 76.32 2.75 siRNA4 80.17 Reference siRNA4 77.98 2.19 siRNA5 78.22 Reference siRNA5 76.26 1.96 siRNA6 89.26 Reference siRNA6 87.93 1.33 siRNA7 90.07 Reference siRNA7 87.98 2.09

[0675] Among them, reference siRNA1-reference siRNA7 are siRNAs with the same base sequence as siRNA1-siRNA7, but at the positions of the nucleotides with stabilizing modifications in siRNA1-siRNA7, there are siRNAs without any modifications:

[0676] ΔTm value (siRNA to be tested) = Tm(siRNA) - Tm(reference siRNA).

[0677] As shown in Table 12, compared with the case where the nucleotides at the same position are unmodified, the double-stranded oligonucleotides and their conjugates containing the stabilized modified nucleotides disclosed in this invention have higher double-stranded thermal dissociation temperatures, which are increased by at least 1.33°C. Among them, siRNA1 has the largest increase, which is 2.91°C higher than the reference siRNA.

[0678] Some embodiments of this disclosure have been described in detail above. However, this disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical concept of this disclosure, various simple modifications can be made to the technical solutions of this disclosure, and these simple modifications all fall within the protection scope of this disclosure.

[0679] It should also be noted that the various specific technical features described in the above embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, this disclosure will not describe the various possible combinations separately.

[0680] Furthermore, various different embodiments of this disclosure can be combined in any way, as long as they do not violate the spirit of this disclosure, they should also be regarded as the content disclosed in this disclosure.

Claims

1. An siRNA comprising a sense strand and an antisense strand, the sense strand comprising a nucleotide sequence I, the antisense strand comprising a nucleotide sequence II, both nucleotide sequence I and nucleotide sequence II consisting of 19 nucleotides, each nucleotide in nucleotide sequence I and nucleotide sequence II being a modified or unmodified nucleotide, nucleotide sequence I and nucleotide sequence II being at least partially anticomplementary to form a double-stranded region, nucleotide sequence II being at least partially anticomplementary to a first nucleotide sequence, the first nucleotide sequence being a nucleotide sequence from the mRNA of apolipoprotein C3 gene expression. A nucleotide sequence of 19 nucleotides in length, with the 3rd or 5th nucleotide of the nucleotide sequence II being a stabilizing modified nucleotide in the direction from the 5' end to the 3' end. The stabilizing modified nucleotide refers to a nucleotide in which the 2' hydroxyl group of the ribose is replaced by a stabilizing modified group. Compared with siRNA in which the nucleotide at the corresponding position is an unmodified nucleotide, the siRNA containing the stabilizing modified nucleotide has increased thermal stability, and the steric hindrance of the stabilizing modified group is greater than that of the 2'-O-methyl group. The increased thermal stability of the siRNA means that the Tm of the siRNA increases by 0.1-6°C.

2. The siRNA as described in claim 1, wherein, Each of the stabilizing modification groups independently has the structure shown in -XR, where X is O, NR', S, or SiR'2; R is one of C2-C6 alkyl, substituted C2-C6 alkyl, C6-C8 aryl, or substituted C6-C8 aryl; each R' is independently one of H, C1-C6 alkyl, substituted C1-C6 alkyl, C6-C8 aryl, or substituted C6-C8 aryl, wherein the substituted C2-C6 alkyl, substituted C6-C8 aryl, or substituted C1-C6 alkyl refers to a group formed by substituting one or more hydrogen atoms of C2-C6 alkyl, C6-C8 aryl, or C1-C6 alkyl with a substituent selected from one or more of the following substituents: C1-C3 alkyl, C6-C8 aryl, C1-C3 alkoxy, halogen, oxoyl group, and thioyl group.

3. The siRNA as described in claim 1 or 2, wherein, The nucleotide sequence I is equal in length to the nucleotide sequence shown in SEQ ID NO:1, and differs by no more than one nucleotide; and the nucleotide sequence II is equal in length to the nucleotide sequence shown in SEQ ID NO:2, and differs by no more than one nucleotide. 5'-CAAUAAAGCUGGACAAGAZ1-3' (SEQ ID NO: 1); 5'-Z2UCUUGUCCAGCUUUAUUG-3'(SEQ ID NO:2), Wherein, Z1 is A, Z2 is U, nucleotide sequence I contains nucleotide Z3 corresponding to Z1, nucleotide sequence II contains nucleotide Z4 corresponding to Z2, and Z4 is the first nucleotide at the 5' end of the antisense strand; the nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2 includes the difference at the position of Z4, and Z4 is selected from A, G or C; Alternatively, the nucleotide sequence I is equal in length to the nucleotide sequence shown in SEQ ID NO:45, and differs by no more than one nucleotide, and the nucleotide sequence II is equal in length to the nucleotide sequence shown in SEQ ID NO:46, and differs by no more than one nucleotide: 5'-UUAAAAGGGACAGUAUUCZ5-3' (SEQ ID NO: 45); 5'-Z6GAAUACUGUCCCUUUUAA-3'(SEQ ID NO:46), Wherein, Z5 is U, Z6 is A, nucleotide sequence I contains nucleotide Z7 corresponding to Z5, nucleotide sequence II contains nucleotide Z8 corresponding to Z6, and Z8 is the first nucleotide at the 5' end of the antisense strand; the nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:46 includes the difference at the Z8 position, and Z8 is selected from G, C or U; Alternatively, the nucleotide sequence I is the same length as the nucleotide sequence shown in SEQ ID NO:105, and differs by no more than 3 nucleotides, and the nucleotide sequence II is the same length as the nucleotide sequence shown in SEQ ID NO:106, and differs by no more than 3 nucleotides: 5'-GGACAGUAUUCUCAGUGCZ9-3' (SEQ ID NO: 105); 5'-Z 10 GCACUGAGAAUACUGUCC-3'(SEQ ID NO:106), Where Z9 is U, Z 10 For A, the nucleotide sequence I contains a nucleotide Z at position Z9. 11 The nucleotide sequence II contains a position corresponding to Z. 10 nucleotide Z 12 The Z 12 It is the first nucleotide at the 5' end of the antisense strand; the nucleotide differences between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:106 include Z. 12 The difference in position, and Z 12 Selected from G, C, or U.

4. The siRNA according to any one of claims 1-3, wherein, The sense and antisense strands may be the same or different in length, with the sense strand being 19-23 nucleotides long and the antisense strand being 19-26 nucleotides long; and nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:3, and nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:

4. 5'-CAAUAAAGCUGGACAAGAZ3-3' (SEQ ID NO: 3); 5'-Z4UCUUGUCCAGCUUUAUUG-3'(SEQ ID NO:4), Z3 is selected from A, U, G or C, and Z4 is a complementary nucleotide to Z3; Alternatively, the nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:47, and the nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:48: 5'-UUAAAAGGGACAGUAUUCZ7-3' (SEQ ID NO: 47); 5'-Z8GAAUACUGUCCCUUUUAA-3'(SEQ ID NO:48), Z7 is selected from A, U, G or C, and Z8 is a complementary nucleotide to Z7; Alternatively, nucleotide sequence I is the nucleotide sequence shown in SEQ ID NO:107, and nucleotide sequence II is the nucleotide sequence shown in SEQ ID NO:108: 5'-GGACAGUAUUCUCAGUGCZ 11 -3'(SEQ ID NO:107); 5'-Z 12 GCACUGAGAAUACUGUCC-3'(SEQ ID NO:108), Among them, Z 11 Selected from A, U, G, or C, Z 12 Is with Z 11 Complementary nucleotides.

5. The siRNA according to any one of claims 1-4, wherein, The sense strand further contains nucleotide sequence III, and the antisense strand further contains nucleotide sequence IV. Each nucleotide of nucleotide sequence III and nucleotide sequence IV is independently one of non-fluorinated nucleotides and is not the stabilizing modification. The length of nucleotide sequence III is 1, 2, 3, or 4 nucleotides. The length of nucleotide sequence IV is equal to that of nucleotide sequence III, and nucleotide sequence IV and nucleotide sequence III are substantially anticomplementary or completely anticomplementary. Nucleotide sequence III is attached to the 5' end of nucleotide sequence I, and nucleotide sequence IV is attached to the 3' end of nucleotide sequence II. Nucleotide sequence IV is substantially anticomplementary or completely anticomplementary to a second nucleotide sequence, which is a nucleotide sequence in the mRNA expressed by the APOC3 gene that is adjacent to the first nucleotide sequence and has the same length as nucleotide sequence IV.

6. The siRNA according to any one of claims 1-5, wherein, The siRNA further contains an oligonucleotide sequence V, each nucleotide of which is independently one of non-fluorinated modified nucleotides and is not the stabilizing modified nucleotide. The nucleotide sequence V is 1 to 3 nucleotides in length and is attached to the 3' end of the antisense strand to form the 3' overhang of the antisense strand.

7. A pharmaceutical composition comprising the siRNA as described in any one of claims 1-6 and a pharmaceutically acceptable carrier.

8. An siRNA conjugate comprising the siRNA of any one of claims 1-6 and a conjugate group conjugated to the siRNA, the conjugate group comprising a linker and a pharmaceutically acceptable targeting group, wherein the siRNA, the linker and the targeting group are covalently or non-covalently linked in sequence, and each of the targeting groups is selected from ligands capable of binding to cell surface receptors.

9. The siRNA conjugate of claim 8, wherein the conjugate has the structure shown in formula (308): in, n1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4; each m1, m2, or m3 is independently an integer selected from 2 to 10; R 10 R 11 R 12 R 13 R 14 or R 15 Each is independently H, or selected from the group consisting of C1-C. 10 Alkyl, C1-C 10 Halogenated alkyl groups and C1-C 10 Alkoxy; R3 is a group with the structure shown in formula A59: Where E1 represents OH, SH, or BH2, and Nu represents siRNA. R2 is a straight-chain alkylene group with a length of 1-20 carbon atoms, wherein one or more carbon atoms are optionally replaced by any one or more groups selected from the group consisting of: C(O), NH, O, S, CH=N, S(O)2, C2-C 10 alkenyl, C2-C 10 Ethyne group, C6-C 10 aryl, C3-C 18 Heterocyclic groups and C5-C 10 Heteroaryl; and wherein R2 may optionally have any one or more substituents from the group consisting of: C1-C 10 Alkyl, C6-C 10 Aryl, C5-C 10 heteroaryl, C1-C 10 Halogenated alkyl, -OC1-C 10 Alkyl, -OC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-OH, -OC1-C 10 Halogenated alkyl, -SC1-C 10 Alkyl, -SC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated alkyl groups, halogenated substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2,-N(C1-C) 10 Alkyl) (C1-C 10 alkyl), -NH(C1-C 10 Alkyl), -N(C1-C 10 Alkyl) (C1-C 10 alkylphenyl), -NH(C1-C 10 Alkylphenyl), cyano, nitro, -CO2H, -C(O)O(C1-C 10 Alkyl), -CON (C1-C) 10 Alkyl) (C1-C 10 Alkyl), -CONH (C1-C) 10 Alkyl groups, -CONH2, -NHC(O) (C1-C) 10 alkyl), -NHC(O)(phenyl), -N(C1-C 10 Alkyl)C(O)(C1-C 10 Alkyl), -N(C1-C 10 alkyl)C(O)(phenyl), -C(O)C1-C 10 Alkyl, -C(O)C1-C 10 Alkylphenyl, -C(O)C1-C 10 Haloalkyl, -OC(O)Cl-C 10 Alkyl group, -SO2 (C1-C) 10 alkyl), -SO2 (phenyl), -SO2 (C1-C 10 Halogenated alkyl groups), -SO2NH2, -SO2NH (C1-C 10 alkyl), -SO2NH (phenyl), -NHSO2 (C1-C 10 Alkyl), -NHSO2 (phenyl) and -NHSO2 (C1-C) 10 (halogenated alkyl); Each L1 is independently a straight-chain alkylene group with a length of 1-70 carbon atoms, wherein one or more carbon atoms are optionally replaced by any one or more groups selected from the group consisting of: C(O), NH, O, S, CH=N, S(O)2, C2-C 10 alkenyl, C2-C 10 Ethyne group, C6-C 10 aryl, C3-C 18 Heterocyclic groups and C5-C 10 Heteroaryl; and wherein L1 may optionally have any one or more substituents from the group consisting of: C1-C 10 Alkyl, C6-C 10 Aryl, C5-C 10 heteroaryl, C1-C 10 Halogenated alkyl, -OC1-C 10 Alkyl, -OC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-OH, -OC1-C 10 Halogenated alkyl, -SC1-C 10 Alkyl, -SC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated alkyl groups, halogenated substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2,-N(C1-C) 10 Alkyl) (C1-C 10 alkyl), -NH(C1-C 10 Alkyl), -N(C1-C 10 Alkyl) (C1-C 10 alkylphenyl), -NH(C1-C 10 Alkylphenyl), cyano, nitro, -CO2H, -C(O)O(C1-C 10 Alkyl), -CON (C1-C) 10 Alkyl) (C1-C 10 Alkyl), -CONH (C1-C) 10 Alkyl groups, -CONH2, -NHC(O) (C1-C) 10 alkyl), -NHC(O)(phenyl), -N(C1-C 10 Alkyl)C(O)(C1-C 10 Alkyl), -N(C1-C 10 alkyl)C(O)(phenyl), -C(O)C1-C 10 Alkyl, -C(O)C1-C 10 Alkylphenyl, -C(O)C1-C 10 Haloalkyl, -OC(O)Cl-C 10 Alkyl group, -SO2 (C1-C) 10 alkyl), -SO2 (phenyl), -SO2 (C1-C 10 Halogenated alkyl groups), -SO2NH2, -SO2NH (C1-C 10 alkyl), -SO2NH (phenyl), -NHSO2 (C1-C 10 Alkyl), -NHSO2 (phenyl) and -NHSO2 (C1-C) 10 (halogenated alkyl); The site indicates the covalently linked group; each M1 is independently selected from one of the ligands that have affinity for the desialylate glycoprotein receptor on the surface of mammalian liver cells.

10. Use of the siRNA of any one of claims 1-6, and / or the pharmaceutical composition of claim 7, and / or the siRNA conjugate of claim 8 or 9 in the preparation of a medicament for treating and / or preventing diseases or symptoms associated with the mRNA level of APOC3 gene expression.

Images