Application of specific antisense oligonucleotide in preparation of medicine for treating neuronal intracellular inclusion body disease

By designing specific antisense oligonucleotides to target the GGC repeat amplification in the 5'UTR region of the NOTCH2NLC gene, the problem of unclear pathogenesis of NIID was solved, enabling effective treatment of NIID, restoring nucleolar function and reducing genomic instability.

CN120989083APending Publication Date: 2025-11-21THE FIRST AFFILIATED HOSPITAL OF ZHENGZHOU UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511263079.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-05
Publication Date
2025-11-21

AI Technical Summary

Technical Problem

There is currently no effective treatment for intranuclear inclusion body disease of neurons, especially for NIID caused by abnormal amplification of the GGC repeat sequence in the 5'UTR region of the NOTCH2NLC gene, and its pathogenic mechanism is unclear.

Method used

The designed specific antisense oligonucleotide (ASO-GGC) consists of 11 nucleotides, with the 6th site being DNA and the remainder being RNA modified with 2′-O-Me. All sites are modified with phosphate thioester. It targets the 5′-UTR sequence of the NOTCH2NLC gene to target GGC repeat amplification, restore nucleolar function, and reduce genomic instability.

Benefits of technology

It significantly improves gene damage and cellular senescence in NIID models, restores nucleolar function, reduces genomic instability, and rescues NIID pathological phenotypes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120989083A_ABST
    Figure CN120989083A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to application of specific antisense oligonucleotide to preparation of medicine for treating neuronal intracellular inclusion body disease. The invention provides a specific antisense oligonucleotide which is complementary with a 5 '-UTR (Untranslated Region) sequence of a NOTCH2NLC gene. The specific antisense oligonucleotide is composed of 11 nucleotides. The invention provides an application of specific antisense oligonucleotide in preparation of a medicine for treating a neuronal intracellular inclusion body disease. The invention provides a medicine for treating a neuron intracellular inclusion body disease. The medicine contains specific antisense oligonucleotide. Based on an in-vitro cell transfection model of the NIID and a patient-derived brain organ, the potential pathogenic mechanism of the NIID caused by NOTCH2 NLC GGC repeated amplification mutation is determined, specific antisense oligonucleotides (ASOs) are designed for a GGC repeated amplification sequence, and the ASOs are found to be capable of saving the pathological phenotype of the NIID.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of specific antisense oligonucleotides in the preparation of drugs for treating neuronal intranuclear inclusion body diseases. Background Technology

[0002] Neuronal intranuclear inclusion disease (NIID) is a progressive neurodegenerative disease with clinical manifestations encompassing a variety of symptoms, including cognitive impairment, dystonia, and ataxia. Studies have shown that abnormal amplification of the GGC repeat sequence (repetition count > 60) in the 5'UTR region of the NOTCH2NLC gene can lead to NIID. GGC repeat amplification can induce the translation of the toxic protein polyG from the upstream open reading frame (uORF), which is considered the main pathogenic mechanism of NIID, and currently there is no effective treatment.

[0003] In recent years, the clinical potential of antisense oligonucleotides (ASOs) in the treatment of rare neurological diseases has gradually emerged. For example, in spinal muscular atrophy, myotonic dystrophy, and ALS, and in a model of fragile X-related tremor / ataxia syndrome (FXTAS) caused by GGC repeat mutations, sterically hindered ASOs targeting GGC repeat sequences can effectively reduce the production and aggregation of FMRpolyG and show significant therapeutic effects (Derbis M, Konieczny P, Walczak A, Sekrecki M, Sobczak K. Quantitative Evaluation of Toxic Polyglycine Biosynthesis and Aggregation in Cell Models Expressing Expanded CGGRepeats. Front Genet. 2018; 9:216. doi:10.3389 / fgene.2018.00216; Shah S, Sharp KJ, Raju Ponny S, et al. Antisense oligonucleotide rescue of CGG expansion-dependent FMR1). mis-splicing in fragile Summary of the Invention

[0004] This invention found that NPM1 dysfunction in NIID models can lead to increased gene damage and abnormal 3D chromatin structure; ASO therapy targeting GGC repeat amplification rescued related phenotypes in the disease model, suggesting its potential application value in NIID treatment.

[0005] Research by the inventors' team shows that polyG tends to form inclusion bodies in the cell nucleus, which can induce nucleocytoplasmic translocation of NPM1, increasing nucleolar stress. NPM1 plays an important role in DNA damage repair and maintaining 3D genome structure. Under physiological conditions, NPM1 can be recruited to DNA damage sites and participate in the repair process. Its dysfunction may lead to gene repair defects and increased genome instability, ultimately accelerating cellular senescence. Furthermore, as a nucleolar protein, NPM1 can interact with the chromatin structural protein CTCF, anchoring chromatin around the nucleolus to regulate gene expression activity. CTCF and RAD21 synergistically maintain 3D chromatin structure, promoting the formation of chromatin loops and topologically associated domains (TADs) by binding to specific chromatin sites. This evidence suggests that polyG may induce NPM1 dysfunction and trigger DNA damage and 3D chromatin structural abnormalities in NIIDs, but the specific mechanism remains unclear.

[0006] To achieve the objectives of this invention, the following technical solution is adopted:

[0007] First, this invention utilizes an in vitro cell transfection model of NIID and patient-derived brain organoids (carrying the NOTCH2NLCGGC repeat mutation) to explore the potential pathogenic mechanism of NIID caused by the NOTCH2NLC GGC repeat amplification mutation, combining high-throughput chromatin conformation capture technology and single-cell sequencing technology. The results show that polyG plays an important role in the pathological process of NIID by disrupting nucleolar function and NPM1 homeostasis, inducing gene damage and cellular senescence.

[0008] Then, specific antisense oligonucleotides (ASOs) targeting the GGC repeat amplification sequence were designed, and their therapeutic effects on NIID were investigated in in vitro cell transfection models and patient-derived brain organoids. The results showed that ASO-GGC significantly improved gene damage and aging in the NIID model, restored nucleolar function, reduced genomic instability, and promoted neuronal development. ASO-GGC consists of 11 nucleotides, with the 6th site being DNA, and the remaining sites being RNA modified with 2′-O-Me. All sites are also modified with phosphate thioester, and the sequence is 5′-mC*mC*mG*mC*mC*dG*mC*mC*mG*mC*mC-3′ (11 nt, m representing 2′-O-Me modification), as shown in SEQ ID NO:1.

[0009] Based on the above, the first aspect of the present invention provides a specific antisense oligonucleotide, which is complementary to the 5'-UTR sequence of the NOTCH2NLC gene. The specific antisense oligonucleotide consists of 11 nucleotides; further, the 6th site of the specific antisense oligonucleotide is DNA, the remaining sites are RNA and modified with 2′-O-Me, and all sites are modified with phosphate thioester. In a further embodiment, the sequence of the specific antisense oligonucleotide is shown in SEQ ID NO:1.

[0010] A second aspect of the present invention provides the use of specific antisense oligonucleotides in the preparation of medicaments for treating neuronal intranuclear inclusion body diseases.

[0011] A third aspect of the present invention provides a medicament for treating neuronal intranuclear inclusion body disease, the medicament containing a specific antisense oligonucleotide.

[0012] The beneficial effects of this invention are as follows:

[0013] Based on an in vitro cell transfection model of NIID and patient-derived brain organoids (carrying NOTCH2NLC GGC repeat mutations), this invention clarifies the potential pathogenic mechanism of NIID caused by NOTCH2NLC GGC repeat amplification mutations, and designs specific antisense oligonucleotides (ASOs) targeting the GGC repeat amplification sequence, discovering that ASOs can rescue the pathological phenotype of NIID. Attached Figure Description

[0014] Figure 1PolyG expansion induces protein aggregation, disrupts nucleolar organization, and triggers a stress response. (A) Potential IDRs were predicted in the polyG sequence using bioinformatics methods; a score greater than 0.5 indicated disorder. (B) The viability of HEK-293T cells expressing 20×-polyG or 90×-polyG was detected at different time points after transfection (ANOVA). (C) Immunofluorescence showed that 90×-polyG formed aggregates and affected the distribution of nucleolar proteins NPM1 and FBL. Scale bar: 5 μm. (D) Western blot analysis of NPM1 and FBL in HEK-293T cells of the control, 20×-polyG, and 90×-polyG groups was performed using protein capillary electrophoresis. (EF) Violin plots show the relative expression levels of NPM1 and FBL in HEK-293T cells of the blank control, 20×-polyG, and 90×-polyG groups (ANOVA). (G) Immunoblot analysis of NPM1 and FBL in brain organoids of the GGCexp (extended GGC) and GGCnor (normal GGC) groups using protein capillary electrophoresis. (HI) Violin plot showing the relative expression levels of NPM1 and FBL in brain organoids of the GGCexp and GGCnor groups. Paired Student's t-test. (J) Immunofluorescence distribution of 90×-polyG, NPM1, and DAPI in HEK-293T cells at different time points. Scale bar: 5 μm. (K) Quantitative analysis of the size of inclusion bodies formed by 90×-polyG in HEK-293T cells at different time points. (L) Immunofluorescence showing colocalization of 90×-polyG with HSP70, while not observed in 20×-polyG. Scale bar: 5 μm. (MN) Immunoblot analysis and relative expression analysis (ANOVA) of HSP70 in the blank control group, 20×-polyG group, and 90×-polyG group. (OP) Immunoblotting and relative expression analysis of HSP70 in brain organoids from the GGCexp and GGCnor groups. Paired Student's t-test. (Q) Capillary electrophoresis verification of siNPM1 inhibition of NPM1 expression in HEK-293T cells. Paired Student's t-test. (R) Immunofluorescence showing co-localization of 90×-polyG with rRNA after NPM1 knockdown. Scale bar: 5 μm.

[0015] Figure 2Development of 3D brain organoids (3DCOs) and the effect of PolyG expansion on nucleolar proteins. (A) The developmental process of 3DCOs begins with induced pluripotent stem cells (iPSCs), successively undergoing the embryoid stage and the neuroepithelial development stage, ultimately forming mature 3DCOs. Scale bar: 100 μm. (BC) Immunofluorescence characterization of 3DCOs: the inner layer of the pseudoventricle was labeled with PAX6 (neural stem cells), the middle layer with CTIP2 (interneurons), and the outer layer with TUJ1 (neurons). Scale bar: 100 μm. (DE) Immunofluorescence showed that compared with the GGCnor (normal GGC) group, the number of p62 and ubiquitin-positive inclusion bodies in the 3DCOs of the GGCexp (expanded GGC) group was significantly increased. Scale bar: 10 μm. Two-tailed paired Student's t-test. (FH) Immunoblotting results showed that with the gradual increase of mCherry / 90×-polyG expression level in HEK-293T cells, the expression of nucleolar protein NPM1 also increased significantly. n=2; ANOVA analysis. (I) 90×-polyG co-localized with rRNA, while 20×-polyG did not exhibit this phenomenon.

[0016] Figure 3 PolyG expansion affects the expression and distribution of chromatin structural proteins such as CTCF and RAD21. (A) Immunofluorescence shows that 90×-polyG reduces the fluorescence intensity of CTCF and affects the distribution of nucleolar protein NPM1. Scale bar: 5 μm. (B) Immunofluorescence shows that 90×-polyG reduces the fluorescence intensity of RAD21 and affects the distribution of nucleolar protein NPM1. Scale bar: 5 μm. (C) Western blot analysis of CTCF and RAD21 in HEK-293T cells of the blank control group, 20×-polyG group, and 90×-polyG group using protein capillary electrophoresis. (DE) Violin plots show the relative expression levels (ANOVA) of CTCF and RAD21 in the blank control group, 20×-polyG group, and 90×-polyG group. (F) Western blot analysis of CTCF and RAD21 in brain organoids of the GGCexp and GGCnor groups using protein capillary electrophoresis. (GH) Violin plots show the relative expression levels of CTCF and RAD21 in brain organoids from the GGCexp and GGCnor groups. Two-tailed paired Student's t-test. (I) Starting from the medial border of the pseudoventricle in the brain organoid, the migration ability of RAD21-positive cells was significantly reduced in the GGCexp group, while the fluorescence intensity of TUJ1 was weakened. Scale bar: 20 μm.

[0017] Figure 4Effects of Polyglycine (PolyG) amplification on CTCF, RAD21, and neuronal development. (AC) Immunoblotting results showed that the protein expression levels of CTCF and RAD21 gradually decreased with increasing culture time of HEK-293T cells expressing 90×-polyG. (D) Immunofluorescence showed that neural stem cells highly expressing PAX6 also showed high expression of RAD21 in 3D brain organoids (3DCOs). Scale bar: 20 μm. (E) Immunofluorescence showed that the distribution of CTCF in 3DCOs of the GGCexp (extended GGC) group was more diffuse compared with the GGCnor (normal GGC) group. Scale bar: 5 μm. (F) Immunoblotting results showed that the expression of the neuronal marker TUJ1 was significantly reduced in 3DCOs of the GGCexp group compared with the GGCnor group. Two-tailed paired Student's t-test.

[0018] Figure 5 HI-C sequencing reveals polyG amplification leading to changes in 3D chromatin structure. (A) Log-log plot of genomic distance versus contact frequency. Curves represent contact frequencies for the GGCnor and GGCexp groups, respectively. Best-fit lines are shown in the range of 100kb to 2Mb. (B) Pairwise Pearson correlation analysis between Hi-C samples under different conditions. Scatter plots show the log2-normalized contact frequencies of sample pairs at 5kb resolution. Correlation calculations are based on contacts with an interval of at least 5kb and no more than 200kb. (C) Multiple bin sizes meet the criterion that >80% of bins have at least 1,000 contact reads. (D) Log2 ratio of contact frequencies between the GGCexp and GGCnor groups (log2(Obs / Control)). (E) Compartmental transitions of brain organoids between the GGCexp and GGCnor groups. (F) Representative Hi-C maps of brain organoids from the GGCexp and GGCnor groups, showing the compartment, TAD (topological association domain), and loop (chromatin loop) from left to right. Blue arrows indicate loop locations. Insulation scores of bins corresponding to the middle regions in (G) and (F) figures. Red arrows indicate TAD boundaries, and green arrows indicate TAD interiors.

[0019] Figure 6PolyG amplification induces DNA damage and cellular senescence. (A) Immunofluorescence shows that 90×-polyG promotes the expression of p-γH2AX (a DNA damage marker). Scale bar: 5 μm. (B) Western blot analysis of p-γH2AX in HEK-293T cells of the control, 20×-polyG, and 90×-polyG groups using protein capillary electrophoresis. (C) Violin plot showing the relative expression levels of p-γH2AX in the control, 20×-polyG, and 90×-polyG groups (ANOVA). (DE) Immunofluorescence shows that the proportion of p-γH2AX-positive cells in the GGCexp group was significantly higher than that in the GGCnor group. Scale bar: 5 μm. (F) Western blot analysis of p-γH2AX in brain organoids of the GGCexp (extended GGC) and GGCnor (normal GGC) groups using protein capillary electrophoresis. (G) Violin plot showing the relative protein expression of p-γH2AX in brain organoids of the GGCexp and GGCnor groups. Horizontal paired Student's t-test. (H) Single-cell sequencing GSVA analysis showed significant activation of DNA damage response pathways in brain organoids in the GGCexp group (compared to the GGCnor group). (I) Clustering tree analysis of transcriptome sequencing data from the blank control group, 20×-polyG group, and 90×-polyG group showed that the blank control group and 20×-polyG group clustered into one group, while the 90×-polyG group was in a separate group. (JK) Gene function enrichment analysis showed that differentially expressed genes in the 90×-polyG group were significantly enriched in aging-related pathways compared to the control group and 20×-polyG group (blue box). (L) β-galactosidase staining of HEK-293T cells and brain organoids (cellular senescence markers). (MN) Statistical analysis showed a significant increase in the blue precipitate area of ​​β-galactosidase staining in HEK-293T cells and brain organoids. Statistical analysis of HEK-293T cells was based on one-way ANOVA, and statistical analysis of brain organoids was based on horizontal two-tailed paired Student's t-test. (O) Single-cell sequencing GSVA analysis showed that DNA damage-induced senescence pathways were significantly activated in brain organoids of the GGCexp group (compared to the GGCnor group).

[0020] Figure 7 Polyglycine (PolyG) expansion induces DNA damage response and activation of aging-related pathways.

[0021] (A) GSVA analysis showed that, compared with the GGCnor (normal GGC) group, the GGCexp (extended GGC) group had significantly increased DNA damage response pathway activity in all cell types of 3D brain organoids (3DCOs). (B) Principal component analysis (PCA) based on batch RNA-seq data from the control, 20×-polyG, and 90×-polyG groups. Each point represents a sample, and the results showed significant separation in gene expression levels among the groups. (C) Venn diagram of differentially expressed genes (DEGs) from batch RNA-seq data of the control, 20×-polyG, and 90×-polyG groups. (D) Gene enrichment analysis revealed that DEGs were not significantly enriched in aging-related pathways between the 20×-polyG and control groups. (E) Heatmap analysis of differentially expressed genes. Each row represents a DEG, and each column represents a sample. Colors indicate gene expression levels (red: high expression, blue: low expression). Gene clustering results showed that the 20×-polyG group had high similarity to the control group, while the 90×-polyG group exhibited a unique gene expression pattern. (F) Single-cell GSVA analysis showed that, compared with the GGCnor group, the GGCexp group had significantly higher scores for DNA damage-induced senescence pathways among the major cell types of 3DCOs. Abbreviations: NPCs: neural progenitor cells; NBs: neuroblasts; MNs: mature neurons; iMNs: immature neurons; GNs: glutamatergic neurons; RGCs: radial glial cells; OPCs: oligodendrocyte precursor cells; MSCs: myelinating Schwann cells. Figure 8Toxicity assessment of ASO-GGC and its effects on neuronal development. (A) Immunofluorescence showed that ASO-GGC-cy3 (200 nM) efficiently entered HEK-293T cells via transfection (top panel) and diffused into the interior of 3D brain organoids (3DCOs) (bottom panel). Scale bar: 20 μm. (B) HEK-293T cells were transfected with ASO-ctr and ASO-GGC (100 nM and 200 nM) using transfection reagents, with a control group transfected with only the reagents. Cell viability assays showed that ASO treatment did not significantly affect cell viability (ANOVA). (CD) Immunofluorescence showed that treatment with ASO-ctr (200 nM) and ASO-GGC (200 nM) did not increase the levels of necrosis (red fluorescence) or apoptosis (green fluorescence) in HEK-293T cells. Scale bar: 100 μm (ANOVA). (E) Immunofluorescence showed that, compared with ASO-ctr, ASO-GGC promoted the aggregation and distribution of CTCF in 3DCOs of the GGCexp (extended GGC) group and improved neuronal development. Scale bar: 5 μm. (F) Immunoblot results showed that ASO-GGC significantly increased the expression level of the neuronal marker TUJ1 in 3DCOs of the GGCexp group. Two-tailed paired Student's t-test.

[0022] Figure 9 ASO-GGC reduces polyG biosynthesis. (A) Immunoblotting results showed that, compared with ASO-ctr, ASO-GGC significantly reduced the translation rate of mCherry in HEK-293T cells. (BC) Immunofluorescence showed that, compared with ASO-ctr, ASO-GGC significantly reduced the proportion of 90×-polyG inclusion bodies. Scale bar: 50 μm. (DE) qPCR results showed that, compared with ASO-ctr, ASO-GGC significantly increased the transcriptional levels of mCherry and NOTCH2NLC in HEK-293T cells. (FG) Immunoblotting results showed that ASO-GGC had no significant effect on the expression of endogenous NOTCH2NLC protein. (HI) Immunofluorescence showed that ASO-GGC significantly reduced the proportion of p62 and ubiquitin-positive inclusion bodies in brain organoids in the GGCexp group. Scale bar: 5 μm. (J) qPCR results showed that ASO-GGC significantly increased the transcriptional level of NOTCH2NLC in brain organoids in the GGCexp group. (F) & (K) Western blot results showed the effect of ASO-GGC on the expression of target proteins. All statistical analyses were performed using horizontally paired Student's t-tests, with ASOs treatment concentration of 200 nM.

[0023] Figure 10ASO-GGCs alleviated polyG amplification-induced nucleolar stress and cellular senescence. (AC) Western blot results showed that, compared with ASO-ctr, ASO-GGCs significantly reduced the levels of NPM1 and p-γH2AX in HEK-293T cells expressing 90X-polyG. (DE) β-galactosidase staining showed that ASO-GGCs significantly reduced the blue precipitate in HEK-293T cells expressing 90X-polyG. Scale bar: 50 μm. (FH) Western blot results showed that, compared with ASO-ctr, ASO-GGCs significantly reduced the protein levels of NPM1 and p-γH2AX in brain organoids in the GGCexp group. (IJ) Immunofluorescence showed that, compared with ASO-ctr, ASO-GGCs significantly reduced the proportion of p-γH2AX-positive cells in brain organoids in the GGCexp group. Scale bar: 5 μm. (KL)β-galactosidase staining showed that ASO-GGC significantly reduced blue precipitate in brain organoids in the GGCexp group. Scale bar: 20 μm. All statistical analyses were performed using a horizontally paired two-tailed Student's t-test. The ASO treatment concentration was 200 nM.

[0024] Figure 11 Single-cell sequencing revealed that ASO-GGC reduced gene damage and senescence levels and improved neuronal function in GGCexp brain organoids. (A) uMAP plot shows six types of neurons in ASO-ctr and ASO-GGC-treated GGCexp brain organoids. (B) Volcano plot shows differentially expressed genes (DEGs) between ASO-ctr and ASO-GGC-treated brain organoids. For ease of presentation, differentially expressed genes with |log2FC|<3.5 and -log10p<60 were retained. (CD) Functional enrichment analysis of differentially expressed genes revealed that they were significantly enriched in pathways such as ribosome formation and polypeptide elongation, and were mainly involved in biological processes such as translation and macromolecular biosynthesis. (EF) GSVA analysis showed that ASO-GGC significantly reduced the activity of DNA damage response pathways and DNA damage-induced senescence pathways in GGCexp brain organoids. (G) Nine gene modules were identified in the above single-cell data by hdWGCNA analysis. (H) Comparison revealed that four gene modules—pink (90 genes), blue (929 genes), red (231 genes), and turquoise (1913 genes)—were most associated with ASO-GGC treatment. (IJ) Gene function enrichment analysis showed that the above four gene modules were significantly enriched in pathways such as nervous system development, neuronal projection, axonogenesis, and neuronal migration.

[0025] Figure 12Hi-C sequencing reveals the rescue effect of ASO-GGC on the chromatin three-dimensional structure of 3D brain organoids. (A) Double logarithmic plot of genomic distance versus contact frequency. The curve shows the contact frequency of ASO-GGC-treated 3D brain organoids (3DCOs). The best-fit line is shown in the range of 100kb to 2Mb. (B) Paired Pearson correlation analysis between Hi-C samples under different treatment conditions. The scatter plot shows the log2-normalized contact frequency of sample pairs at 5kb resolution. Correlation calculations used contact pairs with an interval of at least 5kb but not exceeding 200kb. The results show that ASO-GGC-treated 3DCOs and the GGCnor (normal GGC) group showed higher Pearson correlation coefficients compared to the ASO-ctr group. (C) Multiple bin sizes meet the criterion of "more than 80% of bins having at least 1000 contact reads".

[0026] Figure 13 Single-cell sequencing reveals the effects of ASO-GGC on DNA damage and aging pathways in 3D brain organoids. (A) uMAP plot shows the distribution of cell types in 3D brain organoids (3DCOs) treated with ASO-ctr and ASO-GGC. (B) Bubble plot shows the expression levels of marker genes for each cell type. Color depth indicates expression intensity, and bubble size indicates the proportion of cells expressing the gene. (C) Heatmap of marker genes for each cell type, showing their specific expression patterns. Each row represents one gene, and each column represents one cell type. Color indicates gene expression level (yellow: high expression, purple: low expression). (DE) GSVA analysis showed that, compared with the ASO-ctr group, the scores of DNA damage response pathway and DNA damage-induced aging pathway were significantly reduced in the main cell types of 3DCOs treated with ASO-GGC.

[0027] Figure 14ASO-GGC restored CTCF and RAD21 expression and improved 3D chromatin structure. (AC) Immunoblotting results showed that, compared with ASO-ctr, ASO-GGC significantly increased the protein levels of CTCF and RAD21 in HEK-293T cells expressing 90X-polyG. (DF) Immunoblotting results showed that, compared with ASO-ctr, ASO-GGC significantly increased the protein levels of CTCF and RAD21 in brain organoids of the GGCexp group. (G) Log2 ratio of contact frequency between the ASO-GGC treatment group and the GGCexp group (log2(Obs / Control)). (H) Compartment switching of brain organoids in the ASO-GGC treatment group relative to the GGCexp group. (I) Representative Hi-C map of brain organoids in the ASO-GGC treatment group, showing the compartment, TAD (topological association domain), and loop (chromatin loop) from left to right. Blue arrows indicate loop locations. (J) Insulation score of bins corresponding to the middle region of Figure (I). The red arrows indicate the boundaries of the TAD, and the green arrows indicate the interior of the TAD. Detailed Implementation

[0028] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of the embodiments of this invention will be clearly described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0029] The study described in this example was approved by the Ethics Committee of the First Affiliated Hospital of Zhengzhou University.

[0030] Statistical methods used in the examples:

[0031] Image analysis is automated or blinded. GraphPad Prism (V9.0.0) analyzes the data, displaying the mean ± SEM or violin plot. Statistical methods include t-tests and ANOVA (Tukey / Dunnett corrected). Significance markers: *: P<0.05, **: P<0.01, ***: P<0.001, ****: P<0.0001. Unless otherwise stated, the sample size N = 3.

[0032] The NIID disease models in the examples include a HEK293T cell transfection model (HEK293T cell model transfected with GGC repeat sequences) and brain organoids derived from NIID patients.

[0033] Example 1

[0034] 1. PolyG damages nucleolar structure and function.

[0035] We first discovered that polyG possesses a potential IDR (intrinsic disorder region) through bioinformatics prediction methods (PONDR; https: / / www.pondr.com / , referencing Romero P, Obradovic Z, Li X, Garner EC, Brown CJ, Dunker AK. Sequence complexity of disordered protein. Proteins. Jan 1 2001; 42(1):38-48. doi:10.1002 / 1097-0134(20010101)42:1<38::aid-prot50>3.0.co; 2-3) Figure 1A), this feature is similar to the pathogenic repeating polypeptides produced by repeating mutations in the FMR1 and C9orf72 genes previously reported (Asamitsu S, Yabuki Y, Ikenoshita S, Kawakubo K, Kawasaki M, Usuki S, et al. CGG repeat RNA G-quadruplexes interact with FMRpolyG to cause neuronaldysfunction in fragile X-related tremor / ataxia syndrome. Sci Adv. 2021 Jan 13;7(3):eabd9440.doi:10.1126 / sciadv.abd 9440.). Although our previous studies found that pathogenic polyG can induce nucleolar stress characterized by NPM1 nucleoplasmic ectopia (Fan Y, Li MJ, Yang J, Li SJ, Hao XY, Li JD, et al. GGC repeat expansion in NOTCH2NLC induces dysfunction in ribosome biogenesis and translation. Brain. 2023 Aug 1; 146(8):3373-3391. doi:10.1093 / brain / awad058.), the specific effects of polyG on nucleolar structure and function remain unclear. The nucleolus consists of an NPM1-rich fibrous center (FC) and an FBL-rich granular component (GC), among which the NPM1 IDR is key to maintaining nucleolar liquid-liquid phase separation (LLPS) homeostasis and structural integrity. Therefore, we hypothesize that pathological polyG carrying IDR may disrupt nucleolar structure and function.

[0036] 1.1 HEK-293T cells were transfected with 20×- and 90×-polyG overexpression plasmids.

[0037] To verify this hypothesis, we transfected HEK-293T cells with constructed 20×- and 90×-polyG overexpression plasmids. First, we constructed two overexpression plasmids carrying the 5'-UTR and partial exon 1 sequences of the NOTCH2NLC gene, each containing 20 and 90 CGG repeat sequences, respectively, and fused them with mCherry for expression (polyG-mCherry), thus creating the 20×- and 90×-polyG overexpression plasmids. Simultaneously, a blank plasmid expressing only mCherry was constructed as a negative control. Then, HEK293T cells were cultured in high-glucose DMEM medium containing 1% L-glutamine (Lonza), 10% fetal bovine serum, and 1% penicillin / streptomycin (37°C, 5% CO2). When the cell density reached approximately 80% confluence, the 20×- and 90×-polyG overexpression plasmids were transfected into the cells to obtain a HEK293T cell model transfected with GGC repeat sequences.

[0038] The overexpression plasmid is constructed by using the 5'-UTR of the human NOTCH2NLC gene containing 20 or 90 GGC repeat sequences and a partial exon 1 sequence (ATGTGGATCTGCCCA(GGC)). n GACCGAGAAGATGCCCGCCCTGCGCCGCTCTGCTGTGGGCGCTGCTGGCGCTCTGGCTGTGCTGCGCGCACCCCC GCGC, n=20 or 90; SEQ ID NO:2, SEQ ID NO:3) were cloned into the pcDNA3.1 vector and fused with mCherry, which had its ATG start codon deleted. The constructed overexpression plasmid started with the ATG in the uN2C ORF (translation region formed after the NTCH2NLC mutation) and ended with the first stop codon.

[0039] 1.2 CCK8 Experiment in Cell Models

[0040] CCK8 assays on HEK293T cell models revealed that 90×-polyG significantly inhibited cell viability compared to 20×-polyG. Figure 1 B), suggesting its potential cytotoxicity. Further experiments showed that 90×-polyG formed significant aggregates within cells and induced nucleoplasmic translocation of NPM1 (B). Figure 1 C) and upregulation of expression ( Figure 1 D&E indicates the occurrence of nucleolar stress. Simultaneously, we found that 90×-polyG induced GC layer disruption in a cell model ( Figure 1 C) and FBL expression downregulated ( Figure 1D&F). In our previous work, we successfully constructed three pluripotent stem cell lines (iPSCs) from NIID patients carrying NOTCH2NLC GGC repeat mutations (repeat counts of 130, 109, and 139, respectively) (specifically, by inducing skin fibroblasts into pluripotent stem cells using the CytoTune iPS 2.0 SendaiReprogramming Kit (A16517)), and induced them into brain organoids ( Figure 2 A), they exhibit typical pseudoventricular structures ( Figure 2 B&C). These organoids retain the GGC duplication mutation of NOTCH2NLC and exhibit typical pathological features of NIID, namely p62 and ubiquitin-positive intranuclear inclusions (B&C). Figure 2 D&E). We also constructed three brain organoids derived from healthy controls as a control group for this study. Comparative analysis revealed a significant increase in NPM1 expression in brain organoids derived from NIID patients (D&E). Figure 1 G&H), while FBL expression was downregulated ( Figure 1 In summary, these results indicate that 90×-polyG can disrupt the structure and function of the nucleolus.

[0041] The differentiation of the aforementioned brain organoids is based on STEMdiff. TM The brain organoids were obtained using the Cerebral Organoid Kit (stemcell; catalog number: 08570). The procedure was as follows: Healthy iPSCs were selected and seeded into Matrigel-coated 6-well plates, maintained using mTeSR1 plus (stemcell; catalog number: 100-0276). Once the iPSCs reached a suitable density, they were digested into single cells using Gentle Cell Dissociation Reagent (stemcell; catalog number: 07174), resuspended in EB Seeding Medium, and seeded into low-absorption 96-well round-bottom plates to form embryoids (EBs). On day 5, EBs were transferred to low-absorption 24-well plates using Induction Medium for further culture. On day 7, EBs were coated with Matrigel (Corning; catalog number: 354277), seeded into 6-well plates, and induced with Expansion Medium. On day 10, the brain organoids were transferred to a track-shaker and cultured to maturity using Maturation Medium, with the medium changed every 3 days.

[0042] 1.3 Relationship between 90×-polyG and NPM1

[0043] Notably, we found co-localization of 90×-polyG and NPM1 in the HEK293T cell model. Figure 1 C) suggests a possible interaction between the two. To investigate the relationship between 90×-polyG and NPM1, we controlled the transfection time of the overexpression plasmid and found that 90×-polyG (carrying the mCherry tag) induced an increase in NPM1 expression in a concentration-dependent manner. Figure 2 F, G & H). Aggregation of 90×-polyG was observed 12 hours after transfection. Figure 1 J), and then the aggregate gradually increases in size ( Figure 1 Interestingly, 90×-polyG and NPM1 first co-localized 12 hours after transfection (K). Figure 1 J&K). NPM1 is known to participate in the intracellular protein quality control system (Frottin F, Schueder F, Tiwary S, Gupta R, ...). R, Schlichthaerle T, et al. The nucleolus functions as a phase-separated proteinquality control compartment. Science. 2019 Jul 26; 365(6451):342-347. doi:10.1126 / science.aaw9157.), therefore pathological polyG may activate this process. Specifically, pathological proteins in the nervous system enter the nucleolus and bind to NPM1 to reduce their toxicity, while the involvement of heat shock protein 70 (HSP70) can partially restore their refolding ability (Frottin F, Schueder F, Tiwary S, Gupta R, R, Schlichthaerle T, et al. The nucleolus functions as a phase-separated protein quality control department. Science. 2019 Jul 26; 365(6451):342-347. doi:10.1126 / science.aaw9157.). To verify whether polyG is also involved in this mechanism, we found significant co-localization of 90×-polyG and HSP70 in HEK-293T cells using immunofluorescence experiments. Figure 1 L), and HSP70 expression levels were significantly increased ( Figure 1M&N). Furthermore, HSP70 expression was significantly increased in brain organoids derived from NIID patients compared to those from healthy controls. Figure 1 These results suggest that 90×-polyG may activate the protein quantity control system centered on NPM1.

[0044] 1.4 Relationship between 90×-polyG and DAPI

[0045] We also found that 90×-polyG and DAPI showed significant co-localization 24 hours after transfection. Figure 1 J). Given that the nucleolus is rich in rRNA and that IDR competitively binds to rRNA, we hypothesized that the DAPI signal co-localized with polyG might represent rRNA. Further experiments confirmed that 90×-polyG, rRNA, and DAPI co-localized (J). Figure 2 I) provides potential evidence for the binding of 90×-polyG to rRNA. NPM1 is known to regulate protein biosynthesis by binding to rRNA via its IDR; therefore, we investigated whether NPM1 mediates the co-localization of 90×-polyG and rRNA. To test this hypothesis, we inhibited NPM1 expression using small interfering RNA (siRNA, sequence GGACAAGAAUCCUUCAAGATT UCUUGAAGGAUUCUUGUCCTT, SEQ ID NO:4) (inhibition efficiency exceeding 90%). Figure 1 Q) revealed that 90×-polyG no longer co-localizes with NPM1, but still binds to rRNA. Figure 1 The results indicate that polyG can bind independently to rRNA, but its binding to NPM1 is preferential to rRNA. This property is similar to that of the C9orf72-associated repeat dipeptide, but unlike the C9orf72-associated repeat dipeptide, it preferentially binds to rRNA (White MR, Mitrea DM, Zhang P, Stanley CB, Cassidy DE, Nourse A, et al. C9orf72 Poly(PR)Dipeptide Repeats Disturb Biomolecular Phase Separation and Disrupt Nucleolar Function. Mol Cell. 2019 May 16; 74(4):713-728.e6.doi:10.1016 / j.molcel.2019.03.019.). In summary, our results indicate that 90×-polyG can interact independently with both NPM1 and rRNA, and its binding to NPM1 is preferential to rRNA.

[0046] 2. PolyG induces changes in 3D chromatin structure

[0047] 2.1 PolyG-induced changes in 3D chromatin structure

[0048] Nucleolar homeostasis plays a crucial role in maintaining the three-dimensional (3D) structure of the genome. Studies have shown that NPM1 can interact with the chromatin structural protein CTCF, thereby regulating the formation of the chromatin three-dimensional structure (Wang AJ, Han Y, Jia N, Chen P, Minden MD. NPM1c impedes CTCF functions through cytoplasmic mislocalization inacute myeloid leukemia. Leukemia. 2020 / 05 / 01 2020;34(5):1278-1290.). Furthermore, RAD21 synergistically works with CTCF to participate in the formation of TADs and loops (Davidson IF, Barth R, Zaczek M, van der Torre J, Tang W, Nagasaka K, et al. CTCF is a DNA-tension-dependent barrier tocohesin-mediated loop extrusion. Nature. 2023 Apr; 616(7958):822-827. doi:10.1038 / s41586-023-05961-5.). Therefore, we hypothesize that 90×-polyG perturbation of NPM1 may induce changes in the three-dimensional structure of the genome. To verify this hypothesis, we found in the HEK293T cell model that 90×-polyG significantly reduced CTCF compared to 20×-polyG and the blank control. Figure 3 The expression levels of A, C&D) and RAD21 ( Figure 3 B, C&E). Furthermore, 90×-polyG continuously reduces CTCF in a time-dependent manner ( Figure 4 A&B) and RAD21 Figure 4 The expression of A&C further indicates its long-term impact on 3D chromatin structure. Meanwhile, we also observed CTCF ( ) in brain organoids derived from NIID patients. Figure 3 F&G) and RAD21 Figure 3 F&H expression was downregulated, and CTCF distribution was more loosely distributed. Figure 4 E). Notably, RAD21 is involved in the segregation of sister chromatids during cell division, and it is co-expressed with PAX6-labeled stem cells in organoids (E). Figure 4D), suggesting a close relationship with cell proliferation capacity. Further analysis revealed that cells highly expressing RAD21 in patient-derived brain organoids exhibited significantly reduced migration capacity. Figure 3 I). Furthermore, developmental delays in neurons (TUJ1 positive) in brain organoids derived from NIID patients (I). Figure 4 F) indicates that pathogenic polyG may accelerate neuronal loss. In summary, these results provide direct evidence for polyG-induced changes in 3D chromatin structure.

[0049] 2.2 Forms of polyG-induced 3D chromatin structure alterations

[0050] To further explore the specific forms of polyG-induced 3D chromatin structure alterations, we performed Hi-C sequencing on brain organoids (cultured for 90 days) from NIID patients and healthy controls. Using Hi-C 2.0 technology, approximately 3 billion paired-end reads were obtained from each sample, generating a total of approximately 1 billion uniquely aligned valid interaction data. We validated the quality of the Hi-C data through cis / trans interaction ratio and distance-dependent interaction frequency decay analysis. Figure 5 A). The interaction matrix between the two groups of samples is highly correlated (Pearson correlation coefficient R = 0.96). Figure 5 B), and the resolution reaches 5 kilobase pairs (kb) ( Figure 5 C) enables us to analyze the 3D chromatin structure of brain organoids at different scales, including compartments, TADs, and loops.

[0051] Chromatin is spatially divided into the normally active A compartment and the inhibitory B compartment. The A compartment is mainly located within the nucleus, while the B compartment is anchored to the periphery of the nucleus via Lamin B1. The compartments were significantly altered in the disease group (NIID patients) compared to healthy controls. Figure 5 D). Further analysis showed that a total of 512 (8.9%) departments underwent conversion. Figure 5Of the 5231 (91.1%) communities, 295 (5.1%) were converted from A to B, 217 (3.8%) were converted from B to A, and the remaining 5231 (91.1%) communities remained conserved. Previous studies have found that 90×-polyG can induce the disruption of Lamin B1 (Zhong S, Lian Y, Luo W, et al. Upstream open reading frame with NOTCH2NLC GGC expansion generates polyglycine aggregates and disrupts nucleocytoplasmic transport: implications for polyglycine diseases. Acta Neuropathologica. 2021 / 12 / 01 2021;142(6):1003-1023. doi:10.1007 / s00401-021-02375-3), which may be one of the important reasons for community conversion.

[0052] Since CTCF and RAD21 synergistically regulate the formation of TADs and loops, we further investigated the effects of CTCF and RAD21 dysregulation on TADs and loops. In the disease group and the healthy control group, we identified 5592 and 5568 TAD structures, respectively. Compared with the healthy control group, the disease group showed a reduction of 2026 TADs and an increase of 2058 TADs. Figure 5 As shown in F (middle), the TAD boundary is clear in the healthy control group, while it is blurred in the disease group, suggesting that the interactions within the TAD domains are more intense in the healthy control group. To quantify the change in TAD boundary insulation strength, we calculated the insulation fraction of each bin and found that the insulation fraction of the TAD boundary was significantly increased in the disease group. Figure 5 G) indicates a decrease in boundary strength. Furthermore, the insulation fraction within the TAD in the disease group was lower than that in the healthy control group (G). Figure 5 G) indicates a decrease in the frequency of interactions within the TAD. Next, we further analyzed the differences in loops between the two groups. In the disease group and the healthy control group, we identified 4990 and 5456 loop structures, respectively. Compared with the healthy control group, the disease group had 2308 fewer loops and 1845 new loops. Among the 3153 conserved loops, 191 showed increased interaction strength (fold change ≥ 2) and 441 showed decreased interaction strength (fold change ≤ 0.5). Figure 5 As shown in F (right side), the interaction within loops is reduced in the disease group.

[0053] In summary, our results indicate that the 3D chromatin structure of the NIID brain organoid model is significantly abnormal, and these changes may be closely related to polyG-induced nucleolar dysfunction.

[0054] 3. NPM1 dysfunction induces gene damage and aging

[0055] NPM1 can be recruited to gene damage sites and participate in DNA damage repair (Box, JK; Paquet, N.; Adams, MN; Boucher, D.; Boldenson, E.; O'Byrne, KJ; et al. Nucleophosmin: from structure and function to disease development. BMC Mol Biol 2016, 17(1), 19. DOI: 10.1186 / s12867-016-0073-9.), therefore we speculate that 90×-polyG-induced NPM1 nucleocytoplasmic translocation may trigger gene damage. Phosphorylated γH2AX (p-γH2AX) is a marker molecule of gene damage. 12 We examined the expression of p-γH2AX in HEK293T cell models containing 20 or 90 GGC repeat sequences, as well as in brain organoids derived from NIID patients and healthy controls. The results showed that 90×-polyG significantly induced increased p-γH2AX expression in HEK-293T cells compared to 20×-polyG and the blank control group. Figure 6 A, B & C). Similarly, compared with healthy controls, the proportion of gene damage events in brain organoids derived from NIID patients (disease group) was significantly increased. Figure 6 D&E), and p-γH2AX levels also increased significantly ( Figure 6 F&G). To further assess the level of gene damage in brain organoids derived from NIID patients, based on previously obtained single-cell sequencing data (Fan Y, Li MJ, Yang J, Li SJ, Hao XY, Li JD, et al. GGC repeat expansion in NOTCH2NLC induces dysfunction in ribosome biogenesis and translation. Brain. 2023 Aug 1; 146(8):3373-3391. doi:10.1093 / brain / awad058.), we found through gene set variation analysis (GSVA) ​​that the level of gene damage was significantly increased in the disease group ( Figure 6H), and this phenomenon is widespread in all cell types, including neural stem cells, neuroblasts, neurons, glutamatergic neurons, radial glial cells, oligodendrocytes, and Schwann cells (MSCs). Figure 7 A). In summary, these results indicate a significant increase in gene damage events in NIID disease models.

[0056] Genetic damage has been proven to be an important driver of cellular senescence (Dileep, V.; Boix, CA; Mathys, H.; Marco, A.; Welch, GM; Meharena, HS; et al. Neuronal DNA double-strand breakslead to genome structural variations and 3D genome disruption in neurodegeneration. Cell 2023, 186(20), 4404-4421.e4420.DOI:10.1016 / j.cell.2023.08.038.), therefore we speculate that NIID disease models may exhibit more severe senescence phenotypes. We performed whole transcriptome sequencing (bulk RNA-seq) on HEK-293T cells transfected with 20×-polyG, 90×-polyG and blank plasmids. Principal component analysis showed that there was significant heterogeneity among the three groups of samples, while the samples within each group had high similarity ( Figure 7 B). Cluster analysis further showed that the 20×-polyG group and the blank control group clustered together, while the 90×-polyG group formed its own cluster (B). Figure 6 I) indicates that the 20×-polyG group and the blank control group have similar gene expression patterns, while the 90×-polyG group exhibits unique transcriptional characteristics. Venn diagrams show the number of differentially expressed genes among the three groups ( Figure 7 C), the differential gene heatmap showed that the 90×-polyG group had a specific gene expression pattern ( Figure 7 E). Functional enrichment analysis of the upregulated differentially regulated genes then revealed that the 90×-polyG group was significantly enriched in the aging-related pathway (SHAP pathway). Figure 6 J&K), while the 20×-polyG group did not show significant enrichment in this pathway compared to the blank control group (J&K). Figure 7 D) suggests that the aging phenotype mainly occurs in the 90×-polyG group.

[0057] Cellular senescence is typically accompanied by increased β-galactosidase activity. We found that β-galactosidase activity was significantly increased in HEK-293T cells expressing 90×-polyG. Figure 6L&M). In addition, nucleocytoplasmic transport impairment is also one of the significant features of cellular senescence, and previous studies have confirmed the existence of significant nucleocytoplasmic transport impairment in NIID models (Zhong, S.; Lian, Y.; Luo, W.; Luo, R.; Wu, X.; Ji, J.; et al. Upstream open reading frame with NOTCH2NLCGGC expansion generates polyglycine aggregates and disrupts nucleocytoplasmic transport: implications for polyglycine diseases. Acta Neuropathol 2021, 142(6), 1003-1023. DOI: 10.1007 / s00401-021-02375-3.). To assess the aging level of brain organoids derived from NIID patients, we found through GSVA analysis of single-cell sequencing data that brain organoids derived from patients showed a higher level of gene damage-related aging ( Figure 6 O). Notably, the level of senescence in neurons was lower than that in the normal control group ( Figure 7 F), we speculate that this may be related to the high sensitivity of neurons to injury and their susceptibility to loss. Furthermore, compared to the control group, β-galactosidase activity was significantly increased in patient-derived brain organoids (F). Figure 6 L&N).

[0058] In summary, these results indicate that the accumulation of gene damage events in NIID disease models promotes cellular senescence. In conclusion, these findings reveal that polyG plays a crucial role in the pathological process of NIID by inducing gene damage and cellular senescence through disruption of nucleolar function and NPM1 homeostasis.

[0059] 4. ASO reduces the efficiency of biosynthesis in the NIID model polyG.

[0060] We designed ASO-GGC, ASO-GGC-cy3 (ASO-cy3 for short), and a control ASO-ctr. These ASOs block the translation of repetitive RNAs through steric hindrance. We then transfected these three ASOs into HEK-293T cells. The ASO-GGC consists of 11 nucleotides, with the 6th site being DNA and the remaining sites being RNA modified with 2′-O-Me. All other sites are modified with phosphate thioester. The ASO-GGC-cy3 differs from ASO-GGC in that it is modified with cy3 at the 5′ end. The ASO-ctr consists of 10 DNA sites in the middle, with the remaining sites being RNA modified with 2′-O-Me. All other sites are modified with phosphate thioester. The ASO-GGC sequence is 5′-mC*mC*mG*mC*mC*dG*mC*mC*mG*mC*mC-3′ (11nt, SEQ ID NO: 1, where m represents 2′-O-Me modification). The ASO-ctr sequence is 5'-mG*mC*mG*mU*mA*dT*dT*dA*dT*dA*dG*dC*dC*dG*dA*mU*mU*mA*mA*mC-3′ (SEQ ID NO: 5, m indicates 2′-O-Me modification). The ASO-GGC-Cy3 sequence is 5'-cy3-mC*mC*mG*mC*mC*dG*mC*mC*mG*mC*mC-3′ (11nt, SEQ ID NO: 6, m indicates 2′-O-Me modification). All ASOs used were synthesized by Gemma Gene and purified by HPLC. Experimental results showed that ASO-cy3 (200 nM) could be efficiently transfected into HEK-293T cells via liposomes. Figure 8 A). To evaluate the cytotoxicity of ASO-ctr and ASO-GGC, we examined cell viability and found that ASO-ctr and ASO-GGC had no significant effect on cell viability compared to the control group which only received transfection reagent. Figure 8 B). Furthermore, through apoptosis and necrosis cell staining experiments, we found that ASO-ctr and ASO-GGC did not significantly increase the levels of apoptosis and necrosis in cells (B). Figure 8 These results indicate that ASO-ctr and ASO-GGC have no significant cytotoxic effects, therefore we further evaluated their therapeutic potential in the NIID model.

[0061] We co-transfected HEK-293T cells with 90×-polyG plasmid and 200 nM ASO-GGC or ASO-ctr, and analyzed the results after 48 hours of culture. The results showed that ASO-GGC significantly reduced the expression level of 90×-polyG (mCherry). Figure 9A). Simultaneously, with the decrease in 90×-polyG expression, inclusion bodies also decreased significantly. Figure 9 B&C). To clarify whether ASO-GGC inhibits translation by degrading 90×-polyG-mCherry mRNA, we performed qPCR to quantify mCherry mRNA, and found that the mCherry mRNA level was significantly increased in the ASO-GGC group (B&C). Figure 9 D) suggests that ASO may reduce 90×-polyG production by inhibiting translation rate rather than degrading mRNA. To further evaluate the effects of ASO-GGC on the transcription and translation of endogenous NOTCH2NLC, we used qPCR to analyze the transcriptional level of NOTCH2NLC and found that ASO-GGC increased the transcriptional level of NOTCH2NLC (D). Figure 9 E), but it did not significantly affect its translation rate. Figure 9 G).

[0062] To verify the therapeutic effect of ASO in patient-derived brain organoids, we first treated brain organoids with 200 nM ASO-cy3 continuously for 2 weeks. The results showed that ASO-cy3 could effectively enter the brain organoids. Figure 8 A). Therefore, we used ASO-GGC to treat patient-derived brain organoids to evaluate its therapeutic effect. Immunofluorescence assays showed that ASO-GGC significantly reduced the number of p62 and ubiquitin-positive intranuclear inclusion bodies (A). Figure 9 H&I) indicates a decrease in polyG production. Furthermore, ASO-GGC also increased the transcriptional level of endogenous NOTCH2NLC mRNA (H&I). Figure 9 J), but did not affect the translation level of endogenous NOTCH2NLC (J). Figure 9 F). In summary, these results indicate that ASO-GGC can reduce the biosynthesis and aggregation of polyG in the NIID model by decreasing the translation rate, without affecting the translation of endogenous NOTCH2NLC.

[0063] The primers used for qPCR detection of mCherry and NOTCH2NLC transcription levels are as follows (GAPDH is used as an internal control):

[0064] mCherry F: 5′-ACGACGCCGAGGTGAAGAC-3′, SEQ ID NO: 7;

[0065] mCherry R: 5′-CTCGTTGTGGCTGGTGATGTC-3′, SEQ ID NO: 8;

[0066] NOTCH2NLC F: 5′-CTACCAGTGCCAGTGCCTCAG-3′, SEQ ID NO: 9;

[0067] NOTCH2NLC R: 5′-CCGACAGGTGCCTCCATTGAC-3′, SEQ ID NO: 10;

[0068] GAPDH F: 5′-GAGTCAACGGATTTGGTCGT-3′, SEQ ID NO: 11;

[0069] GAPDH R: 5′-TTGATTTTGGAGGGATCTCG-3′, SEQ ID NO: 12.

[0070] 5. ASO rescues 3D genomic disorder and aging state in NIID models

[0071] Given that ASO-GGC significantly reduced polyG expression and aggregation, we further investigated whether ASO-GGC could improve genomic instability and senescence in the NIID model. In HEK-293T cells co-transfected with 90×-polyG / ASO-GGC and 90×-polyG / ASO-ctr, we found that ASO-GGC significantly reduced NPM1 expression levels ( Figure 10 A&B) suggests an improvement in nucleolar stress. Simultaneously, ASO-GGC significantly reduced gene damage and senescence phenotypes in HEK-293T cells expressing 90×-polyG, manifested by a decrease in p-γH2AX levels ( Figure 10 A&C) and decreased β-galactosidase activity ( Figure 10 D&E). Similarly, in brain organoids derived from NIID patients, ASO-GGCs also significantly improved the pathological state. First, ASO-GGCs improved the nucleolar stress state of brain organoids and reduced the expression level of NPM1 (D&E). Figure 10 F&G). Furthermore, ASO-GGC also reduced the level of gene damage in brain organoids (F&G). Figure 10 F, H, I & J), and promoted neuronal development ( Figure 8 Increased expression of E) and TUJ1 ( Figure 8 F). Finally, ASO-GGC significantly reduced gene damage-induced aging levels in brain organoids (F). Figure 10 K&L).

[0072] To further clarify the therapeutic effect of ASO-GGC on NIID, we performed single-cell sequencing analysis on brain organoids from NIID patients treated with ASO-GGC and ASO-ctr. Specifically, we randomly divided brain organoids from each patient into two groups, treating them with ASO-GGC and ASO-ctr for two consecutive weeks, respectively. Subsequently, the brain organoids were digested into single-cell suspensions, and equal volumes of cells were mixed and sequenced. After excluding low-quality cells, we captured 26,423 and 14,284 cells in the ASO-GGC and ASO-ctr treatment groups, respectively. Sctype analysis identified five major cell types, including neural progenitor cells (NPCs), neuroblasts (NBs), mature neurons (MNs), GABAergic neurons (GNs), and oligodendrocyte precursor cells (OPCs). Figure 11 A, Figure 12 A). Bubble chart of marker genes ( Figure 12 B) and heatmap details are available in [link / reference]. Figure 12 C. We first identified 325 differentially expressed genes between the two groups ( Figure 11 B), these genes are significantly enriched in pathways such as ribosome formation and polypeptide elongation. Figure 11 C), which is closely related to functions such as translation and macromolecular biosynthesis. Figure 11 D). It is worth noting that previous studies have found impaired ribosome and translation functions in NIID models (Fan Y, Li MJ, Yang J, Li SJ, Hao XY, Li JD, et al. GGC repeat expansion in NOTCH2NLC induces dysfunction in ribosome biogenesis and translation. Brain. 2023 Aug 1; 146(8):3373-3391. doi:10.1093 / brain / awad058.), suggesting that ASO-GGC may exert a therapeutic effect by restoring these functions. Further GSVA analysis revealed that ASO-GGC significantly reduced the level of gene damage in NIID brain organoids ( Figure 11 E) and aging state ( Figure 11 F), these improvements were validated in all major cell subpopulations. Figure 13 D&E). Furthermore, we obtained 9 gene modules through hdWGCNA analysis ( Figure 11 G), among which the pink (90 genes), blue (929 genes), red (231 genes), and turquoise (1913 genes) modules were most significantly affected by ASO-GGC. Figure 11H). Functional enrichment analysis of these modules revealed that they are mainly involved in processes such as nervous system development, neuronal projection, axonogenesis, and neuronal migration. Figure 11 (I&J) suggests that ASO-GGC may exert its therapeutic effect by restoring neuronal function. In summary, our results indicate that ASO-GGC can significantly improve gene damage and aging status in NIID models, and can restore nucleolar function, reduce genomic instability, and promote neuronal development.

[0073] To clarify whether ASO-GGC could rescue 3D chromatin structure abnormalities in a NIID model, we first assessed changes in chromatin structural proteins in the NIID disease model. The results showed that, compared to ASO-ctr, ASO-GGC significantly upregulated the expression levels of CTCF and RAD21 in the HEK-293T cell model. Figure 14 A, B & C). Meanwhile, in brain organoids derived from NIID patients, ASO-GGCs also significantly increased the expression of CTCF and RAD21 (ASO-GGCs). Figure 14 D, E & F). Furthermore, ASO-GGC restored the normal distribution of CTCF in NIID brain organoids (D, E & F). Figure 8 E). These results suggest that ASO-GGC has a potential therapeutic effect on polyG-induced chromatin structure abnormalities.

[0074] To further evaluate the effect of ASO-GGC on improving the 3D chromatin structure of brain organoids derived from NIID patients, we performed Hi-C sequencing on brain organoids after ASO-GGC treatment. Sequencing yielded approximately 3 billion paired-end reads, generating approximately 1 billion uniquely aligned valid interaction data. We validated the quality of the Hi-C data through cis / trans interaction ratio and distance-dependent interaction frequency decay analysis. Figure 13 A). Compared with the HIC sequencing results of patient-derived brain organoids, the interaction matrix between the ASO-GGC treatment group and the healthy control group showed a higher correlation (Pearson correlation coefficient R = 0.97). Figure 13 B), and the resolution reaches 5 kilobase pairs (kb) ( Figure 13 C). The heat map shows the compartmental changes in the treatment group relative to the control group. Figure 14 Further analysis revealed that of the 512 compartments in the ASO-GGC treatment group that had previously switched, 407 (79.5%) recovered, with 244 (47.7%) recovering from B to A and 163 (31.8%) recovering from A to B. Figure 14H). Furthermore, we identified 5973 TADs and 1950 loop structures in the ASO-GGC treatment group. Further analysis revealed that ASO-GGC significantly restored the TAD boundaries and loop structures on chromosome 8. Figure 14 I). Specifically, ASO-GGC treatment caused the reformation of 1182 previously lost TADs, while eliminating 427 previously newly formed TADs. To quantify the changes in TAD boundary insulation strength, we calculated the insulation fraction and found that ASO-GGC significantly enhanced the insulation of the TAD boundaries and partially restored the contact frequency within the TADs. Figure 14 Furthermore, ASO-GGC reversed 2082 (50.1%) altered loops, with 977 loops regenerated and 1105 loops disappearing. In summary, our results demonstrate that ASO-GGC can, to some extent, rescue 3D chromatin structure abnormalities caused by the repeated amplification of NOTCH2NLC GGCs. These findings further support the potential application value of ASO-GGC in NIID treatment and provide new insights into its mechanism of action.

[0075] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A specific antisense oligonucleotide, characterized in that, The specific antisense oligonucleotide is complementary to the 5'-UTR sequence of the NOTCH2NLC gene, and the specific antisense oligonucleotide consists of 11 nucleotides.

2. The specific antisense oligonucleotide according to claim 1, characterized in that, The specific antisense oligonucleotide has a DNA site at the 6th site and all other sites are RNA modified with 2′-O-Me. All sites are modified with thiophosphate.

3. The specific antisense oligonucleotide according to claim 2, characterized in that, The sequence of the specific antisense oligonucleotide is shown in SEQ ID NO:

1.

4. The use of the specific antisense oligonucleotide according to any one of claims 1-3 in the preparation of a medicament for treating neuronal intranuclear inclusion body disease.

5. A drug for treating neuronal intranuclear inclusion body disease, characterized in that, The drug contains the specific antisense oligonucleotide as described in any one of claims 1-3.

Citation Information

Patent Citations

  • Method, system and analog stimulus-response unit for determining real and imaginary components of an AC response received from a device under test

    US20090198462A1