Method for inducing mouse trophoblast stem cells in vitro

By knocking out the Sorcs3 gene in mouse embryonic stem cells and screening for CDCP1-positive cells in a specific culture medium, rapid and efficient induction of mouse trophoblast stem cells was achieved, solving the problems of long induction time and low purity in existing technologies, and promoting research on ICM and TE lineage transitions.

CN120989154AActive Publication Date: 2025-11-21NANKAI UNIV

Patent Information

Application Number
CN202510957924.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-11
Publication Date
2025-11-21
Estimated Expiration
2045-07-11

AI Technical Summary

Technical Problem

Existing technologies for inducing mouse trophoblast stem cells suffer from problems such as long induction time and low purity, making it difficult to effectively regulate cell fate transition between the inner cell mass (ICM) and the trophoblast (TE).

Method used

Sorcs3-KO ESCs were constructed by knocking out the Sorcs3 gene in mouse embryonic stem cells, and then induced and cultured in a specific culture medium. Antibody-CDCP1 positive cell populations were screened, and mouse trophoblast stem cells were obtained after proliferation.

Benefits of technology

It significantly enhances the differentiation capacity of embryonic stem cells into trophoblast lineages, providing a rapid and high-purity TSCs induction strategy, and offering an important research platform for studying the mechanism of ICM and TE lineage transition in blastocysts.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120989154A_ABST
    Figure CN120989154A_ABST
Patent Text Reader

Abstract

The invention relates to a method for inducing mouse trophoblast stem cells in vitro. According to the method, mouse embryonic stem cells are used as starting cells, Sorcs3 gene knockout mouse embryonic stem cells are obtained through a gene editing technology, and in-vitro induced trophoblast stem cells (iTSCs) are efficiently and rapidly obtained by means of a flow cytometry sorting technology and in combination with specific antibody sorting. According to the invention, the Sorcs3 gene is knocked out from the embryonic stem cell, so that the capability of the embryonic stem cell to differentiate to the trophoblast lineage can be obviously enhanced; an important research platform is provided for deeply researching a lineage intertransformation mechanism of cell masses (ICM) and trophoblast (TE) in the blastocysts, and the method has important significance for researching lineage limitation of early embryonic development of mammals and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of cell culture technology, and in particular relates to a method for inducing mouse trophoblast stem cells in vitro. Background Technology

[0002] A natural barrier exists between the inner cell mass (ICM) and trophoblast (TE) of mice, preventing them from interconverting under natural conditions. The relevant pathways involved are not fully understood, and regulating cell fate transition between these two structures is a hot topic in developmental biology. Embryonic stem cells (ESCs) derived from ICM and trophoblast stem cells (TSCs) derived from TE are ideal tools for in vitro studies of ICM and TE lineage transitions. Although current research indicates that gene editing of specific transcription factors or epigenetic regulators can promote the conversion of mouse ESCs to TSCs, existing TSC induction techniques have limitations in terms of duration and TSC purity. Therefore, this invention aims to provide a rapid and highly homogeneous TSC induction strategy. Summary of the Invention

[0003] To address the aforementioned technical problems, this invention provides a method for in vitro induction of mouse trophoblast stem cells.

[0004] The technical solution adopted in this invention is: a method for in vitro induction of mouse trophoblast stem cells, wherein the Sorcs3 gene is knocked out in mouse embryonic stem cells to obtain Sorcs3-KO ESCs, and after induction and culture of Sorcs3-KO ESCs, a CDCP1-positive cell population is screened, and mouse trophoblast stem cells are obtained after proliferation.

[0005] Preferably, the specific method is as follows:

[0006] Step 1: Construct a plasmid for Sorcs3 gene knockout;

[0007] Step 2: Electroporate the Sorcs3 gene knockout plasmid into mouse embryonic stem cells, culture and sort GFP-positive cells, and proliferate to obtain Sorcs3-KO ESCs;

[0008] Step 3: Sorcs3-KO ESCs were cultured in mouse TSCs medium for 7 days to induce cell growth; the antibody-CDCP1 positive cell population was cultured and sorted, and mouse induced trophoblast stem cells (iTSCs) were obtained after proliferation.

[0009] Preferably, in step one, two mouse Sorcs3-KO sgRNA sequences are designed and synthesized, named sg1 and sg2 respectively, as shown in SEQ ID No.1 and SEQ ID No.2. sg1 and sg2 are ligated into an expression vector to construct a Sorcs3 gene knockout plasmid.

[0010] Preferably, the expression vector is PX458.

[0011] Preferably, in step two, the Sorcs3 gene knockout plasmid is electroporated into wild-type mouse embryonic stem cells. After transfection, the cells are cultured for 48 hours, and the cells are sorted by flow cytometry to separate GFP-positive cells and amplify them. The subclones derived from single cells are genotyped and sequenced to obtain Sorcs3-KO ESCs.

[0012] Preferably, in step three, the TSCs culture medium includes: 70% trophoblast stem cell basal culture medium, 30% conditioned medium CM, 25 ng / ml FGF-4 (MCE, HY-P7014), and 1 μg / ml Heparin (MCE, HY-17567A).

[0013] Preferably, when Sorcs3-KO ESCs have been propagated to a density of 60-70%, they are digested with 0.25% Trypsin-EDTA at a concentration of 3 × 10⁻⁶. 4 Each cell was seeded into a 6-well plate pre-coated with 0.2% gelatin, and the culture medium was TSCs medium, which was changed every two days. After 7 days of culture, CDCP1+ cells were sorted by flow cytometry. After the sorted cells were proliferated for 2-3 days, mouse iTSCs were obtained in vitro.

[0014] Mouse trophoblast stem cells were prepared by in vitro induction of mouse trophoblast stem cells.

[0015] The advantages and positive effects of this invention are: by knocking out the Sorcs3 gene in embryonic stem cells, the ability of embryonic stem cells to differentiate into trophoblast lineages is significantly enhanced; a highly efficient and rapid method for inducing the preparation of mouse trophoblast stem cells is provided, which provides an important research platform for in-depth study of the interconversion mechanism between blastocyst ICM and TE lineages, and is of great significance for research on lineage restriction in early mammalian embryonic development. Attached Figure Description

[0016] Figure 1 Diagram illustrating the principle of Sorcs3 gene knockout;

[0017] Figure 2 Genotyping diagram and sequencing results of Sorcs3-KO subclones;

[0018] Figure 3 Flowchart of Sorcs3-KO ESCs to Sorcs3-KO iTSCs cell induction process;

[0019] Figure 4 Cell morphological changes during Sorcs3-KO ESCs induction; scale bar is 100 μm;

[0020] Figure 5 Flow cytometry of CDCP1 positivity rate during Sorcs3-KO ESCs induction;

[0021] Figure 6 Immunofluorescence identification results of Sorcs3-KO iTSCs; scale bar is 50 μm;

[0022] Figure 7 Immunofluorescence identification results of Sorcs3-KO iTSCs undergoing downward differentiation; scale bar is 50 μm.

[0023] Figure 8 Flow cytometry of Sorcs3-KO iTSCs undergoing downward differentiation ploidy analysis. Detailed Implementation

[0024] The embodiments of the present invention will now be described with reference to the accompanying drawings.

[0025] This invention relates to a method for in vitro induction of mouse trophoblast stem cells. Using mouse embryonic stem cells as the starting cell line, knocking out the Sorcs3 gene significantly enhances the ability of these stem cells to differentiate into trophoblast lineages. This method enables the rapid and efficient induction of mouse trophoblast stem cells (iTSCs).

[0026] The specific method is as follows:

[0027] Step 1: Construct Sorcs3 gene knockout plasmids; Design and synthesize two mouse Sorcs3-KO sgRNA sequences using the CRISPOR website (http: / / www.crispor.tefor.net), as shown in SEQ ID No. 1 and SEQ ID No. 2; Construct Sorcs3 gene knockout plasmids containing sg1 and sg2;

[0028] sg1: SEQ ID No.1CCATCGGACCCGCACCTCGG;

[0029] sg2: SEQ ID No.2TCACACCAAGGGTTCGCGAG.

[0030] sg1 and / or sg2 can be integrated into an expression vector to form a Sorcs3 gene knockout plasmid. The principle of plasmid construction is as follows: Figure 1 As shown, preferably, two sgRNAs are designed targeting exon 1 of the Sorcs3 gene, and the two sgRNAs are integrated into the same expression vector to form a Sorcs3 gene knockout plasmid to improve gene knockout efficiency. In some embodiments of the present invention, the two sgRNAs are ligated and transformed with the PX458 plasmid (Addgene, 48138) recovered by FastDigest BpiI (Thermo, FD1014). After sequencing, the plasmid is extracted to obtain the Sorcs3 gene knockout plasmid.

[0031] Step 2: Obtain Sorcs3-KO ESCs; Electroporate the Sorcs3 gene knockout plasmid into wild-type mouse embryonic stem cells, culture the cells for 48 hours after transfection, perform flow cytometry sorting to separate GFP-positive cells (cells successfully transfected with the plasmid) and amplify them; Genotyping and sequencing verification of the subclones from single cells were performed to obtain Sorcs3-KO ESCs.

[0032] Step 3: Sorcs3-KO ESCs were cultured in mouse TSCs medium to induce the formation of mouse iTSCs. The TSCs medium consisted of: 70% feeder cell basal culture medium, 30% conditioned medium, 25 ng / ml FGF-4 (MCE, HY-P7014), and 1 μg / ml Heparin (MCE, HY-17567A). After 10 days of culture, antibody-CDCP1+ cells were sorted by flow cytometry. After 2-3 days of proliferation, in vitro induced mouse iTSCs were obtained. The induction process is as follows: Figure 3 As shown;

[0033] Specifically, when Sorcs3-KO ESCs proliferated to a density of 60-70%, they were digested with 0.25% Trypsin-EDTA. Cell counting was performed after digestion at a concentration of 3 × 10⁻⁶ cells / cells. 4 One cell per well was seeded into a 6-well plate pre-coated with gelatin, and the culture medium was TSCs medium, which was changed every two days. After 7 days, CDCP1+ cells were sorted by flow cytometry. The sorted cells were then seeded into well plates with a feeder layer (800,000 viable cells per 35 mm dish to reduce cell damage during flow cytometry sorting). After 2-3 days of proliferation, in vitro induced mouse iTSCs were obtained.

[0034] Detection of induced mouse iTSCs revealed that Sorcs3-KO iTSCs exhibited clear edges and typical TSC morphology. Immunofluorescence staining and ploidy analysis confirmed that mouse iTSCs possess TSC attributes. Knocking out the Sorcs3 gene in mouse ESCs enabled them to acquire TSC-like induced characteristics, and immunofluorescence staining and downward differentiation experiments confirmed their trophoblast lineage identity. Knocking out the Sorcs3 gene in embryonic stem cells significantly enhanced their ability to differentiate into the trophoblast lineage, providing an important research platform for further investigation into the mechanisms of lineage transition between the inner cell mass (ICM) and trophoblast (TE) in blastocysts, and holding significant importance for research on lineage restriction in early mammalian embryonic development.

[0035] The present invention will now be described with reference to the accompanying drawings. Experimental methods not specifically described in terms of operation steps are performed in accordance with the corresponding product manuals. Unless otherwise specified, the instruments, reagents, and consumables used in the embodiments can be purchased from commercial companies.

[0036] Example 1: Preparation of mouse TSCs

[0037] 1.1 Constructing the plasmid Sorcs3-KO

[0038] Mouse Sorcs3 gene knockout cells were constructed using CRISPR / Cas9 technology. First, two sgRNA sequences targeting the Sorcs3 gene were designed and synthesized using the CRISPOR online tool: sg1 (SEQ ID No. 1) and sg2 (SEQ ID No. 2). Then, complementary single-stranded DNA fragments of sg1 and sg2, sg1-1 / sg1-2 and sg2-1 / sg2-2, were synthesized, with sequences shown in SEQ ID Nos. 3-6, respectively. These fragments were then annealed to form double-stranded sgRNA fragments.

[0039] Primer information is as follows:

[0040] Sorcs3 sg1-1:

[0041] SEQ ID No.3CACCGCCATCGGACCCGCACCTCGG

[0042] Sorcs3 sg1-2:

[0043] SEQ ID No.4AAACCCGAGGTGCGGGTCCCGATGGC

[0044] Sorcs3 sg2-1:

[0045] SEQ ID No.5CACCGTCACACCAAGGGTTCGCGAG

[0046] Sorcs3 sg2-2:

[0047] SEQ ID No.6AAACCTCGCGAACCCTTGGTTGAC

[0048] The PX458 vector (Addgene, 48138) was linearized by FastDigest BpiI (Thermo, FD1014) and then ligated with the sg1 and sg2 fragments respectively using T4 ligase (16℃, 1h). The ligation products were transformed into 100 μL of competent cells and plated on LB agar plates containing ampicillin (Solarbio, A8180) and incubated overnight at 37℃. The next day, single colonies with clear boundaries and appropriate size were picked for sequencing verification to ensure the correctness of the construction.

[0049] The primer information used for the identification and sequencing of Sorcs3 gene knockout cells is as follows:

[0050] SEQ ID No.7F:TCCTCATTCCCCTGACACACT

[0051] SEQ ID No.8R: ACACTGCTGTTGTGTCCCGA

[0052] 1.2 Preparation of Sorcs3-KO mouse ESCs

[0053] Sorcs3-ESCs were selected for culture. Sorcs3-ESCs were used as the starting cells for inducing mouse iTSCs. The culture medium included 82% DF12 (Thermo, 12500062), 15% fetal bovine serum (HYclone, SH30406.05), supplemented with 1% 100×NEAA (Gibco, 11140050), 1% 100× anti-adrenergic steroids (Gibco, 15140122), 0.11 mM β-mercaptoethanol (Sigma, 21985023), 2 mM Glutamax (Gibco, 35050061), 1000 U / mL LIF (Sigma, ESG1107), 3 μM CHIR99021 (MCE, HY-10182), and 0.2 μM PD0325901 (MCE, HY-10254). Routine culture is performed on the feeder, and 0.25% Trypsin-EDTA (Gibco, 25200072) is used for subculturing at a ratio of 1:10 to 1:15.

[0054] Wild-type mouse embryonic stem cells in rapid growth were electroporated using a NEON electroporator (Invitrogen). 4 μg of the Sorcs3-KO plasmid prepared in step 1.1 was delivered to a 1×10⁻⁶ plate at 1400 V, 11 ms, and 3 pulses. 6 Each cell.

[0055] After transfection, cells were cultured for 48 hours, followed by flow cytometry sorting. GFP-positive cells were sorted using a flow cytometer, and the sorted GFP+ cells were seeded onto a feeder. After amplification for 3-4 days, subclones derived from single cells were selected for genotyping and sequencing verification.

[0056] Genomic DNA was extracted from the selected subclones, and genotyping and sequencing were performed using the primers provided in the patent. The genotyping results of the Sorcs3 knockout subclones and the sequencing results of the Sorcs3 knockout cell lines are as follows: Figure 2 As shown, WT is the wild-type control group, and 1#, 2#, and 3# are three randomly selected subclones. The results show that the randomly selected subclones successfully achieved Sorcs3 gene knockout. The sgRNA sequence designed in this embodiment has high knockout efficiency and expression accuracy.

[0057] 1.3 In vitro induction of mouse TSCs

[0058] First, Sorcs3-KO ESCs were digested with 0.25% Trypsin-EDTA, and then the Sorcs3-KO ESCs were digested at 3×10⁻⁶ ppm. 4 Each cell was seeded into a 6-well plate coated with gelatin. The culture medium was then replaced with TSCs medium, and the medium was changed every two days. After 7 days, TSCs-like clones comprised approximately 70% of the cell composition. At this point, CDCP1+ cells were sorted using flow cytometry. The sorted cells were seeded onto feeders (800,000 viable cells per 35mm dish to minimize cell damage during flow cytometry sorting) and continued to be placed in TSCs medium for acclimation. After 2-3 days of expansion, in vitro induced mouse iTSCs were obtained, with the medium changed every two days. In vitro induced mouse iTSCs were passaged every 3-4 days at a passage ratio of 1:6-1:8.

[0059] The culture medium consists of the following components;

[0060] The TSCs culture medium consists of: 70% trophoblast stem cell basal culture medium, 30% conditioned medium CM, 25 ng / ml FGF-4 (MCE, HY-P7014), and 1 μg / ml Heparin (MCE, HY-17567A);

[0061] The conditioned medium is a basal medium for TSCs containing feeder secretions, and the specific preparation method is as follows: according to 1×10 7 Feeders were planted at a density of 10 cm and cultured in TSCs basal medium. The medium was harvested every 3 days and placed in a 4°C freezer for a total of 3 times. After collection, the medium was aliquoted and stored in a -20°C freezer.

[0062] TSCs basal medium: 77% RPMI 1640 (Gibco, 61870036), 20% fetal bovine serum, supplemented with 1% 100× antibiotics, 2 mM Glutamax, 0.11 mM β-mercaptoethanol, and 1 mM sodium pyruvate (Sigma, P4562).

[0063] like Figure 4 The image shows a white light spectrum illustrating the morphological changes of ESCs induced by Sorcs3-KO. As can be seen, after sorting, the clones have clear edges, exhibiting typical TSC morphology. The proportion of CDCP1+ cells in Sorcs3-KO ESCs during induction is shown in the image. Figure 5 As shown in the figure, CDCP1 can be detected in iTSCs induced by Sorcs3 knockout ESCs, and the proportion is extremely high, proving that it has a high induction efficiency. After WT-ESCs induction, the positive rate of CDCP1 is extremely low and cannot be enriched. As the number of induction days increases, no positive cells are present.

[0064] Example 2: Detection and identification of mouse TSCs

[0065] 2.1 Identification of molecular characteristics of mouse TSCs

[0066] The mouse iTSCs induced in vitro in Example 1 were identified by cell slide preparation and immunofluorescence staining experiments. Antibodies against CDX2, EOMES, and TFAP2C were used as specific molecular markers to stain the cells.

[0067] Mouse iTSCs were plated and fixed with 4% PFA at room temperature for 20 minutes, followed by perforation with 0.1% Triton (Sigma, T8787) for 1 hour, and then blocked with 2% BSA (Sigma, A1933) for 1 hour. The samples were then incubated overnight at 4°C with primary antibodies including CDX2 (Biogenex, MU392A), EOMES (Abcam, ab183991), TFAP2C (Santa Cruz, sc-12762), TPBPA (Abcam, ab104401), PROLIFERIN (Santa Cruz, sc-271891), GCM1 (Sigma, HPA011343), and SDC1 (Abclonal, a4174). The slides were then washed with PBS for 10 minutes each time, for a total of three times. Afterwards, they were incubated with the corresponding secondary antibody at room temperature for two hours. Following the incubation, the slides were washed with PBS for 20 minutes each time, for a total of three times. The cell nuclei were then stained with Hochest 33342 (Thermo, H3570) at room temperature for 15 minutes. After staining with PBS, the slides were washed three times, mounted with anti-fluorescence quenching mounting medium, and then imaged using a confocal microscope (SP8, Leica). The staining results are shown below. Figure 6 As shown, this demonstrates that the prepared mouse iTSCs possess TSCs properties.

[0068] 2.2 Identification of the differentiation capacity of mouse iTSCs

[0069] Mouse trophoblast stem cells differentiated downwards. When the confluence of mouse iTSCs reached 70%, they were digested with 0.25% Trypsin-EDTA for 3 min, and digestion was terminated with serum. The cells were then injected with 3 × 10⁻⁶ cells. 5 Cells were seeded into wells at a density of 35 mm / well, and the culture medium was TSC basal medium without the addition of FGF-4 and Heparin.

[0070] TSCs basal medium: 77% RPMI 1640 (Gibco, 61870036), 20% fetal bovine serum, supplemented with 1% 100× antibiotics, 2 mM Glutamax, 0.11 mM β-mercaptoethanol, and 1 mM sodium pyruvate (Sigma, P4562).

[0071] Differentiation was completed after 6 days of culture. Cell morphology was observed under a microscope; differentiation was complete when the nucleus volume increased or multiple nuclei aggregated. Cells were fixed with PFA (Sigma, P6148) and identified by immunofluorescence staining. Results are as follows. Figure 7As shown, the cells obtained from the differentiation experiment can express TPBPA, PROLIFERIN, GCM1, and SDC1, indicating that mouse iTSCs have the ability to differentiate downwards.

[0072] Ploidy analysis was performed on mouse iTSCs differentiated at 0, 4, and 8 days. Cells differentiated at 0, 4, and 8 days were fixed with alcohol, stained with propidium iodide (Yeasen, 40710ES03) at a concentration of 3 μM, incubated at room temperature for 15 min, and then analyzed by flow cytometry. Results are shown below. Figure 8 As shown, diploid (2n), tetraploid (4n) and octoploid (8n) peak values ​​are indicated, with WT-TSCs as the control. The results show that as the number of differentiation days increases, the number of giant cells differentiated from mouse iTSCs gradually increases, further confirming the TSCs properties of the induced mouse iTSCs.

[0073] The embodiments of the present invention have been described in detail above, but the content described is only a preferred embodiment of the present invention and should not be considered as limiting the scope of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the patent coverage of the present invention.

Claims

1. A method for inducing mouse trophoblast stem cells in vitro, characterized in that: Sorcs3-KO ESCs were obtained by knocking out the Sorcs3 gene in mouse embryonic stem cells. After inducing and culturing the Sorcs3-KO ESCs, the antibody-CDCP1 positive cell population was screened and proliferated to obtain mouse trophoblast stem cells.

2. The method for inducing mouse trophoblast stem cells in vitro according to claim 1, characterized in that: The specific method is as follows: Step 1: Construct a plasmid for Sorcs3 gene knockout; Step 2: Electroporate the Sorcs3 gene knockout plasmid into mouse embryonic stem cells, culture and sort GFP-positive cells, and proliferate to obtain Sorcs3-KO ESCs; Step 3: Sorcs3-KO ESCs were cultured in mouse TSCs medium and induced for 7 days; antibody-CDCP1 positive cell populations were cultured and sorted, and mouse trophoblast stem cells were obtained after proliferation.

3. The method for inducing mouse trophoblast stem cells in vitro according to claim 2, characterized in that: In step one, two mouse Sorcs3-KO sgRNA sequences were designed and synthesized, named sg1 and sg2 respectively, as shown in SEQ ID No.1 and SEQ ID No.

2. sg1 and sg2 were ligated into an expression vector to construct a Sorcs3 gene knockout plasmid.

4. The method for inducing mouse trophoblast stem cells in vitro according to claim 3, characterized in that: The expression vector was PX458.

5. The method for inducing mouse trophoblast stem cells in vitro according to claim 2, characterized in that: In step two, the Sorcs3 gene knockout plasmid was electroporated into wild-type mouse embryonic stem cells. After transfection, the cells were cultured for 48 hours, and the cells were sorted by flow cytometry to separate GFP-positive cells and amplify them. The subclones derived from single cells were genotyped and sequenced to obtain Sorcs3-KO ESCs.

6. The method for inducing mouse trophoblast stem cells in vitro according to claim 2, characterized in that: In step three, the TSCs culture medium includes: 70% trophoblast stem cell basal culture medium, 30% conditioned medium CM, 25 ng / ml FGF-4 (MCE, HY-P7014), and 1 μg / ml Heparin (MCE, HY-17567A).

7. The method for inducing mouse trophoblast stem cells in vitro according to claim 6, characterized in that: When Sorcs3-KO ESCs reached a density of 60-70%, they were digested with 0.25% Trypsin-EDTA at a concentration of 3 × 10⁻⁶. 4 Each cell was seeded into a 6-well plate pre-coated with 0.2% gelatin, and the culture medium was TSCs medium, which was changed every two days. After 7 days of culture, CDCP1+ cells were sorted by flow cytometry. After the sorted cells were proliferated for 2-3 days, mouse trophoblast stem cells were obtained in vitro.

8. Mouse trophoblast stem cells prepared by the method for in vitro induction of mouse trophoblast stem cells according to any one of claims 1-7.

Citation Information

Patent Citations

  • SorCS1-like agent for use in the treatment of insulin resistance and diseases related thereto

    CN102647995A

  • Method for producing formative pluripotent stem cells capable of directly inducing primordial germ cells

    CN117242172A

  • Differentiation of human embryonic stem cells

    US20100015100A1

  • Differentiation of Human Embryonic Stem Cells

    US20100255580A1

  • Methods for generating formative pluripotent stem cells competent for direct primordial germ cell induction

    US20230392125A1

Cited By

  • Complete grape embryo-derived human trophoblast stem cell line and application thereof

    CN121592585A