Method and kit for detecting SNV of HLA-B*15: 02TA gene

By combining a blocking RPA and an inhibitory CRISPR-Cas12a system, double mismatch crRNA and a blocker were designed to achieve rapid and accurate detection of HLA-B*15:02TA gene SNVs. This solves the problems of complex operation and insufficient specificity in existing technologies and is suitable for miniaturization and point-of-care testing.

CN120989230APending Publication Date: 2025-11-21THE FIRST AFFILIATED HOSPITAL OF FUJIAN MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511136282.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-14
Publication Date
2025-11-21

AI Technical Summary

Technical Problem

现有HLA-B*15:02基因检测技术操作复杂、特异性和灵敏度不足,无法满足小型化和床边检测的需求,且CRISPR-Cas系统的脱靶效应导致信号与噪声比低,无法满足SNV诊断要求。

Method used

By combining repressive RPA technology with the inhibitory CRISPR-Cas12a system, a dual-recognition method for SNVs was constructed by designing double mismatched crRNAs and repressors. The repressive RPA was used to rapidly enrich MT, and the specific recognition capability of the inhibitory CRISPR-Cas12a was combined to achieve accurate detection of SNVs.

Benefits of technology

It simplifies the testing process, improves the specificity and sensitivity of the test, and can distinguish between the HLA-B*15:02TA mutant gene and the wild-type gene within 1 hour. It is suitable for miniaturization and point-of-care testing, reduces the detection limit, and reduces medical risks.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120989230A_ABST
    Figure CN120989230A_ABST
Patent Text Reader

Abstract

The invention relates to a method for detecting an SNV (Single Nucleotide Virus) of an HLA-B * 15: 02TA (Human Leukocyte Antigen-B * 15: 02TA gene. According to the method, rapid and accurate detection is realized on the basis of an RPA-CRISPR-Cas12a double-recognition SNV strategy; according to the method, RPA is combined with a CRISPR-Cas system, a new strategy for double recognition of SNV is adopted, and the fluorescent biosensor is constructed according to the new strategy: (1) a mismatched basic group is introduced into the first six spacer sequences of crRNA away from a target gene PAM sequence, so that the specific differentiation of a mutant gene (MT) and a wild gene (WT) is improved, which is the first recognition of SNV; and (2) rapidly enriching MT by using the retardation type RPA, namely identifying the SNV for the second time. Preferably, according to the method disclosed by the invention, the combination of the retarding type RPA and the inhibiting CRISPR-Cas12a is further carried out in a one-tube method, so that the rapid and accurate dual recognition of the SNV is realized. The rapid, accurate, simple and convenient detection of the HLA-B * 15: 02TA rash gene is realized, and the kit has a wide clinical application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, specifically to a method and kit for detecting HLA-B*15:02TA gene SNV. Background Technology

[0002] Due to the importance and necessity of HLA-B*15:02 gene testing in clinical applications, it has increasingly attracted the attention and exploration of researchers in recent years. The HLA-B*15:02 allele is strongly associated with Stevens-Johnson syndrome (SJS) induced by drugs such as carbamazepine, and carriers should avoid using these drugs. Performing this gene test on patients receiving carbamazepine treatment can effectively predict the risk of adverse drug reactions, provide guidance for clinical medication, and enhance the safety and efficacy of treatment.

[0003] Currently, clinical HLA-B*15:02 gene detection technologies have several shortcomings: sequencing methods are complex, have long reporting cycles, and require professional analysis and interpretation; PCR-fluorescent probe methods are difficult to design, low nucleic acid extraction concentrations may lead to false negatives, and require large-scale instruments, making them unsuitable for miniaturization; while fluorescence in situ hybridization (FISH) has good safety, high probe stability, and high specificity, and is widely used clinically, it also requires specialized instruments and laboratories, and has a long testing cycle. These factors limit routine clinical testing of the HLA-B*15:02 gene, therefore there is an urgent need to develop a new rapid and accurate detection method that is simple to operate, highly sensitive, highly specific, suitable for miniaturization, and convenient for point-of-care testing.

[0004] In recent years, CRISPR-Cas12a-based nanobiosensors have become a research hotspot in the field of molecular diagnostics. When a PAM sequence is present in the target DNA, the Cas12a-crRNA complex binds to double-stranded DNA, specifically cleaving the target, causing DNA strand breaks and generating sticky ends, while simultaneously releasing strong non-specific trans-cleavage activity. Using this complex as a recognition element in conjunction with fluorescence detection technology offers advantages such as speed, accuracy, and high specificity, and has been widely applied in SNV detection. Many Cas proteins, due to their sensitivity to mismatches, have been used for SNV detection, and the CRISPR-Cas system is often coupled with isothermal amplification technology. Utilizing the specific recognition and cleavage capabilities of Cas combined with the rapid amplification capabilities of isothermal amplification significantly improves the sensitivity and specificity of pathogen detection.

[0005] Despite the development of high-fidelity CRISPR / Cas systems, off-target effects remain a problem. For example, Cas9 has high tolerance to mismatches in the proximal region of the PAM, and Cas12a also has high tolerance to mismatches in the first 8 nucleotides (less than 4) of the proximal PAM, resulting in the inability to distinguish SNVs, a low signal-to-noise ratio, and failure to meet the diagnostic requirements for SNVs. Summary of the Invention

[0006] (a) Technical problems to be solved

[0007] In view of the shortcomings and deficiencies of the existing technology, the present invention provides a method and kit for detecting SNVs of the HLA-B*15:02TA gene. By combining the repressive RPA technology with the repressive CRISPR-Cas12a system, a dual-recognition SNV detection method is constructed. The repressive RPA is used to rapidly enrich MT, achieving accurate identification of SNVs for the first time during the target amplification stage. Combined with the specific recognition capability of the repressive CRISPR-Cas12a, a dual-recognition SNV strategy is constructed to solve the problems of complex operation, insufficient specificity and sensitivity of the existing detection methods.

[0008] (II) Technical Solution

[0009] In a first aspect, the present invention provides a method for detecting HLA-B*15:02TA gene SNV, characterized by comprising the following steps:

[0010] S1. Establish an inhibitory CRISPR-Cas12a recognition system

[0011] Design of double mismatch crRNAs: Introduce a mismatched base in the first six positions of the PAM sequence of C5-crRNA to obtain different double mismatch crRNAs;

[0012] The target gene DNA was mixed with double mismatched crRNA and Cas12a protein, and after denaturation and annealing, real-time fluorescence detection was performed at 37°C. The reaction process was continuously recorded using a fluorescence microplate reader to obtain time-fluorescence intensity curves for different double mismatched crRNAs. Then, the enzyme kinetic parameters of Cas12a were fitted using the Michaelis-Menten equation to screen for MT and WT. cat / K M The double mismatch crRNA with the highest ratio;

[0013] S2, blocking RPA, and inhibitory CRISPR-Cas12a enzyme cleavage dual recognition SNV

[0014] Design of the blocker sequence: Based on the thermodynamic stability of DNA double strands, the designed blocker satisfies the following condition: the T-phase binding of the blocker to WT. m Value T m blocker-WT The T value of the RPA amplification positive primer binding to WT is greater than that of the WT. m Value T m RP-WT And T m blocker-WT >T-blocker combined with MT m Value T mblocker-MT To achieve selective amplification of MT; this repressor is added to the RPA system to obtain a repressive RPA;

[0015] MT was enriched by amplifying with repressive RPA at 36-38℃ (preferably 37℃) for 15-25 min, and then mixed with CRISPR-Cas12a enzyme digestion solution containing S1-selected crRNA. Real-time fluorescence detection was performed at 36-38℃ to complete the dual recognition of SNV.

[0016] Preferably, in S1, the screening of double-mismatched crRNAs includes: calculating the k of Cas12a under different crRNA conditions using the Michaelis-Menten equation. cat / K M The value was used to select U3C5-crRNA, which has the strongest ability to distinguish between MT and WT, for the detection of S2; U3C5-crRNA indicates that a U mutation is introduced at the 3rd site from PAM, and the 5th site is the original C mutation site.

[0017] Preferably, in the repressive RPA amplification of S2, the repressor reacts with the WT template at a T0... m The value must satisfy: T m blocker-WT >T m RP-WT >T m blocker-MT This ensures that the inhibitor preferentially binds to the WT template, inhibiting WT template amplification. m blocker-WT T represents the binding of the inhibitor to WT. m Value; T m RP-WT T represents the binding of the RPA amplification positive primer to WT. m Value; T m blocker-MT T represents the binding of the inhibitor to MT. m value.

[0018] Preferably, the positive primer sequence is positive primer 1 or positive primer 2;

[0019] The sequence of positive primer 1 is CTGATGAGCCCCCGTTTAATCTAT, and the corresponding antagonist sequence is ATTTTTCCCACGTGTGCCCC-ddc.

[0020] The sequence of positive primer 2 is CTGATGAGCCCCCGTTTAATCT, and the corresponding antagonist sequence is CTATTTTTCCCACGTGTGCCCC-ddc.

[0021] The -ddc in the sequence represents dideoxycytosine nucleotide, which is a chain termination modification for DNA synthesis.

[0022] Preferably, the CRISPR-Cas12a digestion reaction solution of S2 contains: activated Cas12a protein, U3C5-crRNA and fluorescent reporter molecule.

[0023] Preferably, the fluorescent reporter molecule is FAM-TTATT-BHQ1.

[0024] Preferably, in S2, real-time fluorescence detection is performed using a real-time fluorescence quantitative PCR instrument at a reaction temperature of 37°C.

[0025] Preferably, in S2, the repressive RPA and CRISPR-Cas12a enzyme digestion reactions are performed in a single tube. Specifically, the RPA system is placed at the bottom of the reaction tube, and the Cas12a system is dropped onto the tube cap. After the RPA reaction is complete, the CRISPR-Cas12a enzyme digestion reaction solution and the RPA amplification product are mixed by brief centrifugation. After thorough mixing, fluorescence detection is performed, with the entire process conducted in a closed tube. This method avoids false positive or false negative results caused by aerosol contamination in POCT.

[0026] In a second aspect, the present invention provides a kit for implementing the method, characterized in that it comprises: U3C5-crRNA, a blocking RPA primer and a blocking agent, Cas12a protein, an RPA amplification enzyme mixture, and a fluorescent reporter molecule.

[0027] Preferably, the retardant is a single-stranded DNA designed for the HLA-B*15:02TA WT sequence, with a length of 15-25 nt and a TW. m The temperature is 5-10℃ higher than that of the positive primer.

[0028] Preferably, the RPA primers include positive primer 1 or positive primer 2;

[0029] The sequence of positive primer 1 is CTGATGAGCCCCCGTTTAATCTAT, and the corresponding antagonist sequence is ATTTTTCCCACGTGTGCCCC-ddc.

[0030] The sequence of positive primer 2 is CTGATGAGCCCCCGTTTAATCT, and the corresponding antagonist sequence is CTATTTTTCCCACGTGTGCCCC-ddc.

[0031] The -ddc in the sequence represents dideoxycytosine nucleotide, which is a chain termination modification for DNA synthesis.

[0032] Thirdly, the present invention provides a fluorescent reagent kit based on RPA-CRISPR-Cas12a dual recognition of SNVs, comprising:

[0033] Cas12a protein;

[0034] A crRNA complementary to the SNV site of the target gene, wherein the spacer sequence of the crRNA introduces at least one mismatch within the first 6 bases of the PAM sequence, and the mismatch is located at the 3rd base.

[0035] RPA amplification system is used for selective enrichment of mutant DNA;

[0036] FQ fluorescent probe;

[0037] The buffer system is designed to allow RPA and CRISPR-Cas12a to work synergistically in the same reaction tube.

[0038] The crRNA is selected from U3C5-crRNA and its functionally equivalent variants;

[0039] The target gene is the HLA-B*15:02TA gene, and its SNV site is located at the 5th base of the PAM sequence.

[0040] The RPA amplification system includes blocking primers containing modifying groups to inhibit wild-type DNA amplification.

[0041] (III) Beneficial Effects

[0042] The technical effects of this invention are as follows:

[0043] 1. This invention combines repressive RPA technology with an inhibitory CRISPR-Cas12a system to construct a dual-identification SNV detection method. On the one hand, this method utilizes repressive RPA to rapidly enrich MT, achieving accurate SNV identification for the first time during the target amplification stage. On the other hand, it combines the specific recognition capability of inhibitory CRISPR-Cas12a to construct a dual-identification strategy for SNVs.

[0044] 2. In constructing the repressive CRISPR-Cas12a system, given the limitation of Cas12a's poor specificity in distinguishing single base mismatches between MT and WT, this invention introduces a mismatched base in the six spacer sequences preceding the target gene's PAM sequence within the crRNA, improving the specificity for distinguishing MT and WT. This method is named repressive CRISPR-Cas12a. Five crRNAs were designed based on different mismatch sites, and the enzyme kinetic parameters (k) under different crRNA conditions were investigated. cat / K M By comparing the results, the crRNA with the strongest specific recognition of SNV was obtained, and a repressive CRISPR-Cas12a system was constructed using this crRNA. Among them, k cat / KM It is an important parameter in enzyme kinetics, which comprehensively reflects the enzyme's catalytic efficiency and substrate affinity, and can effectively measure the ability of Cas12a to cleave MT and WT sequences under different crRNA guidance.

[0045] 3. The repressive RPA incorporates an oligonucleotide (DNA blocker) that is complementary to the WT target in the reaction. Because the blocker contains a chemical modification (-ddc) at the 3' end, the oligonucleotide cannot be extended by polymerase, thereby inhibiting WT gene amplification and achieving large-scale recruitment of the MT target. This method achieves accurate identification of SNVs during the sample amplification stage.

[0046] This invention utilizes an RPA-CRISPR-Cas12a dual-recognition SNV strategy for rapid and accurate detection of HLA-B*15:02TA, effectively distinguishing between the HLA-B*15:02TA mutant gene (MT) and the wild-type gene (WT), and reducing detection time from 24 hours to 1 hour. This invention significantly simplifies the operational process, enabling this detection to be implemented in a wider range of environments, such as primary healthcare institutions or on-site testing scenarios. It has an extremely low detection limit (67.6 aM (>3σ)), allowing for rapid and accurate identification of individuals carrying the HLA-B*15:02 gene who may experience adverse reactions to specific drugs, thus facilitating preventative measures or treatment adjustments and reducing medical risks. Attached Figure Description

[0047] Figure 1 Design a mapping of crRNA locations to target genes.

[0048] Figure 2 The nonlinear fitting curves of FQ concentration versus reaction rate dCcl / dt for MT and WT under the condition of 4 crRNAs are shown.

[0049] Figure 3 To record the changes in real-time fluorescence signal generated by Cas12a nonspecific cleavage of FQ under single-error and double-error conditions using a real-time fluorescence quantitative PCR instrument; the real-time fluorescence curves of CRISPR-Cas12a (A) and inhibitory CRISPR-Cas12a (B) were compared to verify the feasibility of inhibitory CRISPR-Cas12a recognizing SNVs.

[0050] Figure 4To verify the feasibility of dual identification SNV detection based on RPA-CRISPR-Cas12a single-tube method, the real-time fluorescence curves of MT and WT with and without blocker were compared. A is the time-fluorescence curve of MT and WT without blocker; B is the time-fluorescence curve of MT and WT with blocker.

[0051] Figure 5 The fluorescence signals obtained by using the sensing method constructed in this invention to detect MT target samples with a series of concentration gradients (100 aM, 500 aM, 1 fM, 10 fM, 100 fM, 1 pM) are shown in Figure A. A represents the increase in fluorescence signal as the target concentration increases; B represents the fluorescence signal at 5 × 10⁻⁶ pM. -7 ~1×10 -3 Within the nM concentration range, the fluorescence signal values ​​corresponding to each concentration point show a good linear relationship with the logarithm of the target concentration.

[0052] Figure 6 The results show the experimental results of the sensor constructed in this invention for the high specificity detection of SNV in clinical samples; A is the result of setting the concentration of WT to 1 pM, gradually adjusting the ratio of WT to MT from 1:1 to 1000:1, monitoring the changes in fluorescence signal, and plotting the relationship curve between time and fluorescence signal; B is the result of the fluorescence signal value still exceeding the signal value of WT (1:0) when the concentration ratio of WT to MT reaches 1000:1 (1 fM MT).

[0053] Figure 7 The results show the anti-interference ability of the sensor constructed in this invention in simulated clinical samples. A shows that when the concentration of SDNA added to the standard increases but is below 30 ng / μL, the fluorescence signal is less affected, but when the concentration exceeds 30 ng / μL, the fluorescence value decreases significantly. B shows that when the SDNA concentration is 30 ng / μL, the detected fluorescence signal value is almost consistent with that of the blank sample without the target gene.

[0054] Figure 8 Using 10 fM MT as the target gene, six independent detection experiments were conducted under the same conditions. The endpoint fluorescence signal was collected and the RSD value was calculated.

[0055] Figure 9 A flowchart of a method for detecting SNVs of the HLA-B*15:02TA gene.

[0056] Figure 10A is a schematic diagram of a portable detector based on a dual-recognition SNV fluorescent biosensor using RPA-CRISPR-Cas12a; B is a confocal optical path diagram of the fluorescent detector; C is a structural diagram of the fluorescent detector; and D is a physical image of the portable fluorescent detector.

[0057] Figure 11 This is a standard curve showing the relationship between MT samples at a series of concentration gradients and fluorescence values.

[0058] Figure 12 This is the result of quantifying (5 ng / μL) genomic DNA extracted from human whole blood samples (containing 11 MT and 11 WT samples of the HLA-B*15:02TA gene) and adding it to the RPA system for detection and analysis. Detailed Implementation

[0059] To better explain and facilitate understanding of the present invention, the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0060] Research revealed that sequencing results of small RNA molecules extracted from Francisella novicida U112 cultures containing the CRISPR-Cas12a gene locus showed that the mature crRNA corresponding to Cas12a is 42-44 nt in length, with the first 19 / 20 nt corresponding to a repeat sequence and the remaining 23-25 ​​nt corresponding to a spacer sequence. Point mutations in the first 5 bases of the crRNA spacer sequence affect the cleavage activity of Cas12a; however, point mutations in subsequent bases have almost no effect on the cleavage activity. A crucial seed sequence, approximately 5-6 nt in length, exists near the PAM sequence of the target gene, ensuring the specificity of crRNA binding to the target DNA. Therefore, a mismatch (MT single mismatch, WT double mismatch) was introduced into the first 6 bases at the 5' end of the crRNA spacer sequence. Under the double mismatch condition, the cleavage activity of Cas12a against MT was not significantly inhibited, while this double mismatch significantly inhibited the activity of Cas12a against WT, thus constructing a repressive CRISPR-Cas12a system.

[0061] Rapid and efficient RPA (recombinase polymerase amplification) relies on the recognition of homologous sequences on the target gene by RP (recombinase protein), the stabilization of homologous sequences by single-strand binding proteins (SSBs), and the extension amplification of primers under the action of DNA polymerase. Therefore, introducing a DNA blocker to amplify and enrich the SNV target gene by regulating the above reaction stages, using a thermodynamic parameter related to the thermodynamic stability during DNA double-strand formation—the DNA double-strand melting temperature (T0). mThe design incorporates a nucleotide sequence with blocking properties. The DNA blocker is complementary to the WT target, located near the positive primer, and partially overlaps with it, preventing the positive primer from replacing the blocker as it extends along the template strand. Therefore, the double-stranded DNA complex (T0) formed by the DNA blocker and WT... m blocker-WT ) of T m The value needs to be greater than the complex of WT and the positive primer (T). m RP-WT ) of T m T m The value must satisfy: T m blocker-WT T m Value > T m RP-WT T m Value > T m blocker-MT T m In this case, during WT target amplification, the DNA blocker preferentially binds to the template strand under the action of recombinase, blocking the recruitment of the positive primer; simultaneously, because the DNA blocker contains a chemical modification at the 3' end (e.g., -dcc), it cannot be elongated by polymerase, thus inhibiting the amplification of the WT target and reducing the percentage of amplified WT alleles. Meanwhile, MT, due to a nucleotide mismatch with the DNA blocker, is not hindered by the extension of the positive primer, resulting in preferential amplification of a small number of MT alleles. The core components of the RPA amplification system include recombinase RP, single-stranded binding protein (SSB), DNA polymerase, primers (specifically binding to the target sequence), dNTPs (ATP / GTP / CTP / TTP mixture), and buffer (maintaining pH and ionic strength, containing Mg). 2+ ATP).

[0062] Based on the above principles, this invention provides a method for rapid and accurate detection of HLA-B*15:02TA using a dual RPA-CRISPR-Cas12a SNV identification strategy, comprising the following steps:

[0063] 1. Establish an inhibitory CRISPR-Cas12a recognition system

[0064] (1) Design a crRNA that is complementary to MT (with a base mismatch with WT) and name this crRNA C5-crRNA.

[0065] like Figure 1The diagram shows the matching relationship between the designed crRNA sites and the target genes. Using the HLA-B*15:02TA gene sequence as a template, a crRNA complementary to MT (with a one-base mismatch with WT) was designed. Since the SNV site is located at the 5th base from the PAM sequence, the mutation type is G>C, and this crRNA is named C5-crRNA. The present invention introduces one mismatch in each of the first 6 bases of the 5' end of the C5-crRNA spacer sequence (single mismatch for MT, double mismatch for WT). Five crRNAs were designed based on different mismatch positions: U1C5-crRNA, U2C5-crRNA, U3C5-crRNA, U4C5-crRNA, and A6C5-crRNA. The letter in the crRNA naming prefix indicates the base of the mutation site, and the subscript number represents the number of bases from the PAM at the mutation site. For example, U1C5-crRNA indicates that a U mutation is introduced at the first site from the PAM, and the 5th site is the original C mutation site; the rest follow the same pattern.

[0066] (2) The target gene DNA was mixed with the double mismatched crRNA and Cas12a protein, and after denaturation and annealing, real-time fluorescence detection was performed at 37°C. The reaction process was continuously recorded to obtain a time-fluorescence intensity curve. Then, the enzyme kinetic parameters of Cas12a were fitted by the Michaelis-Menten equation to screen for k-type proteins. cat / K M The double mismatch crRNA with the highest ratio was selected. This selected crRNA was then used in the next step of the CRISPR-Cas12a digestion reaction.

[0067] This step screened out double mismatch crRNAs with the highest discrimination between MT and WT, and quantified them using the Michaelis-Menten equation parameter to measure the affinity (K) of Cas12a for FQ under different double mismatch crRNA conditions. M ) and apparent catalytic efficiency (k cat / K M K M Information on Cas12a's affinity for FQ is provided, K M A smaller value means that Cas12a has a greater affinity for FQ. cat / K M A metric for the catalytic efficiency of Cas12a is provided. cat / K M A higher value means that Cas12a can catalyze the reaction more effectively at a given FQ concentration, reflecting the cleavage capacity of Cas12a.

[0068] Then, the nonlinear fitting curves of FQ concentration versus reaction rate under MT and WT double mismatch crRNA conditions were fitted using the enzyme digestion kinetic parameter calculation method, and the enzyme kinetic parameters of Cas12a under different double mismatch crRNA conditions were calculated.

[0069] like Figure 2 The figures show the nonlinear fitting curves of FQ concentration versus reaction rate dCcl / dt for MT and WT under four crRNA conditions. The nonlinear fitting curves for MT(A) and WT(B) under U2C5-crRNA conditions; for MT(C) and WT(D) under U3C5-crRNA conditions; for MT(E) and WT(F) under U4C5-crRNA conditions; and for MT(G) and WT(H) under A6C5-crRNA conditions. Error bars represent the standard deviation of three independent replicates.

[0070] Under double mismatch crRNA conditions, the affinity of Cas12a enzyme for MT was greater than that for WT (K0). M(MT) <K M(WT) For MT, the farther the mismatch site is from PAM, the greater K. M The larger k is cat The smaller, k cat / K M The smaller the value, the closer the SNV site in the seed sequence is to PAM, and the smaller its impact on Cas12a cleavage activity. For WT, in addition to the mismatch positions mentioned above, the effect of base stacking forces between different base pairs on Cas12a activity must also be considered. The greater the base stacking force, the greater the Cas12a cleavage activity against WT. Apart from the original mutation site, mismatches at positions 1, 2, and 4, and WT, are all GU base pairs; mismatches at position 3, and WT, are UU base pairs. The GU base stacking force is greater than that of UU, therefore the k value of U3C5-crRNA in WT is... cat / K M Minimum, k of U1C5-crRNA cat / K M Maximum. The k-values ​​of Cas12a against MT and WT under different crRNA conditions were compared. cat / K M Compared to MT, under the same conditions, the k-value of U3C5-crRNA / Cas12a for MT and WT were compared. cat / K M The highest ratio indicates that Cas12a has the best specificity for MT and WT under the U3C5-crRNA condition. Therefore, U3C5-crRNA was selected as the optimal experimental condition.

[0071] 2. Construct a fluorescence detection method for SNVs based on RPA-CRISPR-Cas12a dual recognition

[0072] First, the thermodynamic stability of the DNA double helix was tested, and a nucleotide sequence with retardation function was designed. The thermodynamic parameter is the melting temperature (T0) associated with DNA double helix formation. m This makes the Tm value of the double-stranded DNA complex formed by the repressor and WT greater than the Tm value of WT and the positive primer. m T m The value must satisfy: T m blocker-WT >T m RP-WT >T m blocker-MT In this scenario, the blocker dominates the binding to the template, while the primers remain in a free state due to the competitive inhibition of the blocker. Restrictive RPA rapidly enriches MT, achieving precise SNV identification for the first time during the target amplification stage. Combined with the specific recognition capability of repressive CRISPR-Cas12a (containing the crRNA selected in step 1, U3C5-crRNA), a dual SNV recognition strategy is constructed.

[0073] This invention provides a new strategy and approach for gene testing in patients using CBZ medication.

[0074] Definitions of terms used in this application:

[0075] MT and WT: Mutant type gene (MT) and Wild type gene (WT).

[0076] PAM sequence: The PAM sequence (TTTN) refers to the Protospacer Adjacent Motif (PAM), which plays an important role in the CRISPR-Cas system. When the target DNA contains a PAM sequence, the Cas12a-crRNA complex binds to the double-stranded DNA, specifically cleaving the target, causing DNA strand breaks and generating sticky ends. Simultaneously, it releases strong non-specific trans-cleavage activity.

[0077] Seed sequence: The seed sequence is a key sequence, approximately 5-6 nt, located near the PAM sequence of the target gene. This sequence ensures the specificity of the binding between the crRNA and the target DNA.

[0078] FQ probe: A short deoxyribonucleotide single strand modified at both ends with a fluorescent group (FAM) and a quencher group (BHQ1) serves as a fluorescent signal probe (FAM-ssDNA-BHQ1, FQ). Under normal conditions, the fluorescent group signal is effectively suppressed by the quencher group due to Forster Resonance Energy Transfer (FRET) and cannot be detected. When the Cas12a-crRNA complex recognizes and binds to the target gene, the nuclease activity of Cas12a is activated, non-specifically cleaving the fluorescent signal probe. This cleavage process disrupts the energy transfer pathway between the fluorescent group and the quencher group, thereby releasing a detectable fluorescent signal.

[0079] k cat / K M and K M Meaning: K M k is the affinity constant between the enzyme and its substrate. cat k is the enzyme catalytic constant. cat / K M k represents the apparent catalytic efficiency. cat / K M It is an important parameter in enzyme kinetics, which comprehensively reflects the enzyme's catalytic efficiency and substrate affinity, and can effectively measure the ability of Cas12a to cleave MT and WT sequences under different crRNA guidance.

[0080] Blocking RPA: A blocker is added to the RPA system to transform it into a blocking RPA. Blocking RPA rapidly enriches MT, achieving precise SNV identification for the first time during the target amplification phase. Combined with the specific recognition capability of inhibitory CRISPR-Cas12a, a dual SNV recognition strategy is constructed. This provides a reference for clinical detection of the HLA-B15:02TA gene (Target A), and offers strong laboratory evidence for the detection of another locus of the HLA-B15:02 gene (HLA-B*15:02TB). Furthermore, it expands new research directions for the detection of other SNVs and has potential clinical application value.

[0081] The reagents involved in this application and their sources are as follows:

[0082] LbCas12a(Cpf1) Nuclease was purchased from Shanghai Tulugang Biotechnology Co., Ltd.

[0083] All sequences used in the experiment were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Table 1 is a list of sequences used in the following implementation methods.

[0084] Table 1: Oligonucleotide probe sequences used in the experiment

[0085]

[0086] Note: Bold, underlined bases indicate mutation sites, and bold, boxed bases indicate mismatches introduced into crRNA.

[0087] Primer sequences used for RPA amplification: In this method, the DNA blocker is complementary to the WT target, located near the positive primer, and partially overlaps with it, thus preventing the positive primer from replacing the blocker after extension on the template strand. Nucleotide sequences with blocking effects are designed by testing the thermodynamic stability of the DNA double strand. The thermodynamic parameter is the melting temperature (T0) associated with DNA double strand formation. m This allows the T-cell structure of the double-stranded DNA complex formed by the inhibitor and WT to be activated. m The value is greater than WT and T for binding to the positive primer. m T m The value must satisfy: T m blocker-WT >T m RP-WT >T m blocker-MT In this scenario, the blocker dominates the binding to the template, while the primer remains free due to the competitive inhibition of the blocker. During WT target amplification, the blocker preferentially binds to the template strand under the action of recombinase, blocking the recruitment of the positive primer. Simultaneously, because the blocker contains a chemical modification at its 3' end, it cannot be elongated by polymerase, thus inhibiting WT target amplification and reducing the percentage of amplified WT alleles. Meanwhile, because MT has a nucleotide mismatch with the blocker, the extension of the positive primer is not blocked, leading to the preferential amplification of a minority of MT alleles.

[0088] According to T m Based on the design principles of RP (Programme Regression), the mutation site was designed as close to the center of the blocker as possible. The positive primer and blocker had two overlapping bases. The sequences of the blocker and positive primer were determined using AnnHyb software. Finally, two blockers that met the criteria and their corresponding positive primers were selected, as shown in Table 2.

[0089] Table 2: Blocker and its corresponding primers T m value

[0090]

[0091] Note: Black underlined bases indicate mutation sites. "-ddc" in the sequence represents dideoxycytosine nucleotides, which are chain termination modifications in DNA synthesis.

[0092] Components and proportions of the reaction system for repressive RPA (buffer solution, Mg) 2+ Prepare the following according to Table 3: First, prepare 40 μL of the retarding RPA amplification reaction solution, and then place the prepared reaction solution in a thermal cycler at 37 °C for 20 min.

[0093] Table 3: Composition of Restricted RPA Reaction Solution

[0094]

[0095] The CRISPR-Cas12a enzyme digestion reaction system was prepared according to Table 4.

[0096] First, prepare 10 μL of enzyme digestion reaction solution and drop it onto the cap of the RPA reaction tube. After the RPA reaction is completed, briefly centrifuge and quickly mix the enzyme digestion reaction solution with the RPA amplification product. Then, place the prepared reaction solution in a fully automated medical PCR instrument and perform real-time fluorescence detection at 37°C.

[0097] Table 4: Composition of CRISPR-Cas12a enzyme digestion reaction solution

[0098]

[0099] Example 1

[0100] In this embodiment, a real-time fluorescence quantitative PCR instrument was used to record the changes in real-time fluorescence signals generated by Cas12a nonspecific cleavage of FQ under single-error and double-error conditions. The real-time fluorescence curves of CRISPR-Cas12a (A) and inhibitory CRISPR-Cas12a (B) were compared to verify the feasibility of inhibitory CRISPR-Cas12a recognizing SNVs (see Table 4 for the CRISPR-Cas12a enzyme digestion reaction system).

[0101] like Figure 3 The image shows a comparison of real-time fluorescence curves for nonspecific cleavage of FQ by Cas12a under single-error and double-error crRNA conditions. MT / WT: 100 pM, Cas12a: 100 nM, crRNA: 120 nM, FQ: 100 nM. Error bands represent the standard deviation of three independent replicates.

[0102] As shown in the figure, the fluorescence signal curves of MT did not differ significantly under different crRNA conditions, while the signal of WT was significantly suppressed under the U3C5-crRNA condition. This is because the introduction of mismatches into the crRNA reduced the recognition ability of U3C5-crRNA for WT, inhibiting the cleavage activity of Cas12a on WT. However, MT with single-base mismatches was not significantly suppressed, indicating that the repressive CRISPR-Cas12a has strong specificity for MT, verifying the feasibility of this strategy for recognizing SNVs.

[0103] Example 2

[0104] To further verify the feasibility of dual SNV detection based on the RPA-CRISPR-Cas12a single-tube method, the real-time fluorescence curves of MT and WT under blocker-containing and blocker-free conditions were compared. The single-tube method involves: first, preparing 40 μL of the retarded RPA amplification reaction solution according to Table 3, and then incubating the prepared reaction solution in a thermal cycler at 37°C for 20 min. Simultaneously, preparing 10 μL of the enzyme digestion reaction solution according to Table 4, and adding it to the cap of the RPA reaction tube. After the RPA reaction is complete, briefly centrifuge to quickly mix the enzyme digestion reaction solution with the RPA amplification product. Then, place the prepared reaction solution in an automated medical PCR instrument for real-time fluorescence detection at 37°C.

[0105] like Figure 4 The image shows a comparison of the time-fluorescence curves of MT and WT with and without a blocker in a single-tube assay. A represents the time-fluorescence curves of MT and WT without a blocker; B represents the time-fluorescence curves of MT and WT with a blocker. MT / WT: 10 fM; Cas12a: 75 nM; U3C5-crRNA: 90 nM; FQ: 200 nM. The error bands represent the standard deviation of three independent replicates.

[0106] Depend on Figure 4 It was observed that, with and without the blocker, the fluorescence curve of MT continuously increased over time, eventually reaching a plateau, indicating that the cleavage efficiency of Cas12a on MT was not significantly inhibited by the blocker. In contrast, the fluorescence curve of WT became flat after the addition of the blocker, approaching a blank signal, indicating that the blocker effectively inhibited the amplification of the WT target. These results demonstrate that the one-tube strategy based on blocking RPA combined with CRISPR-Cas12a proposed in this study can be used for SNV identification.

[0107] Example 3

[0108] Prepare 50 μL of dsDNA target gene solution (MT or WT). Place the prepared reaction solution in a thermal cycler for reaction with the following parameters: (a) denaturation at 95℃ for 10 min, followed by annealing at room temperature for 10 min; (b) storage at 4℃. Prepare 5 μL of CRISPR-Cas12a restriction enzyme digestion solution and mix it with 45 μL of dsDNA target solution. Then, place the prepared reaction solution in an automated medical PCR instrument and perform real-time fluorescence detection at 37℃.

[0109] The detection system in this embodiment is as follows: First, prepare the reaction system for the blocking RPA according to Table 3. The positive primer sequence is CTGATGAGCCCCCGTTTAATCTAT (positive primer 1);

[0110] The inhibitor sequence was ATTTTTCCCACGTGTGCCCC-ddc. Simultaneously, the CRISPR-Cas12a restriction enzyme digestion reaction system was prepared according to Table 4, with the crRNA being U3C5-crRNA. The repressive RPA reaction system was first placed at the bottom of the reaction tube and incubated in a thermal cycler at 37°C for 20 min. Simultaneously, the enzyme digestion solution was dropped onto the cap of the RPA reaction tube. After the RPA reaction was completed, the enzyme digestion solution was briefly centrifuged to quickly mix with the RPA amplification product. The prepared reaction solution was then placed in an automated medical PCR instrument and real-time fluorescence detection was performed at 37°C, with the entire process conducted in a closed tube.

[0111] The following detection performance of the above detection system was examined:

[0112] (1) Sensitivity test

[0113] Under the selected optimal experimental conditions, this study used the constructed sensing method to detect MT target samples with a series of concentration gradients (100 aM, 500 aM, 1 fM, 10 fM, 100 fM, 1 pM) and recorded real-time fluorescence signals. Figure 5 The following graph shows the sensitivity evaluation: A represents the time-fluorescence signal curves for different concentrations of MT; B represents the relationship between the logarithm of MT concentration and the corresponding fluorescence signal values ​​at each concentration point. MT: 100 aM, 500 aM, 1 fM, 10 fM, 100 fM, 1 pM; Cas12a: 75 nM; crRNA: 90 nM; FQ: 200 nM; blocker: 200 nM; RP: 100 nM. Error bands (bars) represent the standard deviation of three independent replicate experiments.

[0114] like Figure 5 As shown in Figure A, the fluorescence signal increases with increasing target concentration. A graph is plotted with the logarithm of the target concentration on the x-axis and the fluorescence signal value corresponding to each concentration point on the y-axis. Figure 5 From B), we know that in 5×10 -7 ~1×10 -3 Within the nM concentration range, the fluorescence signal values ​​corresponding to each concentration point showed a good linear relationship with the logarithm of the target concentration, and the linear regression equation was F = 4146.55 + 578.09lgC. MT Correlation coefficient R 2=0.9904, and the limit of detection is 67.6 aM (>3σ). The results show that the sensor constructed in this scheme has high detection sensitivity and can accurately detect low concentrations of artificially synthesized target genes, and has the potential to detect actual clinical samples.

[0115] (2) Specificity investigation

[0116] Based on the composition ratio of genomic DNA in clinical samples, the aim is to verify the high specificity of the constructed sensor for SNV detection in clinical samples. Therefore, it is necessary to evaluate the detection capability for trace MT in a background of large amounts of WT.

[0117] In the specificity study, the concentration of WT was set to 1 pM, and the ratio of WT to MT was gradually adjusted from 1:1 to 1000:1. At the same time, the changes in fluorescence signal were monitored, and the relationship curve between time and fluorescence signal was plotted.

[0118] like Figure 6 The diagram shows the specificity evaluation. A represents the time-fluorescence signal curves of WT and MT at different concentration ratios; B represents the comparison of fluorescence values ​​of WT and MT at different concentration ratios after Cas12a digestion for 37 min. WT: 1 pM; MT: 1 fM, 10 fM, 100 fM, 1 pM; Cas12a: 75 nM; crRNA: 90 nM; FQ: 200 nM; blocker: 200 nM; RP: 100 nM. Error bands (bars) represent the standard deviation of three independent replicates. (*p < 0.05, **p < 0.01, ***p < 0.001)

[0119] like Figure 6 As shown in B, when the concentration ratio of the two reaches 1000:1 (1fM MT), its fluorescence signal value still exceeds that of 1pM WT (1:0), indicating that the method has strong specificity for MT and can be further applied to the detection of clinical samples.

[0120] (3) Anti-interference analysis

[0121] Because salmon sperm genomic DNA (SDNA) is homologous to human genomic DNA, a standard was added to the SDNA to simulate a clinical sample for interference resistance analysis.

[0122] The concentration of extracted human genomic DNA was determined using Nanodrop 2000, showing a range of 10 ng / μL to 150 ng / μL. Subsequently, the sDNA was diluted to different concentrations (5 ng / μL, 10 ng / μL, 20 ng / μL, 30 ng / μL, 50 ng / μL, 100 ng / μL, 200 ng / μL), and an appropriate amount of sDNA was added to the RPA system to assess its anti-interference properties. Figure 7 This is a graph showing the resistance to interference analysis. A shows the fluorescence signal values ​​of 10 fM MT standard at different concentrations (0, 5 ng / μL, 10 ng / μL, 20 ng / μL, 30 ng / μL, 50 ng / μL, 100 ng / μL, 200 ng / μL) in SDNA; B shows a comparison of fluorescence signal values ​​among four different samples. Error bars represent the standard deviation of three independent replicates. (*p < 0.05, **p < 0.01, ***p < 0.001)

[0123] like Figure 7 As shown in Figure A, with increasing SDNA concentration, the fluorescence signal is less affected when the concentration is below 30 ng / μL; however, when the concentration exceeds 30 ng / μL, the fluorescence value decreases significantly, indicating that the sensor has a certain degree of anti-interference capability in simulated clinical samples. Figure 7 As shown in Figure B, when the sDNA concentration was 30 ng / μL, the detected fluorescence signal value was almost identical to that of the blank sample without the target gene, indicating that the use of sDNA in the simulated sample was appropriate. Furthermore, after adding 10 fM MT standard, the fluorescence signal was not significantly different from that of the 1 pM MT standard, indicating that the sensor still exhibited good anti-interference performance even under conditions containing 30 ng / μL genomic DNA.

[0124] (4) Reproducibility test

[0125] To evaluate the stability and reliability of the sensor, its reproducibility was investigated. Using 10 fM MT as the target gene, six independent detection experiments were conducted under identical conditions, and endpoint fluorescence signals were collected. Figure 8 The figure shows the reproducibility test results, where all MT concentrations are 10 fM, and the error bars represent the standard deviation of six independent repeated trials. The calculated fluorescence signals for the six trials were 4460.61, 4219.76, 4383, 4284.36, 4204.88, and 4377.49, with an RSD of 2.35%. These results demonstrate that the fluorescent biosensor constructed in this study possesses high accuracy and good reproducibility, providing a reliable basis for subsequent clinical sample testing.

[0126] Example 4

[0127] This embodiment provides a procedure for real-time testing of clinical samples. For example... Figure 9 As shown, the detection procedure is as follows:

[0128] ① Sample collection: Collect blood samples from the human body (such as the arm) and extract nucleic acids (DNA, etc.).

[0129] ②RPA amplification: Add nucleic acid to the reaction system containing RPA reagent (as shown in Table 3), incubate at 37℃ for 30 min to amplify nucleic acid, and then briefly centrifuge (spin down) after amplification.

[0130] ③ Cas12a reaction: Transfer the RPA amplification product into a system containing the Cas12a system (as shown in Table 4), react at 37℃ for 20 min, and Cas12a will specifically recognize the target sequence (distinguishing between mutant MT and wild-type WT).

[0131] ④ Detection output:

[0132] Real-time detection: Using instruments (such as PCR instruments), the detection results of MT and WT are presented in real time through fluorescence curves, data, etc.

[0133] Endpoint detection: The endpoint fluorescence data can be read by an instrument, or the result can be judged by visually observing the fluorescence difference between MT and WT samples after blue light exposure.

[0134] In the testing of actual clinical samples, to avoid false positive or false negative results caused by aerosol contamination in point-of-care testing (POCT), a single-tube strategy was adopted to combine the RPA and CRISPR-Cas12a systems. Specifically, the RPA system was placed at the bottom of the reaction tube, and the Cas12a system was dropped onto the cap. After the RPA reaction was complete, the CRISPR-Cas12a enzyme digestion solution and the RPA amplification product were mixed by brief centrifugation. After thorough mixing, fluorescence detection was performed. The entire reaction process did not require opening the cap.

[0135] In other embodiments, a self-made portable fluorescence detector can be used to read the reaction endpoint signal, a method particularly suitable for point-of-care detection. The self-made portable fluorescence detector is shown in Figure 10. It is printed using 3D printing technology, and the various modules are assembled. The assembled model and the internal structure of the detection head are shown in Figures A and B. Figure A is a confocal optical path diagram of the fluorescence detector; Figure B is a structural diagram of the fluorescence detector; and Figure C is a physical image of the portable fluorescence detector.

[0136] Example 5

[0137] The detection system constructed in Example 2 was used to detect actual clinical samples. The detection process is as follows:

[0138] (1) Establishment of the standard curve for the fluorescence instrument

[0139] Construct standard curves for a series of MT samples with known concentration gradients. For example... Figure 11 As shown, when the MT concentration is 1×10 -6 ~1×10 -4 At nM, the fluorescence signal value is related to C MT It exhibits a good linear relationship (F = 160.6171 + 24.9745lgC). MT ), R 2 =0.9729, and the limit of detection is 372 aM (>3σ). These results demonstrate that the proposed detection method possesses high sensitivity and specificity.

[0140] (2) Clinical sample testing

[0141] Human whole blood samples were obtained from remaining blood samples used in HLA-B*15:02-related testing at the pharmacy department of a provincial-level tertiary hospital. Based on sequencing results, 22 samples were selected, including 11 MT and 11 WT samples of the HLA-B*15:02 TA gene. Genomic DNA extracted from each clinical sample was quantified (5 ng / μL) and added to the RPA system for analysis. The analysis results are shown below. Figure 12 .

[0142] Table 5: HLA-B*15:02TA gene sequencing results of 22 clinical samples.

[0143]

[0144]

[0145] like Figure 12 The detection results shown indicate that the signal values ​​of MT samples are generally higher than those of WT samples, with a significant difference between the two. This demonstrates that the detection system constructed in this invention can still detect SNVs in complex sample environments, even when faced with high concentrations of genomic DNA and residual reagents from the DNA extraction process in clinical samples. The sequencing results shown in Table 5 are also consistent with the results detected by the detection system of this invention. This further demonstrates that the dual-identification SNV detection system constructed in this invention has good sensitivity and specificity, and can be used for the detection of clinical samples, showing its great potential in the diagnosis of SNV-related diseases and personalized drug treatment.

[0146] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features. These modifications or substitutions, or combinations of technical features in the above embodiments that do not conflict with each other, can be made in accordance with the manner described in the embodiments. These modifications, substitutions or combinations do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for detecting HLA-B*15:02TA gene SNV, characterized in that, Includes the following steps: S1. Establish an inhibitory CRISPR-Cas12a recognition system Design of double mismatch crRNAs: Introduce a mismatched base in the first six positions of the PAM sequence of C5-crRNA to obtain different double mismatch crRNAs; The target gene DNA was mixed with double mismatch crRNA and Cas12a protein, and after denaturation and annealing, real-time fluorescence detection was performed at 37℃. The reaction process was continuously recorded to obtain time-fluorescence intensity curves of different double mismatch crRNAs. Then, the enzyme kinetic parameters of Cas12a were fitted using the Michaelis-Menten equation to screen for MT and WT. cat / K M The double mismatch crRNA with the highest ratio; S2, repressive RPA, and inhibitory CRISPR-Cas12a enzyme cleavage dual recognition SNV Design of the blocker sequence: Based on the thermodynamic stability of DNA double strands, the designed blocker satisfies the following condition: the T-phase binding of the blocker to WT. m Value T m blocker-WT The T value of the RPA amplification positive primer binding to WT is greater than that of the WT. m Value T m RP-WT And T m blocker-WT >T m blocker-MT To achieve selective amplification of MT; the repressor is added to the RPA system to obtain a repressive RPA; MT was enriched by amplifying with repressive RPA at 36-38℃ for 15-25 min, and then mixed with CRISPR-Cas12a enzyme digestion solution containing S1-selected crRNA. Real-time fluorescence detection was performed at 36-38℃ to complete dual recognition of SNV.

2. The method according to claim 1, characterized in that, In S1, the screening of double mismatched crRNAs includes: calculating the k of Cas12a under different crRNA conditions using the Michaelis-Menten equation. cat / K M The value was used to select U3C5-crRNA, which has the strongest ability to distinguish between MT and WT, for the detection of S2; U3C5-crRNA indicates that a U mutation is introduced at the 3rd site from PAM, and the 5th site is the original C mutation site.

3. The method according to claim 1, characterized in that, In the repressive RPA amplification of S2, the repressor reacts with the WT template at T... m The value must satisfy: T m blocker-WT >T m RP-WT >T m blocker-MT This ensures that the inhibitor preferentially binds to the WT template and inhibits WT template amplification; T m blocker-WT T represents the binding of the inhibitor to WT. m Value; T m RP-WT T represents the binding of the RPA amplification positive primer to WT. m Value; T m blocker-MT T represents the binding of the inhibitor to MT. m value.

4. The method according to claim 2, characterized in that, The CRISPR-Cas12a digestion solution in S2 contains: activated Cas12a protein, U3C5-crRNA, and a fluorescent reporter molecule; preferably, the fluorescent reporter molecule is FAM-TTATT-BHQ1.

5. The method according to claim 3, characterized in that, The positive primers for RPA amplification are either positive primer 1 or positive primer 2; The sequence of positive primer 1 is CTGATGAGCCCCCGTTTAATCTAT, and the corresponding antagonist sequence is ATTTTTCCCACGTGTGCCCC-ddc. The sequence of positive primer 2 is CTGATGAGCCCCCGTTTAATCT, and the corresponding antagonist sequence is CTATTTTTCCCACGTGTGCCCC-ddc; The -ddc in the sequence represents dideoxycytosine nucleotide, which is a chain termination modification for DNA synthesis.

6. The method according to claim 1, characterized in that, In S2, real-time fluorescence detection was performed using a real-time quantitative PCR instrument at a reaction temperature of 37℃.

7. The method according to claim 1, characterized in that, In S2, the repressive RPA and CRISPR-Cas12a enzyme digestion reactions are carried out in a single tube. The specific method is as follows: place the RPA system at the bottom of the reaction tube and drop the Cas12a system onto the tube cap; after the RPA reaction is completed, mix the CRISPR-Cas12a enzyme digestion reaction solution and the RPA amplification product by short-term centrifugation, mix thoroughly, and then perform fluorescence detection. The entire process is carried out in a closed tube.

8. A kit for implementing the method according to claims 1-7, characterized in that, Contains: U3C5-crRNA, repressive RPA primers and repressor, Cas12a protein, RPA amplification enzyme mixture, and fluorescent reporter molecule; the repressor is a single-stranded DNA designed for the HLA-B*15:02TA WT sequence, 15-25 nt in length, T m The temperature is 5-10℃ higher than that of the positive primer.

9. The reagent kit according to claim 8, characterized in that, Restrictive RPA primers contain either positive primer 1 or positive primer 2; The sequence of positive primer 1 is CTGATGAGCCCCCGTTTAATCTAT, and the corresponding antagonist sequence is ATTTTTCCCACGTGTGCCCC-ddc. The sequence of positive primer 2 is CTGATGAGCCCCCGTTTAATCT, and the corresponding antagonist sequence is CTATTTTTCCCACGTGTGCCCC-ddc; The -ddc in the sequence represents dideoxycytosine nucleotide, which is a chain termination modification for DNA synthesis.

10. A fluorescent reagent kit based on RPA-CRISPR-Cas12a dual recognition of SNVs, characterized in that, include: Cas12a protein; A crRNA complementary to the SNV site of the target gene, wherein the spacer sequence of the crRNA introduces at least one mismatch within the first 6 bases of the PAM sequence, and the mismatch is located at the 3rd base. RPA amplification system is used for selective enrichment of mutant DNA; FQ fluorescent probe; The buffer system is designed to allow RPA and CRISPR-Cas12a to work synergistically in the same reaction tube. The crRNA is selected from U3C5-crRNA and its functionally equivalent variants; The target gene is the HLA-B*15:02TA gene, and its SNV site is located at the 5th base of the PAM sequence. The RPA amplification system includes repressive primers containing modifying groups to inhibit wild-type DNA amplification.