Composition for detecting lung cancer and application thereof

By detecting the methylation status of the HOXB4, SHOX2, and PTGER4 genes, this method addresses the invasiveness and low sensitivity issues of existing lung cancer detection methods, providing a non-invasive and sensitive early lung cancer screening method that improves the accuracy and efficiency of detection.

CN120989247APending Publication Date: 2025-11-21BIOCHAIN BEIJING SCI & TECH
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511452882.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-11
Publication Date
2025-11-21

AI Technical Summary

Technical Problem

Existing lung cancer detection methods suffer from problems such as high invasiveness, high false positive rate, and low sensitivity, making it difficult to meet the needs of early screening and diagnosis.

Method used

Using target sequences of the HOXB4, SHOX2, and PTGER4 genes as methylation markers, the methylation status of circulating cell-free DNA in plasma was detected using in vitro detection technology with nucleic acid compositions and kits. Amplification and detection were performed using bisulfite reagent and DNA polymerase.

Benefits of technology

It enables non-invasive, sensitive, and specific lung cancer detection, improving the lung cancer detection rate and is suitable for early screening and real-time monitoring of asymptomatic individuals.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention provides a composition for detecting lung cancer and application thereof, the composition comprises nucleic acid for detecting the methylation state of a target gene, the methylation state of the target gene is characterized by methylation of a target sequence of the target gene, and the target gene is an HOXB4 gene, an SHOX2 gene and a PTGER4 gene. The invention also provides a kit comprising the composition, and application of the composition in preparation of a kit for in-vitro detection of lung cancer.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology, and relates to gene detection, in particular to a nucleic acid composition for detecting lung cancer related gene methylation and a corresponding kit and use thereof. BACKGROUND

[0002] Lung cancer is a malignant tumor originating from the bronchial mucosa or glands of the lung, and is one of the malignant tumors with the fastest growing incidence and mortality, and the greatest threat to human health and life. At present, the technical means for early screening and diagnosis of lung cancer in clinical application mainly include imaging examination, hematological examination and pathological examination, etc., but these means have certain limitations: such as pathological examination by obtaining lung cancer tissue through surgery or puncture is the gold standard for the diagnosis of lung cancer, but it has problems such as great difficulty in operation, great trauma to patients and heterogeneity of tissue detection; at present, the imaging examination mainly uses low-dose spiral CT (LDCT) to perform chest scanning, which can improve the detection rate of early lung cancer and reduce the overall lung cancer mortality, but its high false positive rate and possible radiation damage are also a concern; the commonly used serum tumor markers in clinical practice, such as lung cancer five items (CEA, CYFRA21-1, SCC, Pro-GRP, NSE), are used as auxiliary diagnostic means for lung cancer, but the detection sensitivity of these traditional serum tumor markers for early lung cancer is low, which cannot meet the requirements of early screening.

[0003] In recent years, more and more studies have shown that DNA methylation is closely related to the occurrence and development of diseases such as lung cancer. As one of the research focuses in the field of epigenetics, DNA methylation refers to the process in which the 5' cytosine in the CpG dinucleotide on the genomic DNA sequence is converted to 5' methylcytosine under the catalysis of DNA methyltransferase. It has been confirmed that abnormal hypermethylation in the promoter region of tumor suppressor genes will inhibit the transcription of the corresponding tumor suppressor genes, reduce or silence gene expression, lead to the weakening or loss of the anticancer function of the gene, and further promote the occurrence and development of lung cancer. Abnormal methylation of DNA usually occurs in the super-early stage of cancer, is a "seed" factor for tumor growth, and with the development of cancer course, the methylation state of DNA also changes dynamically, which can directly reflect the growth of tumor lesions, therefore, the use of DNA methylation detection for early screening and auxiliary diagnosis of lung cancer has great application potential.

[0004] An important way to achieve early screening of lung cancer is liquid biopsy based on gene sequencing technology, in which the sample for detection is mainly circulating free DNA (cfDNA) in peripheral blood. Part of the cfDNA is produced and released during the apoptosis or necrosis of cancer cells, which is called circulating tumor DNA (ctDNA). The methylation abnormality of specific sites on ctDNA represents the occurrence and development of cancer. Therefore, using plasma cfDNA as the detection sample and combining with methylation gene markers with high sensitivity and specificity for lung cancer detection can achieve early screening and auxiliary diagnosis of lung cancer. SUMMARY

[0005] In view of the defects of the existing detection methods, the purpose of the present application is to provide a new biomolecular marker with high diagnostic value for lung cancer, to achieve non-invasive detection of lung cancer in vitro, and to improve the detection rate of lung cancer.

[0006] The specific technical solutions of the present application are as follows: 1. A composition for detecting lung cancer in vitro, the composition comprising: a nucleic acid for detecting the methylation state of a target gene, wherein the methylation state of the target gene is represented by the methylation of a target sequence of the target gene, and the target gene is HOXB4 gene, SHOX2 gene and PTGER4 gene.

[0007] 2. The composition according to item 1, wherein the target sequence of the HOXB4 gene is as shown in any one of SEQ ID NO: 1-4 or the target sequence of the HOXB4 gene comprises a sequence as shown in any one of SEQ ID NO: 1-4.

[0008] 3. The composition according to item 1, wherein the target sequence of the SHOX2 gene is as shown in any one of SEQ ID NO: 5-8 or the target sequence of the SHOX2 gene comprises a sequence as shown in any one of SEQ ID NO: 5-8.

[0009] 4. The composition according to item 1, wherein the target sequence of the PTGER4 gene is as shown in any one of SEQ ID NO: 9-12 or the target sequence of the PTGER4 gene comprises a sequence as shown in any one of SEQ ID NO: 9-12.

[0010] 5. The composition of any one of items 1-4, wherein the nucleic acid for detecting the methylation status of the target gene comprises a primer that is a fragment of at least 9 nucleotides in a target sequence of the target gene, the fragment comprising at least one CpG dinucleotide sequence.

[0011] 6. The composition of any one of items 1-5, wherein the nucleic acid for detecting the methylation status of the target gene comprises a probe that is a fragment of at least 15 nucleotides in a target sequence of the target gene, the fragment comprising at least one CpG dinucleotide sequence, under medium stringency or high stringency conditions.

[0012] 7. The composition of any one of items 1-6, further comprising a reagent for converting a 5-position unmethylated cytosine base of a target sequence of the target gene to a uracil.

[0013] 8. The composition of any one of items 1-7, wherein the nucleic acid for detecting the methylation status of the target gene further comprises a blocker that preferentially binds to the target sequence in an unmethylated state.

[0014] 9. The composition of item 8, wherein the fragment of at least 9 nucleotides is a sequence of SEQ ID NO: 13 and SEQ ID NO: 14, or a sequence of SEQ ID NO: 16 and SEQ ID NO: 17, or a sequence of SEQ ID NO: 19 and SEQ ID NO: 20.

[0015] 10. The composition of item 8, wherein the fragment of at least 15 nucleotides is a sequence of SEQ ID NO: 15, or a sequence of SEQ ID NO: 18, or a sequence of SEQ ID NO: 21.

[0016] 11. An oligonucleotide for detecting lung cancer in vitro, comprising: a fragment of at least 9 nucleotides in a sequence as set forth in any one of SEQ ID NOs: 1-4 or a complement thereof and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in a sequence as set forth in any one of SEQ ID NOs: 5-8 or a complement thereof and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in a sequence as set forth in any one of SEQ ID NOs: 9-12 or a complement thereof and comprising at least one CpG dinucleotide sequence.

[0017] 12. The oligonucleotide of item 11, further comprising: a fragment that hybridizes under medium stringency or high stringency conditions to at least 15 nucleotides in the sequence as set forth in any one of SEQ ID NOs: 1-4, or the complement thereof, and comprises at least one CpG dinucleotide sequence; and / or a fragment that hybridizes under medium stringency or high stringency conditions to at least 15 nucleotides in the sequence as set forth in any one of SEQ ID NOs: 5-8, or the complement thereof, and comprises at least one CpG dinucleotide sequence; and / or a fragment that hybridizes under medium stringency or high stringency conditions to at least 15 nucleotides in the sequence as set forth in any one of SEQ ID NOs: 9-12, or the complement thereof, and comprises at least one CpG dinucleotide sequence.

[0018] 13. The oligonucleotide of item 11, further comprising: a blocker that preferentially binds to a target sequence in an unmethylated state.

[0019] 14. An oligonucleotide for detecting lung cancer in vitro, comprising: the sequence of SEQ ID NO: 13 and SEQ ID NO: 14.

[0020] 15. The oligonucleotide of item 14, further comprising: the sequence of SEQ ID NO: 15.

[0021] 16. An oligonucleotide for detecting lung cancer in vitro, comprising: the sequence of SEQ ID NO: 16 and SEQ ID NO: 17.

[0022] 17. The oligonucleotide of item 16, further comprising: the sequence of SEQ ID NO: 18.

[0023] 18. An oligonucleotide for detecting lung cancer in vitro, comprising: the sequence of SEQ ID NO: 19 and SEQ ID NO: 20.

[0024] 19. The oligonucleotide of item 18, further comprising: the sequence of SEQ ID NO: 21.

[0025] 20. A kit comprising the composition of any one of items 1-10 or the oligonucleotide of any one of items 11-19.

[0026] 21. The kit of item 20, further comprising at least one additional component selected from the group consisting of: nucleotides, a DNA polymerase, and a buffer required for the function of the DNA polymerase.

[0027] 22. The kit of any one of items 20 or 21, wherein the sample for detection comprises a cell line, a histological section, a tissue biopsy / paraffin-embedded tissue, a body fluid, a stool, a colonic effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or a combination thereof.

[0028] 23. The kit of any one of items 20 to 22, further comprising an instruction.

[0029] 24. Use of the composition of any one of items 1 to 10 or the oligonucleotide of any one of items 11 to 19 in the manufacture of a kit for in vitro detection of lung cancer.

[0030] 25. The use of item 24, wherein the kit for in vitro detection of lung cancer detects lung cancer by a method comprising the following steps: 1) isolating a DNA sample comprising a target sequence of a target gene or a fragment thereof from a biological sample to be tested; 2) determining the methylation status of the target sequence of the target gene; 3) determining the state of the biological sample by the detection result of the methylation status of the target sequence of the target gene, thereby achieving in vitro detection of lung cancer.

[0031] 26. The use of item 25, wherein the method comprises the following steps: extracting genomic DNA of the biological sample to be tested; treating the extracted genomic DNA with a reagent to convert 5 unmethylated cytosine bases to uracil or other bases; contacting the reagent-treated DNA sample with a DNA polymerase and primers of the target sequence of the target gene to perform a DNA polymerization reaction; detecting the amplification product with a probe; and determining the methylation status of at least one CpG dinucleotide of the target sequence of the target gene based on whether the amplification product is present.

[0032] 27. The use of item 26, wherein the reagent is a bisulfite reagent.

[0033] 28. Use of the HOXB4 gene, the SHOX2 gene, and the PTGER4 gene in the manufacture of a kit for in vitro detection of lung cancer.

[0034] 29. The use of item 28, wherein the target sequence of the HOXB4 gene is set forth in any one of SEQ ID NOs: 1-4 or the target sequence of the HOXB4 gene comprises a sequence set forth in any one of SEQ ID NOs: 1-4.

[0035] 30. The use of clause 28, wherein the target sequence of the SHOX2 gene is as set forth in any one of SEQ ID NOs: 5-8 or the target sequence of the SHOX2 gene comprises a sequence as set forth in any one of SEQ ID NOs: 5-8.

[0036] 31. The use of clause 28, wherein the target sequence of the PTGER4 gene is as set forth in any one of SEQ ID NOs: 9-12 or the target sequence of the PTGER4 gene comprises a sequence as set forth in any one of SEQ ID NOs: 9-12.

[0037] The present application has the following beneficial effects: The present application screens the lung cancer related markers HOXB4 gene, SHOX2 gene and PTGER4 gene which can be sensitively and specifically detected, and determines the target sequence of the related marker abnormal methylation, which can sensitively and specifically detect the methylation state of the gene. The composition described in the present application is used for screening of asymptomatic population in a non-invasive manner, has the characteristics of non-invasiveness, and can realize real-time monitoring. Therefore, the present application provides a composition, kit and detection method for in vitro detection of lung cancer, which can conveniently, quickly and effectively detect lung cancer, and has important clinical application value. BRIEF DESCRIPTION OF DRAWINGS

[0038] Figure 1 Detection results of the methylation state of the HOXB4-1 gene in the mixture of human genomic DNA methylation transferase treatment product and healthy human WBC cell line genomic DNA.

[0039] Figure 2 Detection results of the methylation state of the HOXB4-2 gene in the mixture of human genomic DNA methylation transferase treatment product and healthy human WBC cell line genomic DNA.

[0040] Figure 3 Detection results of the methylation state of the HOXB4-3 gene in the mixture of human genomic DNA methylation transferase treatment product and healthy human WBC cell line genomic DNA.

[0041] Figure 4 Detection results of the methylation state of the SHOX2 gene in the mixture of human genomic DNA methylation transferase treatment product and healthy human WBC cell line genomic DNA.

[0042] Figure 5 Detection results of the methylation state of the PTGER4 gene in the mixture of human genomic DNA methylation transferase treatment product and healthy human WBC cell line genomic DNA.

[0043] Figure 6 HOXB4-1 gene methylation status in the genomic DNA of WBC cell lines of healthy people.

[0044] Figure 7 HOXB4-2 gene methylation status in the genomic DNA of WBC cell lines of healthy people.

[0045] Figure 8 HOXB4-3 gene methylation status in the genomic DNA of WBC cell lines of healthy people.

[0046] Figure 9 SHOX2 gene methylation status in the genomic DNA of WBC cell lines of healthy people.

[0047] Figure 10 PTGER4 gene methylation status in the genomic DNA of WBC cell lines of healthy people. DETAILED DESCRIPTION

[0048] The present application is described in detail below. While the application is presented in terms of specific embodiments, it should be appreciated that the application can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided so that this application will be thorough and complete, and fully convey the scope of the application to those skilled in the art.

[0049] The practice of the present application will employ, unless otherwise indicated, conventional molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and genetic techniques within the scope of the present application. Such techniques are explained fully in the literature, for example, Molecular Cloning: A Laboratory Manual, Second Ed. (Sambrook et al., 1989); Oligonucleotide Synthesis (M.J. Gait, 1984); Animal Cell Culture (R.I. Freshney, 1987); the Methods in Enzymology series (Academic Press, Inc.); Current Protocols in Molecular Biology (F.M. Ausubel et al., 1987 and periodic updates); PCR: The Polymerase Chain Reaction (Mullis et al., 1994). Primers, probes, blockers and kits used in the present application can be prepared using standard techniques known in the art.

[0050] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0051] Definitions "Pre-cancerous" in the context of the present application means a cell that is in an early stage of transformation into a cancer cell or that is predisposed to transform into a cancer cell. Such a cell can exhibit one or more phenotypic traits characteristic of a cancer cell.

[0052] "Stringent hybridization conditions" and "high stringency" in the context of the present application refer to conditions under which a probe will hybridize to its target subsequence, typically in a complex mixture of nucleic acids. Stringent conditions are sequence dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids can be found in Tijssen, Techniques in Biochemistry and Molecular Biology - Hybridization of Nucleic Acids, "Overview of principles of hybridization and the

[0053] Also, nucleic acids that do not hybridize under stringent conditions are still substantially similar if the polypeptides that they encode are substantially similar, i.e., when compared and considered in the context of the sequence relationship between the nucleic acids and the polypeptides they encode. In this situation, typically, the nucleic acids are hybridized under moderately stringent hybridization conditions. As an example, "moderately stringent hybridization conditions" include hybridization in 40% formamide, 1 M NaCl, 1% SDS at 37°C, and washing in 1 x SSC at 45°C. Guidance in obtaining appropriate conditions of hybridization can be found in the present art, as can be apparent to the ordinarily skilled artisan. For PCR, temperatures of around 36°C are typically used for low stringency amplification, while annealing temperatures range from 32°C to 48°C depending on primer length. For high stringency PCR amplification, 62°C is typical, while annealing temperatures for high stringency hybridization range from 50°C to 65°C depending on primer length and specificity. Cycling conditions for both low and high stringency amplification typically include: denaturation at 90-95°C for 30 seconds to 2 minutes, annealing for 30 seconds to 2 minutes, and extension at about 72°C for 1 to 2 minutes. Tools and guidance for low and high stringency amplification reactions are available in the present art.

[0054] An "oligonucleotide" in the present application refers to a molecule composed of two or more nucleotides, preferably three or more nucleotides, the precise size of which can depend on a number of factors, which in turn are determined by the ultimate function and use of the oligonucleotide. In certain embodiments, an oligonucleotide can include a length of 10 nucleotides to 100 nucleotides. In certain embodiments, an oligonucleotide can include a length of 10 nucleotides to 30 nucleotides, or can have a length of 20 and 25 nucleotides. In some particular embodiments, oligonucleotides shorter than these lengths are also suitable.

[0055] A "primer" in the present application refers to an oligonucleotide, whether occurring in nature or synthesized, which, when placed in a suitable environment, such as in the presence of nucleotides and an agent for inducing synthesis of a primer extension product complementary to a strand of a nucleic acid, and at a suitable temperature and pH, is an initiation point for synthesis of a desired extension product. The primer can be single-stranded or double-stranded, and must be sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent. The exact length of primer will depend on many factors, including temperature, source of primer, and the method used. For diagnostic and prognostic applications, for example, oligonucleotide primers typically contain at least or more than about 9, 10, or 15, or 20, or 25 or more nucleotides, although they can contain fewer or more nucleotides. Factors involved in determining the appropriate length of a primer are well known to those skilled in the art.

[0056] "Primer pair" of the present application means a pair of primers that hybridize to opposite strands of a target DNA molecule or to a target DNA region flanking the nucleotide sequence to be amplified.

[0057] "Primer site" of the present application means the region of a target DNA or other nucleic acid to which a primer hybridizes.

[0058] "Probe" of the present application, when referring to a nucleic acid sequence, is used in its ordinary sense to mean a selected nucleic acid sequence that, under specified conditions, is capable of hybridizing to a target sequence and can be used to detect the presence of that target sequence. A probe is a single- or double-stranded DNA of several tens to several hundreds or even thousands of base pairs in length that can bind (hybridize) to a complementary, non-labeled single-stranded DNA or RNA in a sample to be tested by means of the denaturation, renaturation, and high precision of base pairing of molecules, forming a double-stranded complex (hybrid). Those skilled in the art will appreciate that in some cases a probe can also be used as a primer, and a primer can also be used as a probe.

[0059] "DNA methylation" of the present application refers to the addition of a methyl group to the 5 position of a cytosine (C), which is usually (but not necessarily) in the context of a CpG (cytosine followed by guanine) dinucleotide. As a relatively stable modification state, it can be inherited to the newly born daughter DNA during the process of DNA replication under the action of DNA methyltransferase, and is an important epigenetic mechanism. When DNA is methylated, methylation of the promoter region of a gene can lead to transcriptional silencing of a tumor suppressor gene, and thus it is closely related to the occurrence of tumors. Abnormal methylation, including hypermethylation of tumor suppressor genes and DNA repair genes, hypomethylation of repetitive sequence DNA, and loss of imprinting of certain genes, is associated with the occurrence of various tumors. "Increased methylation level" or "significant methylation level" as used herein means that there is at least one methylated cytosine nucleotide in the DNA sequence, wherein the corresponding C in a normal control sample (e.g., a DNA sample extracted from a non-cancerous cell or tissue sample or a DNA sample treated for methylation of DNA residues) is non-methylated, and in certain embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more C can be methylated, wherein the C at these positions in the control DNA sample is non-methylated.

[0060] In embodiments, a variety of different methods can be used to detect DNA methylation alterations. Methods for detecting DNA methylation include, for example, methylation sensitive restriction endonuclease (MSRE) assays using southern or polymerase chain reaction (PCR) analysis, methylation specific or methylation sensitive PCR (MS-PCR), methylation sensitive single nucleotide primer extension (Ms-SnuPE), high resolution melting (HRM) analysis, bisulfite sequencing, pyrosequencing, methylation specific single strand conformation analysis (MS-SSCA), combined bisulfite restriction analysis (COBRA), methylation specific denaturing gradient gel electrophoresis (MS-DGGE), methylation specific melting curve analysis (MS-MCA), methylation specific denaturing high performance liquid chromatography (MS-DHPLC), methylation specific microarray (MSO). These assays can be PCR based, quantitative using fluorescent labels, or southern blotting.

[0061] A "methylation assay" of the application refers to any assay that determines the methylation state of one or more CpG dinucleotide sequences within a DNA sequence.

[0062] "Detecting" of the application means any process of observing a marker or a change in a marker (e.g., a change in methylation state of a marker or expression level of a nucleic acid or protein sequence) in a biological sample, whether or not the marker or change in marker is actually detected. In other words, the act of probing a sample for a marker or change in a marker is "detecting," even if the marker is determined to be absent or below a level of sensitivity. Detection can be quantitative, semi-quantitative, or non-quantitative observation, and can be based on comparison to one or more control samples. It is understood that detecting lung cancer as disclosed herein includes detecting precancerous cells that are beginning to develop into or will develop into lung cancer cells, or have an increased propensity to develop into lung cancer cells. Detecting lung cancer can also include detecting a possible probability of death or a possible prognosis of a disease condition.

[0063] "Identity" and "similarity" in the context of the present application refer to sequence similarity between two nucleic acid molecules. "Identity" or "similarity" can be measured by comparing the positions in each sequence that are aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base, then the molecules are identical at that position. When the same or a similar amino acid (e.g., similar in steric properties or charge properties) occupies a position in the compared sequences, the molecules can be referred to as homologous (similar) at that position. Expression as a percentage of homology / similarity or identity refers to the number of identical or similar amino acids at positions shared by the compared sequences as a function of the number of positions in the compared sequences. "Unrelated" or "nonhomologous" sequences share less than 40% identity, preferably less than 25% identity, with the sequences of the present application. In comparing two sequences, the presence of gaps or the presence of extra residues in one sequence relative to the other sequence also decreases the identity and homology / similarity. In specific embodiments, two or more sequences or subsequences are substantially or significantly homologous, similar or identical when, using BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or as determined by manual alignment and visual inspection, for example, as provided on-line by the National Center for Biotechnology Information (NCBI), their sequences are about 60% identical, or about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identical over a comparison window, or designated region in which the sequence is being compared. The definition also relates to, or can be used to test, the complement of a sequence. Thus, to the extent permitted by the context, a nucleotide sequence complementary to a specified target sequence or variant thereof is itself considered "similar" to the target sequence, and when referring to "similar" nucleic acid sequences, includes single-stranded sequences, their complements, duplexed strand complexes, sequences capable of encoding the same or similar polypeptide products, and any permissible variants of any of the foregoing. Situations in which similarity must be limited to analysis of a single nucleic acid strand sequence can include, for example, detection and quantitation of expression of a particular RNA sequence or coding sequence in a cell. The definition also includes sequences with deletions and / or additions as well as substitutions.In embodiments, the identity or similarity can be over a region of at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 10, 21, 22, 23, 24, 25, or more nucleotides in length, or over a region of more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or more than about 100 nucleotides in length.

[0064] "Amplification" as used herein refers to the process of obtaining multiple copies from a particular genome of a nucleic acid, such as genomic DNA or cDNA. Amplification can be achieved using any of a variety of known means, including but not limited to polymerase chain reaction (PCR), transcription-based amplification, and strand displacement amplification (SDA).

[0065] "Fluorescence-based real-time PCR" as used herein refers to a method in which a fluorescent moiety is added to the PCR reaction mixture, the entire PCR process is monitored in real time using the accumulation of fluorescence signal, and unknown templates are quantified by standard curves at the end of the PCR. In this PCR technique, there is an important concept, cycle threshold, also called Ct value. C stands for Cycle, t stands for threshold, and the meaning of Ct value is: the cycle number when the fluorescence signal in each reaction tube reaches the set threshold. For example, the method of setting the fluorescence threshold is as follows: the fluorescence signal of the first 15 cycles of PCR reaction is taken as the fluorescence background signal, and the default setting of the fluorescence threshold is 10 times the standard deviation of the fluorescence signal of 3-15 cycles.

[0066] "Cut off value" of real-time PCR as used herein refers to a critical Ct value for judging the positivity or negativity of a sample for a certain biomarker. According to certain embodiments of the present application, the "cut off value is obtained based on statistical processing according to a certain amount of sample data", and the cut off value can be different according to the required sensitivity or specificity.

[0067] "Sensitivity" as used herein refers to the proportion of cancer detected from a certain cancer sample, and the calculation formula is: sensitivity = (detected cancer / all cancer), and "specificity" refers to the proportion of normal detected from a certain healthy sample, and the calculation formula is: specificity = (detected negative / total negative).

[0068] A "label" or "detectable moiety" of the present application is a component that can be detected by spectroscopic, photochemical, biochemical, immunochemical, chemical or other physical means. For example, useful labels include32P, fluorescent dyes, electron-dense reagents, enzymes (for example, as commonly used in an ELISA), biotin, digoxigenin or haptens and can be made detectable by incorporating radiolabels into peptides or by using antibodies that are specifically reactive with the peptides.

[0069] A variety of different methods can be used to detect nucleic acid molecules. Nucleic acid detection methods include, for example, PCR and nucleic acid hybridization (e.g., Southern blot, Northern blot, or in situ hybridization). In particular, oligonucleotides (e.g., oligonucleotide primers) capable of amplifying a target nucleic acid can be used in a PCR reaction. PCR methods generally include the steps of obtaining a sample, isolating nucleic acid (e.g., DNA, RNA, or both) from the sample, and contacting the nucleic acid with one or more oligonucleotide primers that specifically hybridize to the template nucleic acid under conditions that allow amplification of the template nucleic acid to occur. In the presence of the template nucleic acid, an amplification product is produced. Conditions for nucleic acid amplification and detection of amplification products are known to those of skill in the art. A variety of modifications to basic PCR technology have been developed, including, but not limited to, anchor PCR, RACE PCR, RT-PCR, and ligase chain reaction (LCR). Primer pairs in amplification reactions must anneal to opposite strands of the template nucleic acid and should be held at an appropriate distance from one another so that a polymerase can efficiently polymerize across the region and so that the amplification product can be readily detected, e.g., using electrophoresis. For example, computer programs such as OLIGO (Molecular Biology Insights Inc., Cascade, Colo.) can be used to design oligonucleotide primers to aid in the design of primers with similar melting temperatures. Typically, oligonucleotide primers are 9-30 or 40 or 50 nucleotides in length (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length), although oligonucleotide primers can be longer or shorter, provided that appropriate amplification conditions are used.

[0070] Detection of amplification products or hybridization complexes is typically accomplished using a detectable label. The term "label", when referring to a nucleic acid, is intended to include direct labeling of a nucleic acid by coupling (i.e., physically linking) a detectable substance to the nucleic acid, as well as indirect labeling of the nucleic acid by reactivity with another reagent that is directly labeled with a detectable substance. Detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; examples of suitable prosthetic groups include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; examples of luminescent materials include luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin. An example of indirect labeling includes terminal labeling of a nucleic acid with biotin so that the nucleic acid can be detected with fluorescently labeled avidin.

[0071] SUMMARY Liquid biopsy technology is to take blood, saliva, urine and other body fluids as test materials, and take tumor markers as detection indicators to realize early screening and diagnosis of cancer, auxiliary staging, prognosis and recurrence monitoring, drug guidance, etc. It has the advantages of non-invasiveness, high efficiency and accuracy. Among them, the abnormal change of DNA methylation level as a tumor molecular diagnosis marker is one of the current research hotspots and gradually becomes the consensus of the scientific and medical communities. DNA methylation is an important epigenetic modification and is involved in the regulation of various cellular processes, including embryonic development, gene transcription, X chromosome inactivation, genomic imprinting, chromatin structure stability, etc. Therefore, DNA methylation abnormalities are closely related to the occurrence of complex human diseases. In normal cells, cytosine in CpG islands and some CG-rich sites is usually non-methylated, while cytosine bases in regions with low CG proportion are mostly in a highly methylated state. However, in various cancers, the methylation pattern is exactly the opposite. Many studies have shown that high methylation of CpG islands can inhibit or silence the expression of some tumor suppressor genes and DNA mismatch repair genes, while low methylation of other regions of the genome can promote the expression of proto-oncogenes, which can give normal cells carcinogenic properties and promote the occurrence of cancer. In addition, abnormal DNA methylation usually occurs in the super-early stage of cancer and is a "seed" factor for tumor growth. As the cancer progresses, the methylation state of DNA also changes dynamically, which can directly reflect the growth of tumor lesions. Therefore, DNA methylation detection has great application potential for early screening and auxiliary diagnosis of cancer.

[0072] In one aspect, the present application provides a composition for detecting lung cancer in vitro, the composition comprising a nucleic acid for detecting methylation status within a target sequence of a target gene, wherein the target gene methylation status is characterized by methylation of the target sequence of the target gene, and wherein the target gene is HOXB4 gene, SHOX2 gene and PTGER4 gene.

[0073] The present application provides a group of target sequences of target genes abnormally methylated in lung cancer, including target sequences of HOXB4 gene, SHOX2 gene and PTGER4 gene, the target sequence of HOXB4 gene is shown in any one of SEQ ID NO: 1-4 or comprises a sequence shown in any one of SEQ ID NO: 1-4, the target sequence of SHOX2 gene is shown in any one of SEQ ID NO: 5-8 or comprises a sequence shown in any one of SEQ ID NO: 5-8, and the target sequence of PTGER4 gene is shown in any one of SEQ ID NO: 9-12 or comprises a sequence shown in any one of SEQ ID NO: 9-12.

[0074] It will also be appreciated by one of skill in the art that the target sequences of the HOXB4 gene, the SHOX2 gene, the PTGER4 gene are not limited to the specific sequences listed above. The target sequences of the HOXB4 gene should encompass sequences comprising one or two or three or more nucleotide mutations compared to the sequence set forth in any one of SEQ ID NOs: 1-4, but which are substantially identical in essential function, sequences comprising 95%, 96%, 97%, 98%, or 99% sequence identity compared to the sequence set forth in any one of SEQ ID NOs: 1-4, sequences comprising a deletion of one or more nucleotides, an addition of one or more nucleotides, or a substitution of one or more nucleotides from the nucleotide sequence set forth in any one of SEQ ID NOs: 1-4, but which have 90%, 91%, 92%, 93%, 94%, 95%, or 96% or 97% or 98% or 99% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 1-4. The target sequences of the SHOX2 gene should encompass sequences comprising one or two or three or more nucleotide mutations compared to the sequence set forth in any one of SEQ ID NOs: 5-8, but which are substantially identical in essential function, sequences comprising 95%, 96%, 97%, 98%, or 99% sequence identity compared to the sequence set forth in any one of SEQ ID NOs: 5-8, sequences comprising a deletion of one or more nucleotides, an addition of one or more nucleotides, or a substitution of one or more nucleotides from the nucleotide sequence set forth in any one of SEQ ID NOs: 5-8, but which have 90%, 91%, 92%, 93%, 94%, 95%, or 96% or 97% or 98% or 99% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 5-8. The target sequences of the PTGER4 gene should encompass sequences comprising one or two or three or more nucleotide mutations compared to the sequence set forth in any one of SEQ ID NOs: 9-12, but which are substantially identical in essential function, sequences comprising 95%, 96%, 97%, 98%, or 99% sequence identity compared to the sequence set forth in any one of SEQ ID NOs: 9-12, sequences comprising a deletion of one or more nucleotides, an addition of one or more nucleotides, or a substitution of one or more nucleotides from the nucleotide sequence set forth in any one of SEQ ID NOs: 9-12, but which have 90%, 91%, 92%, 93%, 94%, 95%, or 96% or 97% or 98% or 99% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 9-12.

[0075] The target sequence of HOXB4-1 (5'-3') is as follows: CAAAAAAGAACTCATAGCCATTAATTTCTGGGAATTGCCCACAAAATATACTAAAATTTATTCCGACCCCTGACTCGTTTTCCTGTTTCCGAAAGCCCTCCTACTTACTGTCAAGTGAACAAAGTTAGGCGCCCACGTGATCCTCCGAGCCAATGGCCGCCCCGCCTGCGATTCCCGGATAAGGAAATCTGCTCACCCGGACCCCACTCCAGCCAAAGAGGTTTATTTCCCCTTCTTCCCTTCCCCCTCCCCACCCACCCACCCAACACCAGGATTTACATAGGGCTCCTGCGGGGCGACCCCCTCCTTGCCTCGCTCTCTCCGGGATCAGAGAGAGAGCGAGAGAGAGAGCGCGCGCAGGTTGCGACTGGAGGGCCTGTTGGGGCGCTAGGCAGAGCGCAAACCCTAGATCCC (SEQ ID NO: 1) The complement of the target sequence of HOXB4-1 (5’-3’) is as follows: GGGATCTAGGGTTTGCGCTCTGCCTAGCGCCCCAACAGGCCCTCCAGTCGCAACCTGCGCGCGCTCTCTCTCTCGCTCTCTCTCTGATCCCGGAGAGAGCGAGGCAAGGAGGGGGTCGCCCCGCAGGAGCCCTATGTAAATCCTGGTGTTGGGTGGGTGGGTGGGGAGGGGGAAGGGAAGAAGGGGAAATAAACCTCTTTGGCTGGAGTGGGGTCCGGGTGAGCAGATTTCCTTATCCGGGAATCGCAGGCGGGGCGGCCATTGGCTCGGAGGATCACGTGGGCGCCTAACTTTGTTCACTTGACAGTAAGTAGGAGGGCTTTCGGAAACAGGAAAACGAGTCAGGGGTCGGAATAAATTTTAGTATATTTTGTGGGCAATTCCCAGAAATTAATGGCTATGAGTTCTTTTTTG (SEQ ID NO: 2) The sequence of the target sequence of HOXB4-1 after bisulfite treatment (5’-3’) is as follows: TAAAAAAGAATTTATAGTTATTAATTTTTGGGAATTGTTTATAAAATATATTAAAATTTATTTCGATTTTTGATTCGTTTTTTTGTTTTCGAAAGTTTTTTTATTTATTGTTAAGTGAATAAAGTTAGGCGTTTACGTGATTTTTCGAGTTAATGGTCGTTTCGTTTGCGATTTTCGGATAAGGAAATTTGTTTATTCGGATTTTATTTTAGTTAAAGAGGTTTATTTTTTTTTTTTTTTTTTTTTTTTTTTATTTATTTATTTAATATTAGGATTTATATAGGGTTTTTGCGGGGCGATTTTTTTTTTGTTTCGTTTTTTTCGGGATTAGAGAGAGAGCGAGAGAGAGAGCGCGCGTAGGTTGCGATTGGAGGGTTTGTTGGGGCGTTAGGTAGAGCGTAAATTTTAGATTTT (SEQ ID NO: 3) The sequence of the complementary sequence of the target sequence of HOXB4-1 after bisulfite treatment (5'-3') is as follows: GGGATTTAGGGTTTGCGTTTTGTTTAGCGTTTTAATAGGTTTTTTAGTCGTAATTTGCGCGCGTTTTTTTTTCGTTTTTTTTTTGATTTCGGAGAGAGCGAGGTAAGGAGGGGGTCGTTTCGTAGGAGTTTTATGTAAATTTTGGTGTTGGGTGGGTGGGTGGGGAGGGGGAAGGGAAGAAGGGGAAATAAATTTTTTTGGTTGGAGTGGGGTTCGGGTGAGTAGATTTTTTTATTCGGGAATCGTAGGCGGGGCGGTTATTGGTTCGGAGGATTACGTGGGCGTTTAATTTTGTTTATTTGATAGTAAGTAGGAGGGTTTTCGGAAATAGGAAAACGAGTTAGGGGTCGGAATAAATTTTAGTATATTTTGTGGGTAATTTTTAGAAATTAATGGTTATGAGTTTTTTTTTG (SEQ ID NO: 4) The target sequence of the SHOX2 gene (5'-3') is as follows: ATTCCCAGAAGGCTGGCTCGTTCTCAGGCCAGCTCTCACCACCGCTGGCTCTCTGCCTACCGCAAACTTGCTGGTCTAATTTAGGAACAATTGGGCCGAAAGGTATCAGCGAGAGCAACAGACCCCGGTGTTGTGCCGCACAGGGAGCCGCATCCGCAGACGCCCCTCGCTGCCCCTGGGCTCGGGCCAAACCCTGCATAAGGTCCCCTGGACAGCCAGGTAATCTCCGTCCCGCCTGCCCGACCGGGGTCGCACGAGCACAGGCGCCCACGCCATGTTGGCTGCCCAAAGGGCTCGCCGCCCAAGCCGGGCCAGAAGGCAGGAGGCGGAAAACCAGCCTCCGGTGGCGGGCGAAAGCAACCGCTCTTTCTGTTCTCTCTTCGCCCTCCCTCGTGGAAACGCAGACTCGACCCTAAACGCTTAACCCACAGAGATCAACAGGTTCAAGCGGAATATTCGCGATCCTCGGTTTCTATTGGTTGCTCAAAGCCTTTTCAT (SEQ ID NO: 5) The complement of the target sequence of the SHOX2 gene (5'-3') is as follows: ATGAAAAGGCTTTGAGCAACCAATAGAAACCGAGGATCGCGAATATTCCGCTTGAACCTGTTGATCTCTGTGGGTTAAGCGTTTAGGGTCGAGTCTGCGTTTCCACGAGGGAGGGCGAAGAGAGAACAGAAAGAGCGGTTGCTTTCGCCCGCCACCGGAGGCTGGTTTTCCGCCTCCTGCCTTCTGGCCCGGCTTGGGCGGCGAGCCCTTTGGGCAGCCAACATGGCGTGGGCGCCTGTGCTCGTGCGACCCCGGTCGGGCAGGCGGGACGGAGATTACCTGGCTGTCCAGGGGACCTTATGCAGGGTTTGGCCCGAGCCCAGGGGCAGCGAGGGGCGTCTGCGGATGCGGCTCCCTGTGCGGCACAACACCGGGGTCTGTTGCTCTCGCTGATACCTTTCGGCCCAATTGTTCCTAAATTAGACCAGCAAGTTTGCGGTAGGCAGAGAGCCAGCGGTGGTGAGAGCTGGCCTGAGAACGAGCCAGCCTTCTGGGAAT (SEQ ID NO: 6) The sequence of the target sequence of the SHOX2 gene after bisulfite treatment (5'-3') is as follows: ATTTTTAGAAGGTTGGTTCGTTTTTAGGTTAGTTTTTATTATCGTTGGTTTTTTGTTTATCGTAAATTTGTTGGTTTAATTTAGGAATAATTGGGTCGAAAGGTATTAGCGAGAGTAATAGATTTCGGTGTTGTGTCGTATAGGGAGTCGTATTCGTAGACGTTTTTCGTTGTTTTTGGGTTCGGGTTAAATTTTGTATAAGGTTTTTTGGATAGTTAGGTAATTTTCGTTTCGTTTGTTCGATCGGGGTCGTACGAGTATAGGCGTTTACGTTATGTTGGTTGTTTAAAGGGTTCGTCGTTTAAGTCGGGTTAGAAGGTAGGAGGCGGAAAATTAGTTTTCGGTGGCGGGCGAAAGTAATCGTTTTTTTTGTTTTTTTTTCGTTTTTTTTCGTGGAAACGTAGATTCGATTTTAAACGTTTAATTTATAGAGATTAATAGGTTTAAGCGGAATATTCGCGATTTTCGGTTTTTATTGGTTGTTTAAAGTTTTTTTAT (SEQ ID NO: 7) The sequence of the complementary sequence of the target sequence of the SHOX2 gene after bisulfite treatment (5' - 3') is as follows: ATGAAAAGGTTTTGAGTAATTAATAGAAATCGAGGATCGCGAATATTTCGTTTGAATTTGTTGATTTTTGTGGGTTAAGCGTTTAGGGTCGAGTTTGCGTTTTTACGAGGGAGGGCGAAGAGAGAATAGAAAGAGCGGTTGTTTTCGTTCGTTATCGGAGGTTGGTTTTTCGTTTTTTGTTTTTTGGTTCGGTTTGGGCGGCGAGTTTTTTGGGTAGTTAATATGGCGTGGGCGTTTGTGTTCGTGCGATTTCGGTCGGGTAGGCGGGACGGAGATTATTTGGTTGTTTAGGGGATTTTATGTAGGGTTTGGTTCGAGTTTAGGGGTAGCGAGGGGCGTTTGCGGATGCGGTTTTTTGTGCGGTATAATATCGGGGTTTGTTGTTTTCGTTGATATTTTTCGGTTTAATTGTTTTTAAATTAGATTAGTAAGTTTGCGGTAGGTAGAGAGTTAGCGGTGGTGAGAGTTGGTTTGAGAACGAGTTAGTTTTTTGGGAAT (SEQ ID NO: 8) The target sequence of the PTGER4 gene (5'-3') is as follows CCGACCTGTTGGGCACTTTGTTGGTGAGCCCGGTGACCATCGCCACGTACATGAAGGGCCAATGGCCCGGGGGCCAGCCGCTGTGCGAGTACAGCACCTTCATTCTGCTCTTCTTCAGCCTGTCCGGCCTCAGCATCATCTGCGCCATGAGTGTCGAGCGCTACCTGGCCATCAACCATGCCTATTTCTACAGCCACTACGTGGACAAGCGATTGGCGGGCCTCACGCTCTTTGCAGTCTATGCGTCCAACGTGCTCTTTTGCGCGCTGCCCAACATGGGTCTCGGTAGCTCGCGGCTGCAGTACCCAGACACCTGGTGCTTCATCGACTGGACCACCAACGTGACGGCGCACGCCGCCTACTCCTACATGTACGCGGGCTTCAGCTCCTTCCTCATTCTCGCCACCGTCCTCTGCAACGTGCTTGTGTGCGGCGCGCTGCTCCGCATGCACCGCCAGTTCATGCGCCGCACCTCGCTGGGCACCGAGCAGCACCACGCGGCCG (SEQ ID NO: 9) The complement of the target sequence of the PTGER4 gene (5'-3') is as follows: CGGCCGCGTGGTGCTGCTCGGTGCCCAGCGAGGTGCGGCGCATGAACTGGCGGTGCATGCGGAGCAGCGCGCCGCACACAAGCACGTTGCAGAGGACGGTGGCGAGAATGAGGAAGGAGCTGAAGCCCGCGTACATGTAGGAGTAGGCGGCGTGCGCCGTCACGTTGGTGGTCCAGTCGATGAAGCACCAGGTGTCTGGGTACTGCAGCCGCGAGCTACCGAGACCCATGTTGGGCAGCGCGCAAAAGAGCACGTTGGACGCATAGACTGCAAAGAGCGTGAGGCCCGCCAATCGCTTGTCCACGTAGTGGCTGTAGAAATAGGCATGGTTGATGGCCAGGTAGCGCTCGACACTCATGGCGCAGATGATGCTGAGGCCGGACAGGCTGAAGAAGAGCAGAATGAAGGTGCTGTACTCGCACAGCGGCTGGCCCCCGGGCCATTGGCCCTTCATGTACGTGGCGATGGTCACCGGGCTCACCAACAAAGTGCCCAACAGGTCGG (SEQ ID NO: 10) The sequence of the target sequence of the PTGER4 gene after bisulfite treatment (5'-3') is as follows: TCGATTTGTTGGGTATTTTGTTGGTGAGTTCGGTGATTATCGTTACGTATATGAAGGGTTAATGGTTCGGGGGTTAGTCGTTGTGCGAGTATAGTATTTTTATTTTGTTTTTTTTTAGTTTGTTCGGTTTTAGTATTATTTGCGTTATGAGTGTCGAGCGTTATTTGGTTATTAATTATGTTTATTTTTATAGTTATTACGTGGATAAGCGATTGGCGGGTTTTACGTTTTTTGTAGTTTATGCGTTTAACGTGTTTTTTTGCGCGTTGTTTAATATGGGTTTCGGTAGTTCGCGGTTGTAGTATTTAGATATTTGGTGTTTTATCGATTGGATTATTAACGTGACGGCGTACGTCGTTTATTTTTATATGTACGCGGGTTTTAGTTTTTTTTTTATTTTCGTTATCGTTTTTTGTAACGTGTTTGTGTGCGGCGCGTTGTTTCGTATGTATCGTTAGTTTATGCGTCGTATTTCGTTGGGTATCGAGTAGTATTACGCGGTCG (SEQ ID NO: 11) The sequence of the complementary sequence of the target sequence of the PTGER4 gene after bisulfite treatment (5'-3') is as follows: CGGTCGCGTGGTGTTGTTCGGTGTTTAGCGAGGTGCGGCGTATGAATTGGCGGTGTATGCGGAGTAGCGCGTCGTATATAAGTACGTTGTAGAGGACGGTGGCGAGAATGAGGAAGGAGTTGAAGTTCGCGTATATGTAGGAGTAGGCGGCGTGCGTCGTTACGTTGGTGGTTTAGTCGATGAAGTATTAGGTGTTTGGGTATTGTAGTCGCGAGTTATCGAGATTTATGTTGGGTAGCGCGTAAAAGAGTACGTTGGACGTATAGATTGTAAAGAGCGTGAGGTTCGTTAATCGTTTGTTTACGTAGTGGTTGTAGAAATAGGTATGGTTGATGGTTAGGTAGCGTTCGATATTTATGGCGTAGATGATGTTGAGGTCGGATAGGTTGAAGAAGAGTAGAATGAAGGTGTTGTATTCGTATAGCGGTTGGTTTTCGGGTTATTGGTTTTTTATGTACGTGGCGATGGTTATCGGGTTTATTAATAAAGTGTTTAATAGGTCGG (SEQ ID NO: 12) The target sequence for HOXB4-2 (5’-3’) is as follows: CGGGCTGGGGTGCAGGGGGTTCTGGGCGCAGGGAGGCGGCGGGGGGCTGCTGCTGACCGCCTCGCAGCGCTGGCCGGGCTCCGGGAGGAGGGCCCCGGCGGGTGGCGGCGCAGGAGCCCGAGGGGACAGACCGGGCGGTGGCGGGGGCGGCGGGGGTGGTGGCGGAGGCGGCGGGGGCCCAGGGTCCCGGCAGGCCGCGTAGCGCTGCACGGTGCACGCCGCGCGCCGCCCGAAGCCCGCCTCCGGCTGGAAGCTGCTCTCTCGCCTCTGGCCGCCGGCGTAGTACCCGGGCGAGTGGTCGCTGGGTAGGTAATCGCTCTGTGAATATTCCTCGCATGGAGGGAAC (SEQ ID NO: 25) The complement of the target sequence for HOXB4-2 (5’-3’) is as follows: GTTCCCTCCATGCGAGGAATATTCACAGAGCGATTACCTACCCAGCGACCACTCGCCCGGGTACTACGCCGGCGGCCAGAGGCGAGAGAGCAGCTTCCAGCCGGAGGCGGGCTTCGGGCGGCGCGCGGCGTGCACCGTGCAGCGCTACGCGGCCTGCCGGGACCCTGGGCCCCCGCCGCCTCCGCCACCACCCCCGCCGCCCCCGCCACCGCCCGGTCTGTCCCCTCGGGCTCCTGCGCCGCCACCCGCCGGGGCCCTCCTCCCGGAGCCCGGCCAGCGCTGCGAGGCGGTCAGCAGCAGCCCCCCGCCGCCTCCCTGCGCCCAGAACCCCCTGCACCCCAGCCCG (SEQ ID NO: 26) The sequence of the target sequence of HOXB4-2 after bisulfite treatment (5'-3') is as follows: CGGGTTGGGGTGTAGGGGGTTTTGGGCGTAGGGAGGCGGCGGGGGGTTGTTGTTGATCGTTTCGTAGCGTTGGTCGGGTTTCGGGAGGAGGGTTTCGGCGGGTGGCGGCGTAGGAGTTCGAGGGGATAGATCGGGCGGTGGCGGGGGCGGCGGGGGTGGTGGCGGAGGCGGCGGGGGTTTAGGGTTTCGGTAGGTCGCGTAGCGTTGTACGGTGTACGTCGCGCGTCGTTCGAAGTTCGTTTTCGGTTGGAAGTTGTTTTTTCGTTTTTGGTCGTCGGCGTAGTATTCGGGCGAGTGGTCGTTGGGTAGGTAATCGTTTTGTGAATATTTTTCGTATGGAGGGAAT (SEQ ID NO: 27) The sequence of the complement of the target sequence of HOXB4-2 after bisulfite treatment (5'-3') is as follows: GTTTTTTTTATGCGAGGAATATTTATAGAGCGATTATTTATTTAGCGATTATTCGTTCGGGTATTACGTCGGCGGTTAGAGGCGAGAGAGTAGTTTTTAGTCGGAGGCGGGTTTCGGGCGGCGCGCGGCGTGTATCGTGTAGCGTTACGCGGTTTGTCGGGATTTTGGGTTTTCGTCGTTTTCGTTATTATTTTCGTCGTTTTCGTTATCGTTCGGTTTGTTTTTTCGGGTTTTTGCGTCGTTATTCGTCGGGGTTTTTTTTTCGGAGTTCGGTTAGCGTTGCGAGGCGGTTAGTAGTAGTTTTTCGTCGTTTTTTTGCGTTTAGAATTTTTTGTATTTTAGTTCG (SEQ ID NO: 28) The target sequence for HOXB4-3 (5'-3') is as follows: GCCCGAGGGGACAGACCGGGCGGTGGCGGGGGCGGCGGGGGTGGTGGCGGAGGCGGCGGGGGCCCAGGGTCCCGGCAGGCCGCGTAGCGCTGCACGGTGCACGCCGCGCGCCGCCCGAAGCCCGCCTCCGGCTGGAAGCTGCTCTCTCGCCTCTGGCCGCCGGCGTAGTACCCGGGCGAGTGGTCGCTGGGTAGGTAATCGCTCTGTGAATATTCCTCGCATGGAGGGAACTTGGGGTCGACATAGTTTGAGTTGAT (SEQ ID NO: 29) The complement of the target sequence for HOXB4-3 (5'-3') is as follows: ATCAACTCAAACTATGTCGACCCCAAGTTCCCTCCATGCGAGGAATATTCACAGAGCGATTACCTACCCAGCGACCACTCGCCCGGGTACTACGCCGGCGGCCAGAGGCGAGAGAGCAGCTTCCAGCCGGAGGCGGGCTTCGGGCGGCGCGCGGCGTGCACCGTGCAGCGCTACGCGGCCTGCCGGGACCCTGGGCCCCCGCCGCCTCCGCCACCACCCCCGCCGCCCCCGCCACCGCCCGGTCTGTCCCCTCGGGC (SEQ ID NO: 30) The sequence of the target sequence of HOXB4-3 after bisulfite treatment (5'-3') is as follows: GTTCGAGGGGATAGATCGGGCGGTGGCGGGGGCGGCGGGGGTGGTGGCGGAGGCGGCGGGGGTTTAGGGTTTCGGTAGGTCGCGTAGCGTTGTACGGTGTACGTCGCGCGTCGTTCGAAGTTCGTTTTCGGTTGGAAGTTGTTTTTTCGTTTTTGGTCGTCGGCGTAGTATTCGGGCGAGTGGTCGTTGGGTAGGTAATCGTTTTGTGAATATTTTTCGTATGGAGGGAATTTGGGGTCGATATAGTTTGAGTTGAT (SEQ ID NO: 31) The sequence of the complementary sequence of the target sequence of HOXB4-3 after bisulfite treatment (5'-3') is as follows: ATTAATTTAAATTATGTCGATTTTAAGTTTTTTTTATGCGAGGAATATTTATAGAGCGATTATTTATTTAGCGATTATTCGTTCGGGTATTACGTCGGCGGTTAGAGGCGAGAGAGTAGTTTTTAGTCGGAGGCGGGTTTCGGGCGGCGCGCGGCGTGTATCGTGTAGCGTTACGCGGTTTGTCGGGATTTTGGGTTTTCGTCGTTTTCGTTATTATTTTCGTCGTTTTCGTTATCGTTCGGTTTGTTTTTTCGGGT (SEQ ID NO: 32) The target sequences of the HOXB4 gene, the SHOX2 gene, the PTGER4 gene, and related sequences are shown in Table 1: Table 1: Target sequences of each gene and related sequences

[0076] Preferably, the nucleic acid used for detecting the methylation status of the target gene comprises a fragment of at least 9 nucleotides of the target sequence of the target gene, wherein the fragment comprises at least one CpG dinucleotide sequence. In certain preferred embodiments, where the DNA of the sample to be tested is treated with bisulfite, the nucleic acid used for detecting the methylation status of the target gene comprises a fragment of at least 9 nucleotides, preferably at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more nucleotides, of the sequence of the target sequence of the target gene after bisulfite treatment, wherein the fragment of nucleotides comprises at least one CpG dinucleotide sequence.

[0077] More preferably, the nucleic acid used for detecting the methylation status of the target gene comprises a fragment of at least 15 nucleotides of the target sequence of the target gene, wherein the fragment of nucleotides comprises at least one CpG dinucleotide sequence, under medium stringency or high stringency conditions. In certain preferred embodiments, where the DNA of the sample to be tested is treated with bisulfite, the nucleic acid used for detecting the methylation status of the target gene comprises a fragment of at least 15 nucleotides, preferably at least 16, 17, 18, 19, 20, 21, 22 or more nucleotides, of the sequence of the target sequence of the target gene after bisulfite treatment, under medium stringency or high stringency conditions, wherein the fragment of nucleotides comprises at least one CpG dinucleotide sequence.

[0078] Preferably, the composition further comprises a reagent for converting the 5- methylated cytosine base of the target sequence of the target gene into a uracil. More preferably, the reagent is bisulfite.

[0079] The nucleic acid used for detecting the methylation status of the target gene can further comprise a blocker which preferentially binds to DNA in the unmethylated state.

[0080] Preferably, the composition comprises one or more of the primers, probes and blockers as shown in Table 2: Table 2: Sequences of primers, probes and blockers used in the present application

[0081] "F" in Table 2 represents a forward primer; "R" represents a reverse primer; "P" represents a probe, and "B" represents a blocker.

[0082] Preferably, the fluorescent labeling of the sequences of the probes and blockers used in the present application is as shown in Table 3.

[0083] Table 3 Fluorescent labeling of probes and blocker sequences used in the present application

[0084] In certain embodiments, the composition further comprises an agent that converts 5- position unmethylated cytosine bases of the gene to uracil. Preferably, the agent is bisulfite. Bisulfite modification of DNA is a known tool for assessing CpG methylation status. In the DNA of eukaryotic cells, 5-methylcytosine is the most common covalent base modification. 5-methylcytosine cannot be identified by sequencing, because 5-methylcytosine has the same base pairing behavior as cytosine. Moreover, the epigenetic information carried by 5-methylcytosine is completely lost during PCR amplification. The most commonly used method for analyzing the presence of 5-methylcytosine in DNA is based on the specific reaction of bisulfite with cytosine; after subsequent alkaline hydrolysis, unmethylated cytosine is converted to uracil, which corresponds to thymine in pairing behavior; but 5-methylcytosine remains unmodified under these conditions. In this way the original DNA is converted so that the 5-methylcytosine, which originally could not be distinguished from cytosine in its hybridization behavior, is now detectable as the only remaining cytosine by conventional known molecular biology techniques, for example by amplification and hybridization. All these techniques are based on different base pairing properties, which can now be fully exploited. Thus, typically, the present application provides the use of bisulfite technology in combination with one or more methylation assays for determining the methylation status of CpG dinucleotide sequences within a target sequence of a gene of interest. Moreover, the methods of the present application are suitable for analyzing heterogeneous biological samples, for example low concentrations of tumor cells in blood or stool. Thus, when analyzing the methylation status of CpG dinucleotide sequences in such samples, the skilled person can use quantitative assays to determine the methylation level (e.g. percentage, fraction, ratio, proportion or extent) of a particular CpG dinucleotide sequence, rather than the methylation status. Accordingly, the term methylation status or methylation state should also be considered to refer to a value that reflects the methylation status of a CpG dinucleotide sequence.

[0085] In another aspect, the present application provides oligonucleotides for use in the in vitro detection of lung cancer, comprising: a fragment of at least 9 nucleotides of the sequence set forth in any one of SEQ ID NOs: 1-4 or the complement thereof and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides of the sequence set forth in any one of SEQ ID NOs: 5-8 or the complement thereof and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides of the sequence set forth in any one of SEQ ID NOs: 9-12 or the complement thereof and comprising at least one CpG dinucleotide sequence.

[0086] Preferably the oligonucleotide for detecting lung cancer in vitro comprises: a fragment of at least 9 nucleotides in the sequence of any one of SEQ ID NO: 1-4 or the complement thereof after bisulfite conversion; and / or a fragment of at least 9 nucleotides in the sequence of any one of SEQ ID NO: 5-8 or the complement thereof after bisulfite conversion and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in the sequence of any one of SEQ ID NO: 9-12 or the complement thereof after bisulfite conversion and comprising at least one CpG dinucleotide sequence.

[0087] The oligonucleotide for detecting lung cancer in vitro of the present application can further comprise: a fragment of at least 15 nucleotides in the sequence of any one of SEQ ID NO: 1-4 or the complement thereof after bisulfite conversion and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 15 nucleotides in the sequence of any one of SEQ ID NO: 5-8 or the complement thereof after bisulfite conversion and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 15 nucleotides in the sequence of any one of SEQ ID NO: 9-12 or the complement thereof after bisulfite conversion and comprising at least one CpG dinucleotide sequence.

[0088] Preferably the oligonucleotide for detecting lung cancer in vitro comprises: a fragment of at least 15 nucleotides in the sequence of any one of SEQ ID NO: 1-4 or the complement thereof after bisulfite conversion and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 15 nucleotides in the sequence of any one of SEQ ID NO: 5-8 or the complement thereof after bisulfite conversion and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 15 nucleotides in the sequence of any one of SEQ ID NO: 9-12 or the complement thereof after bisulfite conversion and comprising at least one CpG dinucleotide sequence.

[0089] The oligonucleotide for detecting lung cancer in vitro of the present application can further comprise: a blocker that preferentially binds to DNA in an unmethylated state.

[0090] In a specific embodiment, the oligonucleotide for detecting lung cancer in vitro comprises: the sequence of SEQ ID NO: 13 and SEQ ID NO: 14. It can further comprise: the sequence of SEQ ID NO: 15.

[0091] In another specific embodiment, the oligonucleotide for detecting lung cancer in vitro comprises the sequences of SEQ ID NO: 16 and SEQ ID NO: 17. It also comprises the sequence of SEQ ID NO: 18.

[0092] In another specific embodiment, the oligonucleotide for detecting lung cancer in vitro comprises the sequences of SEQ ID NO: 19 and SEQ ID NO: 20. It also comprises the sequence of SEQ ID NO: 21.

[0093] In another aspect, the present application provides a kit comprising the composition. The kit also comprises at least one other component selected from the group consisting of nucleoside triphosphates, DNA polymerase and buffers required for the function of the DNA polymerase.

[0094] Typically, the kit also comprises a container for holding a patient's biological sample. Also, the kit also comprises instructions for using and interpreting the results of the detection.

[0095] The present application also relates to the use of the above-mentioned composition and oligonucleotide in the preparation of a kit for detecting lung cancer in vitro.

[0096] The present application also relates to the use of one or more of the HOXB4 gene, SHOX2 gene and PTGER4 gene in the preparation of a kit for detecting lung cancer in vitro.

[0097] The HOXB4 gene is located at the q21.32 region of chromosome 17 in the human genome. The HOXB4 gene is a member of the Antp homeobox gene family, which encodes a transcription factor that plays an important regulatory role in the balance between self-renewal and differentiation of hematopoietic stem cells. Meanwhile, the in vivo expression or ectopic expression in vitro of the gene can expand hematopoietic stem cells and progenitor cells, making them potential candidates for therapeutic stem cell expansion.

[0098] The SHOX2 gene, which stands for Short Stature Homeobox 2, is a member of the homeobox gene family. The gene is located at the q25.32 region of chromosome 3 in the human genome, and its expression regulation is closely related to organ development.

[0099] The PTGER4 gene, short for Prostaglandin E Receptor 4, is located in the p13.1 region of chromosome 5 in the human genome. Its encoded product is one of the four receptors for prostaglandin E2 (PGE2) and a member of the G protein-coupled receptor family. PTGER4 mediates PGE2-induced Early Growth Response 1 (EGR1) expression and activates phosphorylation of glycogen synthase kinase-3 (GSK3).

[0100] Furthermore, this application provides a method for in vitro detection of lung cancer, the method comprising the following steps: 1) Isolate the target sequence or fragment of the target gene from the biological sample to be tested; 2) Determine the methylation status of the target sequence of the target gene; 3) The state of the biological sample is determined by the detection results of the methylation status of the target sequence of the target gene, thereby realizing the in vitro detection of lung cancer.

[0101] According to certain preferred embodiments, the method further includes the following steps: 1) Extract genomic DNA from the biological sample to be tested; 2) Treat the DNA sample obtained in step 1) with reagents to convert the 5-position unmethylated cytosine base into uracil or other bases. That is, the 5-position unmethylated cytosine base in the target sequence of the target gene is converted into uracil or other bases. The converted bases are different from the 5-position unmethylated cytosine bases in terms of hybridization performance and are detectable. 3) The DNA sample treated in step 2) is contacted with DNA polymerase and primers for the target sequence of the target gene, so that the target sequence of the treated target gene is amplified to produce an amplification product or is not amplified; if the target sequence of the treated target gene undergoes DNA polymerization, an amplification product will be produced; if the target sequence of the treated target gene does not undergo DNA polymerization, it will not be amplified. 4) Detect the amplification products using probes; and 5) Based on the presence or absence of the amplification product, determine the methylation status of at least one CpG dinucleotide of the target sequence of the target gene.

[0102] Preferably, the primers typically comprise fragments of the target sequence of the target gene, the target sequence fragments comprising fragments of at least 9 nucleotides that are respectively equivalent to, complementary to, or hybridize under moderate or severe conditions to any one of SEQ ID NO: 1-4, any one of SEQ ID NO: 5-8, or any one of SEQ ID NO: 9-12.

[0103] Preferably, a typical probe comprises a fragment of the target sequence of the target gene, the fragment of the target sequence comprising a fragment of at least 15 nucleotides that are respectively equivalent to, complementary to, or hybridized under moderate or severe conditions to any one of SEQ ID NO: 1-4, any one of SEQ ID NO: 5-8, or any one of SEQ ID NO: 9-12.

[0104] Preferably, one or more of the primers and probes are as shown in Table 2 above.

[0105] Furthermore, the contact or amplification includes using at least one of the following methods: using a thermostable DNA polymerase as the amplification enzyme, using a polymerase lacking 5'-3' exonuclease activity, using polymerase chain reaction (PCR), and generating amplified nucleic acid molecules with detectable labels.

[0106] Preferably, PCR is used to determine methylation status. Methods such as fluorescence-based real-time PCR, methylation-sensitive single nucleotide primer extension reaction (Ms-SNuPE), methylation-specific PCR (MSP), and methylation CpG island amplification (MCA) are used to determine the methylation status of at least one CpG dinucleotide of the target sequence of a target gene. Among these, fluorescence-based real-time PCR is a high-throughput quantitative methylation assay that uses fluorescence-based real-time PCR (TaqMan) technology and requires no further processing after the PCR step. In short, the fluorescence-based real-time PCR method begins with a mixed sample of genomic DNA, which is converted into a pool of methylation-dependent sequence differences in a sodium bisulfite reaction according to standard procedures. Fluorescence-based PCR is then performed in a biased reaction (using PCR primers with overlapping known CpG dinucleotides). Sequence differences can be generated at both the amplification level and the fluorescence detection amplification level. The fluorescence-based real-time PCR assay can be used as a quantitative test for the methylation status of genomic DNA samples, where sequence differentiation occurs at the probe hybridization level. In this quantitative approach, the PCR reaction provides methylation-specific amplification in the presence of a fluorescent probe overlapping a specific CpG dinucleotide. A no-offset control for the amount of starting DNA is provided by a reaction in which neither the primer nor the probe covers any CpG dinucleotide. The "fluorescence-based real-time PCR" method can be used with any suitable probe, such as TaqMan, Lightcycler, etc. TaqMan probes are dual-labeled with a fluorescent reporter (RTSPYL5rter) and a quencher molecule (Quencher) and are designed to be specific to regions with relatively high GC content, such that they melt in PCR cycles at a temperature approximately 10°C higher than the forward or reverse primers. This allows the TaqMan probe to remain fully hybridized during the PCR annealing / extension steps. When Taq polymerase synthesizes new strands in PCR, it eventually encounters the annealed TaqMan probe. The Taq polymerase 5' to 3' endonuclease activity then replaces the TaqMan probe by digesting it, releasing the fluorescent reporter molecule for quantification using a real-time fluorescence detection system to detect the signal that is no longer quenched. Typical reagents used for fluorescence-based real-time PCR analysis may include, but are not limited to: target sequence PCR primers for the target gene; nonspecific amplification blocking agents; TaqMan or Lightcycler probes; optimized PCR buffers and deoxynucleotides; and Taq polymerase, etc.

[0107] In some preferred embodiments, the methylation status of at least one CpG dinucleotide in the target sequence of the target gene is determined by the critical Ct value of the real-time PCR reaction. By utilizing real-time PCR to analyze DNA in biological samples, the methylation status of the target sequence of the target gene can be conveniently detected, and the positivity of the tested sample can be quickly and easily determined based on the critical Ct value of the PCR reaction, thus providing a non-invasive and rapid in vitro detection method for lung cancer.

[0108] The biological sample is selected from cell lines, histological sections, tissue biopsies / paraffin-embedded tissues, body fluids, feces, colonic effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof. Plasma is the preferred biological sample.

[0109] The inventors of this application have discovered a significant difference in the methylation status of the target sequences of the HOXB4, SHOX2, and PTGER4 genes between lung cancer tissue and normal tissue: in lung cancer tissue, the target sequences of the HOXB4, SHOX2, and PTGER4 genes are methylated, while in normal tissue, these target sequences are not methylated. Therefore, this application provides a method for in vitro detection of lung cancer by detecting the methylation status of one or more target sequences of the HOXB4, SHOX2, and PTGER4 genes in a sample. The method provided by this application can detect lung cancer non-invasively and rapidly.

[0110] Example This application provides a general and / or specific description of the materials and test methods used in the experiments. In the following examples, unless otherwise specified, % represents wt%, i.e., weight percentage. Reagents or instruments used, unless otherwise specified, are all commercially available conventional reagent products.

[0111] Example 1 Primer and probe testing First, low-methylation sites were screened from next-generation sequencing data of WBCs from 340 healthy individuals and cfDNA from plasma samples from 102 healthy individuals. Second, the screened low-methylation sites were analyzed in lung cancer plasma and tissue samples. Sites showing differences in 103 lung cancer plasma samples and 102 healthy individual plasma samples, and also showing differences in 56 lung cancer tissue samples and 56 adjacent normal tissue samples, were selected as candidate biomarkers. Then, plasma source tracing was performed on the candidate biomarkers. Finally, through sensitivity and specificity validation in lung cancer tissue and healthy individual plasma samples, three specific biomarkers were identified: the HOXB4 gene (which includes three sites: HOXB4-1, HOXB4-2, and HOXB4-3), the SHOX2 gene, and the PTGER4 gene.

[0112] Primers and probes were designed based on the target sequences of the three genes mentioned above, and the designed primer and probe sequences are shown in Table 2 above.

[0113] Genomic DNA from healthy human WBC cell lines is typically in a low / unmethylated state, serving as a negative reference for detecting the methylation status of target gene sequences. In this embodiment, the amount of DNA used is 20 ng / reaction. Human genomic DNA methyltransferase treatment products are typically in a high / fully methylated state. In this embodiment, human genomic DNA methyltransferase treatment products are mixed with genomic DNA from healthy human WBC cell lines, with template inputs of 350 pg and 15.75 ng per reaction, respectively, serving as positive references for detecting the methylation status of target gene sequences. The DNA samples are first converted to bisulfite. Using the converted BisDNA as a template, real-time PCR amplification is performed using the aforementioned primer-probe blocking agent. The β-actin (ACTB) gene is used as an internal control. β-actin gene amplicon is created using primers complementary to the β-actin gene sequence, and the β-actin gene amplicon is detected using a specific probe. Each sample undergoes at least one real-time PCR; in some specific embodiments, two or three real-time PCR detections are performed. The PCR system for primer-probe testing is shown in Table 4 below.

[0114] Table 4

[0115] Note: "F" indicates the forward primer; "R" indicates the reverse primer; "P" indicates the probe.

[0116] The PCR amplification program used was as follows: 94℃, 10 min; (65℃, 5 s; 60℃, 30 s—read fluorescence signal; 93℃, 20 s) 45 cycles; 40℃, 5 s.

[0117] The nucleic acid composition and detection method provided in this application showed negative results for the detection of WBC cell line DNA from healthy individuals, but positive results for the detection of a mixed template of human genomic DNA methyltransferase treatment product and genomic DNA from healthy individuals' WBC cell lines. When BisDNA transformed from a mixture of human genomic DNA methyltransferase treatment product and genomic DNA from healthy individuals' WBC cell lines was used as a template, the HOXB4, SHOX2, and PTGER4 genes were all effectively amplified. Figures 1-5 When BisDNA transformed from healthy human WBC cell line DNA was used as a template, except for the internal reference gene ACTB, the HOXB4, SHOX2, and PTGER4 genes did not amplify. Figures 6-10 ).

[0118] Example 2: WBC testing in lung cancer tissue and healthy individuals Sixteen lung cancer tissue samples (eight each of lung adenocarcinoma and lung squamous cell carcinoma) and 24 healthy human white blood cell (WBC) samples were selected as specimens. Genomic DNA was extracted and converted to BisDNA via sulfite treatment. Template amounts of 500 pg / reaction from lung cancer tissue and 20 ng / reaction from healthy human WBC were used. The methylation status of the HOXB4, SHOX2, and PTGER4 genes was detected according to the PCR reaction system and procedure described in Example 1. Finally, the Ct values ​​of real-time PCR for the target gene sequences were measured in the 16 lung cancer tissue samples and the 24 healthy human WBC samples. Based on the PCR results, the cutoff value was set at Ct=41 for HOXB4, Ct=36 for SHOX2, and Ct=40 for all PTGER4 samples. Values ​​below the cutoff value were considered positive, and values ​​above or equal to the cutoff value were considered negative.

[0119] Table 5 shows the CT value detection results of HOXB4, SHOX2, and PTGER4 genes in lung cancer tissue samples and control samples.

[0120]

[0121] The results are shown in Table 5. The sensitivities of HOXB4-1, HOXB4-2, HOXB4-3, SHOX2, and PTGER4 genes alone in detecting lung cancer were 93.75%, 50%, 100%, 100%, and 100%, respectively. Meanwhile, methylation of the target gene sequences showed good specificity for healthy human white blood cells (WBCs), with specificities of 100%, 91.67%, 91.67%, 100%, and 100% for each. Since HOXB4-2 and HOXB4-3 had relatively poor specificity in healthy individuals, their combined use with SHOX2 and PTGER4 would reduce the specificity of the combined detection. Therefore, excluding HOXB4-2 and HOXB4-3, the combined detection of HOXB4-1 with the three markers SHOX2 and PTGER4 achieved 100% specificity for healthy human WBCs and 100% sensitivity for lung cancer tissue.

[0122] Example 3: Lung Cancer Plasma and Healthy Person Plasma Tests Plasma samples (2.1 mL) from 68 lung cancer patients and 122 healthy individuals were selected as specimens. Cell-free DNA was extracted from the plasma and converted to BisDNA via sulfite treatment. The methylation status of the HOXB4-1, SHOX2, and PTGER4 genes was detected according to the PCR reaction system and procedure in Example 1.

[0123] Table 6 shows the statistical results of HOXB4, SHOX2, and PTGER4 gene detection in lung cancer plasma samples and control samples.

[0124] The results are shown in Table 6. The sensitivities of detecting lung cancer using HOXB4-1, SHOX2, and PTGER4 genes were 70.59%, 55.88%, and 36.76%, respectively. The sensitivity of combined detection of the three biomarkers HOXB4-1, SHOX2, and PTGER4 (single positive was considered positive) reached 83.82%. Meanwhile, methylation of the target gene sequence showed good specificity, with specificities of 99.18%, 96.72%, and 99.18% for detecting control samples, respectively. The specificity of combined detection of the three biomarkers was 95.08%.

[0125] Example 4 Various research studies have shown that different combinations of primers, probes, and blocking agents may have different detection efficiencies for the same sample. Therefore, this application designed and validated three sets of primer, probe, and blocking agent combinations for each of the target sequences in the promoter regions of the SHOX2 and PTGER4 genes. The sequences are shown in Table 2.

[0126] First, this application uses 16 lung cancer tissue samples (8 cases of lung adenocarcinoma and 8 cases of lung squamous cell carcinoma) and 24 healthy human WBC samples as samples to compare three sets of primer, probe and blocking agent combinations. The statistical results are shown in the table below.

[0127] Table 7 shows the CT value detection results of three primer-probe combinations for the SHOX2 and PTGER4 genes in lung cancer tissue samples and control samples.

[0128]

[0129] The results are shown in Table 7. The sensitivities of the three primer / probe combinations for detecting lung cancer in the SHOX2 gene were 100%, 37.5%, and 100%, respectively, and the specificities were 100%, 100%, and 75%, respectively. Due to the poor sensitivity of SHOX2_F1 / R1 / P1 and the poor specificity of SHOX2_F2 / R2 / P2, both SHOX2_F1 / R1 / P1 and SHOX2_F2 / R2 / P2 were excluded, and the SHOX2_F / R / P / B combination was retained. The sensitivities of the three primer / probe combinations for detecting lung cancer in the PTGER4 gene were 100%, 81.25%, and 93.75%, respectively, and the specificities were 100%, 75%, and 62.5%, respectively. Due to the poor specificity of PTGER4_F1 / R1 / P1 and PTGER4_F2 / R2 / P2, both were excluded, and only the PTGER4_F / R / P / B combination was retained.

[0130] Example 5 Based on the test results of plasma samples from 68 lung cancer patients and 122 healthy individuals in Example 3, regression analysis and model construction were performed, resulting in the following formula: P=

[0131] Based on the test results, calculations and analyses were performed according to the formula. When the critical value of P was set to 0.52, the performance indicators were optimal, with a sensitivity of 88.24% and a specificity of 96.72%. Simultaneously, a small sample was used to preliminarily validate the constructed lung cancer diagnostic model, and the results are shown in Table 7 below.

[0132] Table 7

[0133] As shown in Table 7, the above small sample validation results indicate that the DNA methylation detection and model interpretation of the HOXB4, SHOX2, and PTGER4 gene target sequences of the present invention can achieve non-invasive in vitro detection of lung cancer and improve the detection rate of lung cancer.

[0134] In summary, this application utilizes the composition, nucleic acid sequence, kit, and their uses described above, as well as the detection method described above, to detect lung cancer in vitro using the methylated nucleic acid sequence of the target gene and its fragments by detecting the target sequence of the target gene and its fragments, thereby effectively improving the sensitivity and specificity of lung cancer in vitro detection.

[0135] The above description is merely a preferred embodiment of this application and is not intended to limit the application in any other way. Any person skilled in the art may make changes or modifications to the disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of this application without departing from the scope of the technical solution of this application shall still fall within the protection scope of this application.

Claims

1. A composition for in vitro detection of lung cancer, the composition comprising: Nucleic acid used to detect the methylation status of a target gene. The methylation status of the target gene is characterized by the methylation of the target sequence of the target gene. The target genes are HOXB4, SHOX2, and PTGER4.

2. The composition according to claim 1, wherein, The target sequence of the HOXB4 gene is as shown in SEQ ID NO: 1-4, or any one of them, or the target sequence of the HOXB4 gene includes the sequence shown in SEQ ID NO: 1-4.

3. The composition according to claim 1, wherein, The target sequence of the SHOX2 gene is as shown in any one of SEQ ID NO: 5-8 or the target sequence of the SHOX2 gene includes any one of SEQ ID NO: 5-8.

4. The composition according to claim 1, wherein, The target sequence of the PTGER4 gene is as shown in any one of SEQ ID NO: 9-12 or the target sequence of the PTGER4 gene includes the sequence shown in any one of SEQ ID NO: 9-12.

5. An oligonucleotide for in vitro detection of lung cancer, comprising: A fragment containing at least 9 nucleotides of the sequence shown in any one of SEQ ID NO: 1-4 or its complementary sequence and including at least one CpG dinucleotide sequence; and / or A fragment containing at least 9 nucleotides of the sequence shown in any one of SEQ ID NO: 5-8 or its complementary sequence and including at least one CpG dinucleotide sequence; and / or A fragment containing at least 9 nucleotides of the sequence shown in any one of SEQ ID NO: 9-12 or its complementary sequence and including at least one CpG dinucleotide sequence.

6. A kit comprising the composition of any one of claims 1 to 4 or comprising the oligonucleotide of claim 5.

7. Use of the composition of any one of claims 1 to 4 or the oligonucleotide of claim 5 in the preparation of a kit for in vitro detection of lung cancer.

8. The use of HOXB4, SHOX2, and PTGER4 genes in the preparation of kits for in vitro detection of lung cancer.

9. The use according to claim 8, wherein, The target sequence of the HOXB4 gene is as shown in any one of SEQ ID NO: 1-4 or the target sequence of the HOXB4 gene includes the sequence shown in any one of SEQ ID NO: 1-4.

10. The use according to claim 8, wherein, The target sequence of the SHOX2 gene is as shown in any one of SEQ ID NO: 5-8 or the target sequence of the SHOX2 gene includes the sequence shown in any one of SEQ ID NO: 5-8.

Citation Information

Patent Citations

  • DNA methylation marker for detecting lung cancer and application

    CN115505640A

  • Methylated molecular marker for detecting pulmonary nodules and application of methylated molecular marker

    CN117660622A

  • Method, combination and kit for detecting malignant pulmonary nodules and lung cancer

    CN119325513A