Scotogramma trifolii Scotogramma trifolii specific SS-COI primer pair and rapid molecular detection method
By designing a specific SS-COⅠ primer pair for the moth *Helicobacter pylori* and a rapid molecular detection method, the problem of identifying *Helicobacter pylori* was solved, achieving rapid detection with high sensitivity and specificity. This method is applicable to various insect stages and remains, reducing agricultural losses.
Patent Information
- Application Number
- CN202511070088.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-31
- Publication Date
- 2025-11-21
AI Technical Summary
Existing technologies make it difficult to quickly and accurately identify the worm, especially when the larvae have varied body colors and can be confused with closely related species, leading to inappropriate control measures and a lack of specific detection methods for the worm.
A specific SS-COⅠ primer pair for the moth *Helicobacter pylori* and a rapid molecular detection method were designed. PCR amplification was performed using the specific primer pair, and the amplification products were analyzed by agarose gel electrophoresis to determine that the sample was *Helicobacter pylori*.
It enables rapid and accurate identification of the cyclops moth, featuring high sensitivity, strong specificity, and simple operation. It is suitable for detecting various insect stages and remains, reducing agricultural losses.
Smart Images

Figure CN120989252A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of agricultural biotechnology, and particularly relates to a Helicoverpa assulta specific SS-CO I primer pair and a rapid molecular detection method. BACKGROUND
[0002] Lepidoptera is one of the most abundant groups in the class Insecta, which is complete metamorphosis development, and each stage can cause great harm to crop growth. As an important member of the family Noctuidae, Helicoverpa assulta can harm more than 20 crops of 8 families such as peas, soybeans, sugar beets, Chinese cabbage, onions, wheat, corn and millet, and the larvae have the characteristics of migration damage. The agricultural losses caused by Helicoverpa assulta are significant every year. Therefore, strengthening the monitoring of Helicoverpa assulta has great significance for ensuring the safety of agricultural production.
[0003] Helicoverpa assulta is a complete metamorphic insect, and it is difficult to determine the species only from the morphological identification of eggs, larvae and pupae, and the accuracy is low. At the same time, the body color of the larvae is variable, which also brings a lot of uncertainty to morphological identification. At the same time, Helicoverpa assulta, beet armyworm and other closely related species may occur mixed on crops (such as sugar beets), and due to the variable body color of the larvae and the confusion with other lepidopteran larvae, it is difficult to distinguish their species only from morphology, which brings difficulties to the determination of the target for control in production, leading to improper use of drugs and failure of control measures. Therefore, the research on the rapid identification technology of target pests has important role for the development of pest control strategies, early control and accurate identification. At present, the identification methods of Helicoverpa assulta mainly include morphological characteristics identification and PCR technology, but the base sequence homology of Helicoverpa assulta and beet armyworm, cabbage armyworm and other closely related species is high, and it is difficult to find a specific segment targeting Helicoverpa assulta. Therefore, there is no specific standard and detection and identification method for Helicoverpa assulta at present. SUMMARY
[0004] In order to solve the above problems, the present application designs a Helicoverpa assulta specific SS-CO I primer pair and a rapid molecular detection method. The specific primer pair is designed only for Helicoverpa assulta, and the detection method using the specific primer pair can detect each instar and adult residue, and also has stable detection results for trace (ng level) samples. The detection results are judged according to the size and presence or absence of DNA bands, without sequencing and sequence comparison, and have the advantages of high sensitivity, strong specificity, simple operation and good repeatability.
[0005] In order to achieve the above purpose, the present application designs a Helicoverpa assulta specific SS-CO I primer pair, and the sequence of the primer pair is as follows: STSSF: 5'-TTGTACCATTAATATTAGGAGCTCCT-3' STSSR: 5'-TGATGAAATACCAGCTAAATGAAGG-3'.
[0006] As a further improvement of the Helicoverpa armigera specific SS-CO I primer pair of the application: the amplified fragment of the primer pair is a specific region of 227 bp in the Helicoverpa armigera CO I gene.
[0007] To achieve the above-mentioned purpose, the application designs a Helicoverpa armigera rapid molecular detection method using a specific primer pair, comprising the following steps: (1) extracting the genomic DNA of the sample to be tested; (2) performing PCR amplification with the primer pair STSSF / STSSR of claim 1, and the reaction program is: 98℃ pre-denaturation for 3 min; 35 cycles (98℃ for 30 s, 63℃ for 30 s, 72℃ for 30 s); finally 72℃ extension for 5 min; (3) analyzing the amplification product by agarose gel electrophoresis, if a specific band of 227 bp is detected, the sample is determined to be Helicoverpa armigera.
[0008] As a further improvement of the Helicoverpa armigera rapid molecular detection method using a specific primer pair of the application: the sample to be tested includes any instar, age or residual tissue of the test object.
[0009] As a further improvement of the Helicoverpa armigera rapid molecular detection method using a specific primer pair of the application: the reaction system of the PCR amplification is 25 μL, including: 2×Taq Plus PCR MasterMix 12 μL; 1 μL of each of the upstream primer STSSF and the downstream primer STSSR; 1 μL of the genomic DNA template; 1 μL of the genomic DNA template with a concentration of ≥0.14 ng / μL; 10 μL of sterile deionized water.
[0010] As a further improvement of the Helicoverpa armigera rapid molecular detection method using a specific primer pair of the application: the conditions of the agarose gel electrophoresis are: 1.5% agarose gel, 0.5×TBE buffer, 200V voltage, electrophoresis for 20 min.
[0011] To achieve the above-mentioned purpose, the specific primer pair and the Helicoverpa armigera rapid molecular detection method designed by the application have the following applications: the detection sensitivity is 0.14 ng / μL of genomic DNA, and there is no cross reaction to the lepidopteran insects such as cabbage moth, beet armyworm, yellow stick moth, cotton bollworm, Asian corn borer, birch armyworm and tomato leaf miner.
[0012] The patent technology realizes rapid identification of Spodoptera exigua in the field, rapid determination of prevention and treatment targets, accurate and timely prevention and treatment of pests, and reduction of agricultural losses. The patent technology has the characteristics of simple operation, specificity, accuracy, stability and the like; the length of the DNA fragment amplified by the specific primer pair described in the patent application is 227 base pairs, which is easy to separate and observe in agarose gel electrophoresis, and the shorter fragment (<500 bp) has higher amplification efficiency in PCR, especially suitable for low-quality or degraded DNA samples, and can rapidly and accurately detect various insect stages and residues. BRIEF DESCRIPTION OF DRAWINGS
[0013] Figure 1 is the amplification effect comparison of the primer pair of the present application on different lepidoptera insects; Figure 2 is the amplification effect of the primer pair of the present application on different insect stages and residue tissues of Spodoptera exigua; Figure 3 is the detection threshold of the primer pair of the present application on the DNA concentration of Spodoptera exigua samples. DETAILED DESCRIPTION
[0014] The present application will be further described below in combination with the drawings and specific embodiments, and the embodiments are based on the technical scheme of the present application, and give detailed implementation manners.
[0015] The COI gene sequences of Spodoptera exigua and related species (Spodoptera exigua, Spodoptera exigua, etc.) are obtained, multiple sequence alignment is performed, and Spodoptera exigua specific primers are designed, and the sequences are: STSSF: 5'-TTGTACCATTAATATTAGGAGCTCCT-3' STSSR: 5'-TGATGAAATACCAGCTAAATGAAGG-3'.
[0016] The Spodoptera exigua specific gene fragment is amplified using the above-mentioned Spodoptera exigua specific primer, and the nucleotide sequence is: TTGTACCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAATAAACAATATAAGTTTTTGACTCTTACCCCCTTCTTTAACTTTATTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCTCATGGAGGAAGTTCAGTTGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCATCA The CTAB method is used to extract the genomic DNA of the insect (sample) to be detected; The specific primer amplification system and reaction procedure of Spodoptera exigua SS-COⅠ are optimized: The PCR reaction system is 25 μL, wherein the DNA template is 1 μL, the gold medal MIX (containing Mg2+, dNTP, buffer dye) is 22 μL, and the upstream and downstream primers are 1 μL each.
[0017] The PCR reaction procedure is as follows: 98 ℃ pre-denaturation for 3 min; 35 cycles of 98 ℃ for 30 s, 63 ℃ for 30 s, 72 ℃ for 30 s; and finally 72 ℃ extension for 5 min.
[0018] Finally, 5 μL of the PCR amplification product is separated by 1.5% agarose gel electrophoresis at 200 V (the electrophoresis liquid is 0.5× TBE) for 20 min, and the electrophoresis result is analyzed by a gel imaging system.
[0019] The electrophoresis result shows that the 227 bp band is obtained, and then it is determined that the sample is Spodoptera exigua; and other related species (such as Spodoptera exigua and Spodoptera exigua) cannot amplify the fragment due to sequence difference, so that the detection specificity is ensured.
[0020] The present application uses Spodoptera exigua DNA as a template to perform annealing temperature gradient PCR to determine the optimal amplification condition, and the band size is 227 bp when the annealing temperature is 63 ℃, and the band is single and clear and bright.
[0021] Verification of specific amplification effect of Spodoptera exigua specific SS-COⅠ primer on different lepidoptera insects Spodoptera exigua DNA is used as a target, and Spodoptera exigua, Spodoptera exigua, yellow stick moth, cotton bollworm, Asian corn borer, birch night moth and tomato leaf miner are used as controls to perform PCR amplification. The PCR reaction procedure is as follows: 98 ℃ pre-denaturation for 3 min; 35 cycles of 98 ℃ for 30 s, 63 ℃ for 30 s, 72 ℃ for 30 s; and finally 72 ℃ extension for 5 min.
[0022] Finally, 5 μL of the PCR amplification product is separated by 1.5% agarose gel electrophoresis at 200 V (the electrophoresis liquid is 0.5× TBE) for 20 min, and the electrophoresis result is analyzed by a gel imaging system.
[0023] Verification of specific amplification effect of Spodoptera exigua specific SS-COⅠ primer on different biological samples As Figure 1 The electrophoresis detection result shows that in the figure, M: DNA molecular weight standard DNA ladder; 1: Spodoptera exigua Scotogramma trifolii ; 2: Spodoptera exigua Spodoptera exigua ; 3: Spodoptera exigua Mamestra brassicae; 4: Corn borer Ostrinia furnacalis; 5: Tomato leafminer Tuta absoluta; 6: Cotton bollworm Helicoverpa armigera; 7: Yellow tussock moth Monema flavescens 8: Birch Noctuid moth Lacanobia contigua CK: Negative control (ultra-pure water). This specific primer only amplifies *Helicobacter pylori*, targeting a 227 bp fragment. It does not amplify the fragments of the other seven lepidopteran insects, indicating that the *Helicobacter pylori* SS-COⅠ primers screened in this invention have high specificity.
[0024] Verify the amplification effect of primers on different life stages and residual tissues of the moth *Helicobacter pylori*. DNA from different life stages and remains of the moth *Echinochloa crus-galli* was amplified using primers STSSF / STSSR, including different life stages (eggs, larvae, pupae, and adults) and different tissues (head, thorax, abdomen, legs, wings, antennae, labial palps, and beak). like Figure 2 As shown in the figure, the following labels are used: M: DNA molecular weight standard (DNA ladder); 1: Antennae; 2: Lower lip palp; 3: Foot; 4: Beak; 5: Ovum; 6: Head; 7: Thorny; 8: Abdomen; 9: Wings; 10: 3-day-old larva; 11: Pupa; 12: Adult; CK: Negative control (ultra-pure water). The results showed that *Heliotropium indicum* could stably amplify a specific 227 bp fragment in different developmental stages, instars, and tissues.
[0025] Verify the detection threshold of primers STSSF / STSSR against *Heliotropium indicum*. Using DNA from one *Helicobacter pylori* specimen as a template, PCR amplification was performed after dilution. The results showed that even at a template dilution to 0.281 ng / µL (equivalent to 1 / 2,000,000), the target fragment could still be amplified, demonstrating high sensitivity. Figure 3As shown, the figure is marked: M: DNA molecular weight standard DNA ladde; 1: 112.4ng ng / µL (1 / 5000); 2: 22.48 ng / µL (1 / 25000); 3: 4.49ng / µL (1 / 125000) 4: 2.248 ng / µL (1 / 250000); 5: 1.124ng / µL (1 / 500000); 6: 0.562 ng / µL (1 / 1000000); 7: 0.281ng / µL (1 / 2000000); 8: 0.1405 ng / µL (1 / 4000000); CK: negative control.
[0026] According to the above description of the present application, the STSSF / STSSR designed by the present application can specifically detect Spodoptera exigua among Lepidoptera, and has no cross-reaction with Pieris rapae, Spodoptera exigua, Dendrolimus punctatus, Helicoverpa armigera, Ostrinia furnacalis, Phthorimaea operculella and Tomato leaf miner among Lepidoptera; thus, specific detection of Spodoptera exigua is realized, and the needs for rapid detection and monitoring of Spodoptera exigua in agricultural production are met; at the same time, each instar and adult residue can be detected, and stable detection results are also obtained for trace samples (ng level). The detection results are judged according to the size and presence or absence of DNA bands, without the need for sequencing and sequence alignment, and the present application has the advantages of high sensitivity, strong specificity, simple operation, good repeatability and the like.
[0027] The above description is only a preferred embodiment of the present application, and does not limit the present application in any form. Although the present application has been disclosed as above with reference to the preferred embodiment, it is not intended to limit the present application, and any person skilled in the art can make some changes or modifications to the above disclosed technical content to obtain equivalent embodiments with equivalent changes, without departing from the technical solution of the present application. Any simple modification, equivalent change and modification of the above embodiments according to the technical essence of the present application are still within the scope of the technical solution of the present application.
Claims
1. A specific SS-COⅠ primer pair for the moth *Helicobacter pylori*, characterized in that, The primer pair sequences are as follows: STSSF: 5'-TTGTACCATTAATATTAGGAGCTCCT-3' STSSR: 5'-TGATGAAATACCAGCTAAATGAAGG-3'.
2. A rapid molecular detection method for *Helicobacter pylori* based on the primer pair described in claim 1, characterized in that, Includes the following steps: (1) Extract genomic DNA from the sample to be tested; (2) Perform PCR amplification of STSSF / STSSR using the primers described in claim 1. The reaction program is as follows: 98℃ pre-denaturation for 3 min; 35 cycles (98℃ for 30 s, 63℃ for 30 s, 72℃ for 30 s); and finally, 72℃ extension for 5 min; (3) Analyze the amplification products by agarose gel electrophoresis. If a specific band of 227 bp is detected, the sample is determined to be *Helicobacter pylori*.
3. The rapid molecular detection method for *Helicobacter pylori* as described in claim 2, characterized in that: The test samples include any stage, instar, or residual tissue of the insect being tested.
4. The rapid molecular detection method for *Helicobacter pylori* as described in claim 3, characterized in that, The PCR amplification reaction system is 25 μL, including: 12 μL of 2×Taq Plus PCR MasterMix; 1 μL each of upstream primer STSSF and downstream primer STSSR; 1 μL of genomic DNA template; 1 μL of genomic DNA template with a concentration ≥0.14 ng / μL; and 10 μL of sterile deionized water.
5. The rapid molecular detection method for *Helicobacter pylori* as described in claim 4, characterized in that, The conditions for agarose gel electrophoresis were: 1.5% agarose gel, 0.5×TBE buffer, 200V voltage, and electrophoresis for 20 minutes.
6. An application of the detection method as described in any one of claims 2-5, characterized in that: The detection sensitivity is 0.14 ng / μL genomic DNA, and there is no cross-reactivity with lepidopteran insects such as cabbage looper, beet armyworm, yellow tussock moth, cotton bollworm, Asian corn borer, birch looper, and tomato leafminer.
7. The specific SS-COⅠ primer pair for *Helicobacter pylori* as described in claim 1, characterized in that: The amplified fragment of the primer pair is a 227bp specific region in the COⅠ gene of the worm moth.