Primer pair, kit and system for detecting echinococcosis multilocularis based on multiple PCR-CRISPR / Cas12a of circulating free DNA and application

Abstract

The invention discloses a primer pair, a kit and a system for detecting echinococcosis multilocularis based on multiple PCR-CRISPR / Cas12a of circulating free DNA (deoxyribonucleic acid), and application of the primer pair, the kit and the system, and relates to the technical field of gene detection. According to the primer pair for detecting the echinococcosis multilocularis based on the multiple PCR-CRISPR / Cas12a of the circulating free DNA, the 1260 gene, the Nad5 gene and the U1 gene of the echinococcosis multilocularis serve as targets, and the PCR primer pair comprises Em-1260-F4R3, Em-NAD5-F3R5 and Em-U1-F4R1. According to the invention, rapid and sensitive detection can be realized through a multiple PCR-CRISPR / Cas12a detection system, complicated equipment and operation are not needed, and the occurrence rate of false positive results is also reduced.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of gene detection, and in particular to a primer pair, a kit, a system and an application for detecting alveolar echinococcosis based on circulating cell-free DNA by multiplex PCR-CRISPR / Cas12a. BACKGROUND

[0002] Human alveolar echinococcosis, also known as alveolar hydatid disease (AE), is a serious parasitic disease caused by the larval stage of Echinococcus multilocularis (Em), mainly affecting the liver and can spread to other organs. Because the clinical manifestations of AE are often similar to diseases such as malignant tumors, and lack specific clinical symptoms, it is easy to lead to misdiagnosis.

[0003] Traditional detection methods have limitations in diagnosing AE, especially in the follow-up process of the disease. Specifically, imaging techniques have advantages in lesion positioning, size and invasiveness determination, but have limitations in early infection detection. Serological antigens and antibodies can be detected in the early stage of infection, but due to non-specific cross-reactions and the influence of immunosuppressive therapy, the specificity and sensitivity of serological methods are poor. Nucleic acid detection techniques, including polymerase chain reaction (PCR) and isothermal amplification techniques, have high sensitivity and specificity, and are suitable for early differential diagnosis, but traditional molecular detection methods usually rely on infected tissue samples.

[0004] Therefore, providing a high-performance molecular diagnostic method based on non-invasive samples is of great significance for mass screening and early diagnosis of hydatid disease. SUMMARY

[0005] The present application discloses a primer pair, a kit, a system and an application for detecting alveolar echinococcosis based on circulating cell-free DNA by multiplex PCR-CRISPR / Cas12a, to solve the defects of the hydatid disease detection method in the related art.

[0006] In order to solve the above problems, the present application adopts the following technical solutions:

[0007] The primer pair for detecting alveolar echinococcosis based on circulating cell-free DNA by multiplex PCR-CRISPR / Cas12a of the present application takes the 1260 gene, Nad5 gene and U1 gene of Echinococcus multilocularis as the target, and the PCR primer pair includes Em-1260-F4R3, Em-NAD5-F3R5 and Em-U1-F4R1,

[0008] Em-1260-F4: TGGTGACAGGGATTAGATACCC;

[0009] Em-1260-R3: GGTGGACCATCCTTTACTATGC;

[0010] Em-NAD5-F3: TGATGTTATGTTGTCGTTGTTTCA;

[0011] Em-NAD5-R5: CAATTTCTAGCTTGAGAACCACC;

[0012] Em-U1-F4: TCGCTCGGGTGCATAGTTT;

[0013] Em-U1-R1: CAGTAGGAGTGAGAGAGAGGGATG.

[0014] The application is based on a kit for detecting multilocular hydatidosis by multiplex PCR-CRISPR / Cas12a based on circulating free DNA, which comprises the primer pair for detecting multilocular hydatidosis by multiplex PCR-CRISPR / Cas12a based on circulating free DNA according to any one of the technical solutions in the application.

[0015] The application is based on a system for detecting multilocular hydatidosis by multiplex PCR-CRISPR / Cas12a based on circulating free DNA, which comprises the following reaction system: 2 μL of 10×Holmes No. 1 buffer; 1 μL of 10 μM FAM-8C-BHQ1; 1-4 μL of 10 μM crRNA; 1-2.5 μL of 10 M Lb5Cas12a; 2 μL of template; and RNAase-free water, and the total volume of the system is supplemented to 20 μL; wherein the template is the PCR product amplified by the kit for detecting multilocular hydatidosis by multiplex PCR-CRISPR / Cas12a based on circulating free DNA according to any one of the technical solutions in the application.

[0016] The application is based on a system for detecting multilocular hydatidosis by multiplex PCR-CRISPR / Cas12a based on circulating free DNA, which comprises the following reaction system: 2 μL of 10×Holmes No. 1 buffer; 1 μL of 10 μM FAM-8C-BHQ1; 1-4 μL of 10 μM crRNA; 1-2.5 μL of 10 M Lb5Cas12a; 2 μL of template; and RNAase-free water, and the total volume of the system is supplemented to 20 μL; wherein the template is the PCR product amplified by the kit for detecting multilocular hydatidosis by multiplex PCR-CRISPR / Cas12a based on circulating free DNA according to any one of the technical solutions in the application.

[0017] The technical solutions adopted by the application can achieve the following beneficial effects:

[0018] The application is based on the primer pair, kit, system and application of multiplex PCR-CRISPR / Cas12a for detecting multilocular hydatid disease through circulating free DNA. First, the primer pair Em-1260-F4R3, Em-NAD5-F3R5 and Em-U1-F4R1 is provided, and multiple target genes can be amplified simultaneously through multiplex PCR technology, thereby improving the sensitivity and specificity of detection. Further, the application also combines the CRISPR-Cas12a system, and the accuracy and sensitivity of detection can be further enhanced through the screened crRNA. That is, the application can realize rapid and sensitive detection through the multiplex PCR-CRISPR / Cas12a detection system, without the need for complex equipment and operation, and the incidence of false negative results is also reduced.

[0019] In addition, the preferred technical scheme of the application also has the following beneficial effects:

[0020] The application screens the Taq enzyme concentration, specifically, the Taq enzyme concentration is 2U, which can improve the amplification efficiency and sensitivity, avoid the side reaction caused by too high Taq enzyme concentration, and reduce the increase of non-specific amplification or the interference of enzyme activity. In addition, the application can also avoid the false positive fluorescent signal caused by non-specific amplification, thereby reducing the specificity.

[0021] The application screens the annealing temperature, specifically, the annealing temperature is 54℃, which can reduce non-specific amplification, improve product purity, avoid non-specific binding caused by too low temperature, and ensure that the primer can be stably combined with the target sequence, so that as many target sequences as possible are amplified in each cycle, thereby improving the amplification efficiency. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0023] Figure 1 is the fluorescence PCR graph when the 1260 gene primer is screened in example 1;

[0024] Figure 2 is the fluorescence PCR graph when the Nad5 gene primer is screened in example 1;

[0025] Figure 3 is the fluorescence PCR graph when the U1 gene primer is screened in example 1;

[0026] Figure 4 is the result graph of the influence of the amount of Taq enzyme on PCR in example 2;

[0027] Figure 5 is a result graph of the effect of annealing temperature on Em triple PCR in Example 3;

[0028] Figure 6 is a fluorescent PCR graph of triple primer compared with Em-1260-F4R3P2 in Example 4;

[0029] Figure 7 is a fluorescent PCR graph of triple primer compared with Em-NAD5-F3R5P2 in Example 4;

[0030] Figure 8 is a fluorescent PCR graph of triple primer compared with Em-U1-F4R1P1 in Example 4;

[0031] Figure 9 is a gel electrophoresis result graph of triple PCR in Example 4;

[0032] Figure 10 is a result graph of 1260 gene crRNA screening in Example 5;

[0033] Figure 11 is a result graph of Nad5 gene crRNA screening in Example 5;

[0034] Figure 12 is a result graph of U1 gene crRNA screening in Example 5;

[0035] Figure 13 is a result graph of CRISPR detection under each crRNA combination in Example 5;

[0036] Figure 14 is a result graph of CRISPR detection under each crRNA combination under low concentration of PCR template product in Example 5;

[0037] Figure 15 is a result graph of CRISPR detection under different Lb5Cas12a and crRNA concentrations with 1260 gene as target gene in Example 6;

[0038] Figure 16 is a result graph of CRISPR detection under different Lb5Cas12a and crRNA concentrations with Nad5 gene as target gene in Example 6;

[0039] Figure 17 is a result graph of CRISPR detection under different Lb5Cas12a and crRNA concentrations with U1 gene as target gene in Example 6;

[0040] Figure 18is the result graph of the template concentration gradient detection of the CRISPR detection method in Example 7 with 1260 gene as the target gene;

[0041] Figure 19 is the result graph of the template concentration gradient detection of the CRISPR detection method in Example 7 with Nad5 gene as the target gene;

[0042] Figure 20 is the result graph of the template concentration gradient detection of the CRISPR detection method in Example 7 with U1 gene as the target gene;

[0043] Figure 21 is the result graph of the fitting Sigmoid Function in Example 7 with 1260 target gene;

[0044] Figure 22 is the result graph of the fitting Sigmoid Function in Example 7 with Nad5 target gene;

[0045] Figure 23 is the result graph of the fitting Sigmoid Function in Example 7 with U1 target gene;

[0046] Figure 24 is the result graph of the specificity analysis of the triple PCR-CRISPR detection method of Echinococcus multilocularis in Example 8. DETAILED DESCRIPTION

[0047] In order to make the objects, technical solutions and advantages of the present application clearer, the technical solutions of the present application will be described in detail below. Obviously, the described embodiments are only some of the embodiments of the present application, not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of protection of the present application.

[0048] The detection of circulating free DNA (cfDNA) and microRNA (miRNA) has potential in the diagnosis of AE. However, these methods still face the problems of high cost and high equipment requirements in practical application, which limits their wide application in popular areas. In addition, although the specificity of cfDNA is high, its sensitivity is still not ideal, and there is significant heterogeneity between different studies.

[0049] The multiplex PCR combined with CRISPR-Cas12a technology has shown significant advantages in detecting circulating free DNA (cfDNA) in patients with infectious diseases. First, the multiplex PCR technology can simultaneously amplify multiple target genes, improving the sensitivity and specificity of detection. By combining the CRISPR-Cas12a system, the accuracy and sensitivity of detection can be further enhanced, as the CRISPR-Cas12a system has high sequence specificity and can recognize and cut specific DNA sequences, thereby reducing the occurrence of false positive results.

[0050] Based on this, the application provides a primer pair, kit, system and application for detecting multilocular hydatid disease based on circulating free DNA using multiplex PCR-CRISPR / Cas12a. After amplifying the cfDNA of Echinococcus granulosus using multiplex PCR, rapid and sensitive detection can be performed without complex equipment and operation. This combination not only improves the sensitivity of detection, but also reduces the incidence of false positive results.

[0051] In addition, the combination of multiplex PCR and CRISPR-Cas12a also has advantages in detection speed. Traditional pathogen detection methods usually require several hours or even several days to obtain results, while the multiplex PCR and CRISPR-Cas12a system can complete detection in a short time, usually within 1 hour. This is particularly important for clinical diagnosis and public health monitoring that require rapid response.

[0052] The following will combine the attached Figures 1-24 The primer pair, kit, system and application for detecting multilocular hydatid disease based on circulating free DNA using multiplex PCR-CRISPR / Cas12a provided by the application will be described in detail through specific examples and application scenarios.

[0053] Example 1

[0054] This example describes the screening of primer pairs and probes for the PCR amplification system in detail.

[0055] This example describes the screening of primer pairs and probes for the PCR amplification system, including the following steps:

[0056] Step 110: Select 1260 genes, Nad5 genes and U1 genes of Echinococcus granulosus as the final target.

[0057] Step 120: Design PCR primer pairs and probes according to the selected conserved sequence region of Echinococcus granulosus. The primer and probe design sequences are shown in Table 1.

[0058] Table 1: Echinococcus granulosus PCR primer and probe sequence table

[0059]

[0060] Note: P is the sequence of fluorescent probe, 3' end is MGB quenching group, 5' end 1260 gene is 6-FAM dye, Nad5 gene is VIC dye, U1 gene is Cy5 dye.

[0061] Step 130: Determine the best primer combination by online verification and experimental screening. Specifically, prepare the Echinococcus multilocularis PCR reagent according to Table 2. Among them, use the High Affinity HotStart Taq enzyme and its matching PCR reagent of Tiangen.

[0062] Table 2 Echinococcus multilocularis PCR reaction system table

[0063]

[0064]

[0065] The reaction procedure is: 95℃ 5min;

[0066] 95℃ 30s, 60℃ 45s, 40 cycles.

[0067] Select the final primer and probe according to the Ct value.

[0068] Figures 1-3 The fluorescence PCR graphs of the primers and probes of Echinococcus multilocularis 1260 gene, Nad5 gene and U1 gene during screening are shown respectively. From the point of view, for 1260 gene, select Em-1260-F4R3P2 (product length 123bp); from the point of view, for Nad5 gene, select Em-Nad5-F3R5P2 (product length 114bp); from the point of view, for U1 gene, select Em-U1-F4R1P1 (product length 125bp). Figure 1 Figure 2 Figure 3

[0069] Example 2

[0070] This embodiment details the screening of the concentration of Taq enzyme in the PCR reaction system.

[0071] Use the primers screened in Example 1 to screen the concentration of Taq enzyme. Prepare the reagents according to the single PCR system and the three PCR system shown in Table 3 and Table 4.

[0072] Table 3 Single PCR system configuration table

[0073] Singleplex PCR mix Volume (mL) 2U Volume (mL) 3U DNA template 2 2 Taq enzyme (5 U / m L) 0.4 0.6 Deoxynucleotide triphosphates (25 mM) 0.2 0.2 Forward primer (10 mM) 0.6 0.6 Reverse primer (10 mM) 0.6 0.6 Probe (10 mM) 0.4 0.4 10X Holmes 1 Buffer 2 2 RNase free water 13.8 13.6 Total 20 20

[0074] ​​​Table 4 Triple PCR system configuration table

[0075]

[0076]

[0077] The reaction procedure was: 95℃ 5min;

[0078] 95℃ 30s, 60℃ 45s, 40 cycles.

[0079] The FAM, VIC and Cy5 fluorescence signals were collected.

[0080] Figure 4 The effect of Taq enzyme usage on PCR is shown. Figure 4 The single template PCR results (2U and 3U groups) and triple PCR detection results under three template mixing (2U Mix group and 3U Mix group) are shown respectively. Figure 4 It can be seen that under the fixed Taq enzyme concentration, the single template amplification CT value is very close to the three template amplification CT value. It is shown that under this system, the three template amplification system does not significantly reduce the amplification efficiency of the single template. And the transverse comparison of the Taq enzyme usage of 2U and 3U will find that the usage of 2U and 3U cannot form significant difference. Therefore, the triple PCR system selects 2U as the usage of Taq enzyme.

[0081] Example 3

[0082] This embodiment details the annealing temperature screening.

[0083] Using the primers and Taq enzyme concentration screened in Example 1 and Example 2, the triple PCR reaction system is determined, and the annealing temperature is screened. Three test groups with annealing temperatures of 54℃, 55℃ and 56℃ are set.

[0084] The reaction procedure was: 95℃ 5min;

[0085] 95℃ 30s, 60℃ 45s, 40 cycles.

[0086] The FAM, VIC and Cy5 fluorescence signals were collected.

[0087] Figure 5 The effect of annealing temperature on Em triple PCR is shown. Figure 5 It can be seen that in the triple PCR system composed of three templates, the three target genes have lower CT values at the annealing temperature of 54℃. Considering the three targets, 54℃ is selected as the annealing temperature.

[0088] Example 4

[0089] The present embodiment details the construction of a triple PCR system.

[0090] Based on the primers and probes screened in Example 1, the concentration of Taq enzyme screened in Example 2, and the annealing temperature screened in Example 3, a triple PCR system was constructed. Specifically, the triple primers composed of Em-1260-F4R3P2, Em-NAD5-F3R5P2, and Em-U1-F4R1P1 were tested respectively compared with single primers. The reaction system is shown in Table 3 and Table 4.

[0091] Figures 6-8 The fluorescence PCR graphs of the triple primers compared with Em-1260-F4R3P2, Em-NAD5-F3R5P2, and Em-U1-F4R1P1 are shown respectively. Figures 6-8 It can be seen that when the amount of Taq enzyme is 2U, the results of triple primers and single primers are similar.

[0092] Further, by using the plasmids with concentrations of 8 copies / test and 5 copies / test, the triple PCR system of the triple primers composed of Em-1260-F4R3P2, Em-NAD5-F3R5P2, and Em-U1-F4R1P1 was preliminarily verified for sensitivity on two device platforms of ABIQ5 PCR analyzer and Hongshi SLAN 96P PCR analyzer, and the detection results are shown in Table 5.

[0093] Table 5 Sensitivity detection results of triple PCR system

[0094]

[0095] Further, the triple PCR amplification products were analyzed by agarose gel electrophoresis (1% agarose gel electrophoresis, 120V electrophoresis for 30min), and the results are shown in Table 6. Figure 9 It can be seen from Table 6 that the triple primers composed of Em-1260-F4R3P2, Em-NAD5-F3R5P2, and Em-U1-F4R1P1 can meet the performance requirements. Figure 9 Example 5

[0096] The present embodiment details the establishment of a CRISPR detection system for Echinococcus multilocularis.

[0097] 1. In vitro transcription and purification of Echinococcus multilocularis Cas12a crRNA

[0098]

[0099] ​The in vitro transcription and purification of Cas12a crRNA were performed using ToloBio's 31903 Cas12a High Yield crRNA Synthesis and Purification Kit (Cat. No. 31903, ToloBio), and the specific process is shown as follows.

[0100] (1) Preparation of DNA transcription template

[0101] After the Cas12a Sense Oligo and Target Antisense Oligo series (see Appendix) primer annealing reaction is completed, it can be used as a transcription template for in vitro transcription to prepare crRNA for specific target genes. Different Target Antisense Oligos correspond to different target gene sequences, and by designing a series of Target Antisense Oligos, detection or editing of different target genes can be achieved. Specifically, the Target Antisense Oligo sequence used for in vitro transcription of Echinococcus multilocularis crRNA in this embodiment is shown in Table 6.

[0102] Table 6 Target Antisense Oligo sequence used for in vitro transcription of Echinococcus multilocularis crRNA

[0103]

[0104]

[0105]

[0106] (a) Preparation of annealing extension system

[0107] Specifically, the annealing extension system was prepared according to Table 7.

[0108] Table 7 Configuration table of annealing extension system

[0109] Component Volume 10X Annealing Buffer 2 pL Cas12a Sense Oligo (10 pM) 0.5 pL Target Antisense Oligo (10 pM) 0.5 pL Nuclease free water 17 pL

[0110] (b) PCR annealing extension program setting

[0111] Specifically, the PCR annealing extension program was set according to Table 8.

[0112] Table 8 PCR annealing extension program setting table

[0113] Temperature Conditions 95℃ 2 min 95℃→25℃ AT = -2 °C / cycle, 1 s / cycle, 35 cycles 25℃ Stable

[0114] (2) In vitro transcription of Cas12a crRNA

[0115] (a) Preparation of the reaction system

[0116] Specifically, the preparation of the Cas12a crRNA in vitro transcription reaction system was performed according to Table 9.

[0117] Table 9. Cas12a crRNA in vitro transcription reaction system table

[0118] Component Volume 5X TranscriptMax Reaction Buffer 4 pL Nucleotide Triphosphate Mix 8 pL TranscriptMax Enzyme Mix 2.1 pL Nuclease free water 0.9 pL DNA transcription template 5 pL

[0119] (b) Mix the above reagents well, centrifuge briefly, and incubate at 37°C for 2-4 h for in vitro transcription. Prolonged transcription time can increase the transcription yield. If the transcription product is used for CRISPR detection, it is recommended to transcribe overnight for 12-16 h.

[0120] (c) After incubation at 37°C, prepare 30 μL of type I DNA nuclease reaction solution according to Table 10 and add it to 20 μL of in vitro transcription product to remove the DNA template in the transcription system.

[0121] Table 10. Preparation of type I DNA nuclease reaction solution

[0122] Component Volume 2X DNase I Buffer Type I 25 pL DNase I Type I 4 pL Nuclease free water 1 pL

[0123] Type I DNA nuclease reaction conditions: 37°C, 30 min.

[0124] (3) Purification of Cas12a crRNA transcription product

[0125] (a) Take the magnetic beads out of the 4°C refrigerator and place them at room temperature for about 30 min to balance the temperature to room temperature. Invert or vortex to mix the magnetic beads well, and then take 25 μL of magnetic beads and 50 μL of isopropanol and add them to 50 μL of the crRNA sample to be purified. Mix well by blowing with a pipette.

[0126] (b) Incubate at room temperature for 5 min to allow the RNA to bind to the magnetic beads.

[0127] (c) Place the sample on a magnetic stand for 5 min, and after the solution is clarified, carefully remove the supernatant.

[0128] (d) Keep the sample on the magnetic stand, add 200 μL of freshly prepared 80% ethanol, rinse the magnetic beads, incubate at room temperature for 30 s, and carefully remove the supernatant.

[0129] Note: The 80% (v / v) ethanol used for rinsing needs to be freshly prepared with nuclease-free water. For example, take 8 mL of anhydrous ethanol and 2 mL of nuclease-free water, mix well, and you will get 10 mL of 80% (v / v) ethanol.

[0130] (e) Repeat step (d) for a total of 2 rinses.

[0131] (f) Keep the sample on the magnetic stand all the time, open the cover and air dry the magnetic beads for 5 min.

[0132] Note: Avoid over-drying when air-drying the magnetic beads. If the magnetic beads crack, it indicates that the magnetic beads are over-dried, and the elution efficiency of RNA will be reduced at this time.

[0133] (g) Take the sample out of the magnetic stand, add 50 μL of nuclease-free water, and mix well with a pipette. Let it stand at room temperature for 5 min.

[0134] (h) Place the sample on the magnetic stand for 5 min. After the solution is clear, carefully transfer the supernatant to a new nuclease-free PCR tube to obtain the purified Cas12a crRNA.

[0135] 2. Echinococcus multilocularis CRISPR system crRNA screening

[0136] (1) Prepare the Echinococcus multilocularis triple PCR reaction system according to Table 11.

[0137] Table 11 Echinococcus multilocularis triple PCR reaction system

[0138] Reagent name Volume (mL) 2U DNA template 2 Taq enzyme (5 U / m L) 0.4 Deoxynucleotide triphosphates (25 mM) 0.2 Forward primer (10 mM) 0.6 Reverse primer (10 mM) 0.6 10X Holmes 1 Buffer 2 RNase free water 14.2 Total 20

[0139] Reaction program: 95℃ 5min;

[0140] 95℃ 30s, 54℃ 45s, 40 cycles.

[0141] The template concentration of the PCR system is 200 copies / Test.

[0142] The primers selected are Em-1260-F4R3, Em-NAD5-F3R5, and Em-U1-F4R1. Among them, the forward primers of 1260, NAD5 and U1 genes are mixed in equal proportions, i.e. the forward primers of 1260, NAD5 and U1 genes are 0.2 μL respectively; similarly, the reverse primers of 1260, NAD5 and U1 genes are 0.2 μL respectively.

[0143] The PCR product is stored at -20℃ and used as a template for subsequent crRNA screening experiments.

[0144] (2) crRNA design

[0145] According to the better performing PCR primers screened from Echinococcus multilocularis, the corresponding Cas12a crRNA is designed within the range of the amplified fragments, and the sequence is shown in Table 12 Echinococcus multilocularis crRNA sequence. The underlined part represents the target recognition region.

[0146] Table 12 crRNA sequences of E. granulosus

[0147]

[0148]

[0149] (3) Single crRNA screening of E. granulosus CRISPR system

[0150] Based on the PCR products, the crRNA screening of E. granulosus CRISPR system was carried out, and the details are shown in Table 13 Single crRNA screening system of E. granulosus CRISPR system.

[0151] Table 13 Single crRNA screening system of E. granulosus CRISPR system

[0152]

[0153]

[0154] Through the PCR products of 200 copies of plasmids of each target gene, crRNA screening was carried out. The results are shown in Table 14. Figures 10-12 As shown in Table 14, the following alternative crRNAs were obtained for 1260 gene, Nad5 gene and U1 gene in single CIRSPR detection, respectively: Figures 10-12

[0155] 1260 gene: crRNA7 and crRNA11;

[0156] Nad5 gene: crRNA10, crRNA4, crRNA6 and crRNA11;

[0157] U1 gene: crRNA8, crRNA1, crRNA2 and crRNA3.

[0158] (4) Triple crRNA screening of E. granulosus CRISPR system

[0159] According to the strong signal crRNA screened in the single CRISPR system, different triple CRISPR detection systems were obtained by permutation and combination. According to the signal strength formed by different crRNA combinations in CRISPR, the group with strong signal was screened as the best combination.

[0160] The preparation of triple crRNA CRISPR system is shown in Table 14.

[0161] Table 14 Triple crRNA screening system of E. granulosus CRISPR system

[0162] ​ Triple CIRSPR Volume (mL) 10X Holmes 1 Buffer 2 FAM-8C-BHQ1 (10 pM) 1 crRNA (10 pM) 1 Lb5Cas12a (10 pM) 1 Nuclease free water 13 Template (PCR product) 2 Total 20

[0163] Reaction condition, 48°C, 10min incubation, collect FAM fluorescence signal every 30s.

[0164] When there is no significant difference between the detection results, reduce the template concentration of PCR stage (from 200 copies / Test to 100 copies / Test), and then further screening. Until there is a significant difference.

[0165] Specifically, when performing triple CRISPR screening, there are 32 combinations, as shown in Table 15.

[0166] Table 15 crRNA combination table when performing triple CRISPR screening

[0167]

[0168]

[0169] Using the triple PCR product of a single template, detection was performed in triple CRISPR to evaluate the influence of different crRNA combinations on the detection signal results, and the results are shown in Table 15 and Figure 13

[0170] Here, the data processing introduces an algorithm (C20-C1) / NC, which represents the ratio of the fluorescence rise value of the test group (the fluorescence value of the 20th detection minus the fluorescence value of the 1st detection) to the fluorescence value of the corresponding NC sample of the 1st detection. Observe the fluorescence rise multiple. The higher the fluorescence rise multiple, the better the reaction effect in CRISPR detection. In this way, the influence of each crRNA combination on the CRISPR reaction efficiency is evaluated.

[0171] From Table 15 or Figure 13 It can be seen that: for U1 target, crRNA is Em-U1-crRNA1, Em-U1-crRNA2, Nad5 target, crRNA is Em-Nad5-crRNA6, Em-Nad5-crRNA11, the relative signal is relatively strong. The two alternative crRNAs of 1260 target have no significant influence.

[0172] Further, using the PCR product of 100 copies / Test plasmid template, the crRNA combinations screened above are further analyzed, and at this time there are 8 combinations of crRNA, as shown in Table 16.

[0173] Table 16 crRNA combination table when performing triple CRISPR screening

[0174] ​

[0175] The detection results of 100 copies / Test template PCR products are shown in Table 16 and Figure 14 From the results, Em-1260-crRNA11 is more effective for 1260 target. Among Nad5 targets, Em-Nad5-crRNA6 and Em-Nad5-crRNA11 have no significant difference. Em-U1-crRNA1 and Em-U1-crRNA2 of U1 target also have no significant difference. Considering the average signal intensity of the three detection systems, the fifth group combination of this result, i.e. Em-1260-crRNA11, Em-Nad5-crRNA6 and Em-U1-crRNA1, is selected as the crRNA option of triple CRISPR.

[0176] Example 6

[0177] This embodiment describes in detail the optimization of Echinococcus multilocularis CRISPR detection system.

[0178] This embodiment optimizes Echinococcus multilocularis CRISPR Lb5Cas12a and crRNA concentration. According to Table 17, the reaction system configuration of Echinococcus multilocularis CRISPR detection method Lb5Cas12a and crRNA concentration configuration is configured. At the same time, the cross reaction of Lb5Cas12a enzyme concentration and crRNA enzyme concentration is carried out.

[0179] In the PCR stage, the PCR template concentration is adjusted to 10 copies / Test, and each target uses three PCR systems to amplify 8 groups, and the amplified products are mixed. Then CRISPR detection screening is carried out.

[0180] Table 17 Configuration table of Echinococcus multilocularis CRISPR detection method Lb5Cas12a and crRNA concentration

[0181]

[0182]

[0183] Among them, the crRNA is mixed in equal proportion, and the total concentration is 10 μM. And the final concentration of crRNA is not less than the concentration of Lb5Cas12a enzyme.

[0184] Figures 15-17 The CRISPR detection results under different Lb5Cas12a and crRNA concentrations are shown respectively for 1260, Nad5 and U1 as target genes. From Figures 15-17It can be seen that for 1260, Nad5 and U1 target genes, Lb5Cas12a and crRNA can obtain maximum fluorescence enhancement multiple at 500nM. Increasing enzyme or crRNA does not form a detection advantage.

[0185] Example 7

[0186] This embodiment describes in detail the detection limit of E. granulosus CRISPR detection method.

[0187] According to the results of the foregoing examples, the reaction system (PCR stage without probe) is set. The E. granulosus template concentration gradient is set: 100 copies / Test, 30 copies / Test, 10 copies / Test, 3 copies / Test and 1 copies / Test, and each concentration gradient is repeated 15 times.

[0188] By the detection rate at each concentration, Sigmoid Function is fitted to calculate the copy number of each target gene required for 95% detection rate.

[0189] Figures 18-20 The results of the CRISPR detection method template concentration gradient detection are shown respectively with 1260 gene, Nad5 gene and U1 gene as target genes.

[0190] According to the fluorescence signal rising multiple, the detection rate at each concentration gradient is analyzed to obtain the results of Table 18.

[0191] Table 18 E. granulosus CRISPR detection method detection rate analysis table

[0192]

[0193] The copy number data at 95% detection rate is calculated by fitting Sigmoid Function.

[0194] Fitting software: python version 3.12;

[0195] Data analysis library:

[0196] nμMpy-1.26.4-cp312-cp312-win_amd64.whl;

[0197] matplotlib-3.8.3-cp312-cp312-win_amd64.whl;

[0198] scipy-1.12.0-cp312-cp312-win_amd64.whl;

[0199] Standard formula: f(x)=1.0 / (1.0+np.exp(-a*(xb))); The constants of the fitting equation corresponding to each target gene are shown in Table 19.

[0200] Table 19 shows the constants of the fitting equations for each target gene.

[0201] Fitted equation constant 1260 Nad5 U1 a 0.93912745 1.43696527 8.494756 b 2.82267186 2.90580657 3.081597 95% detection LoD (copies) 5.958 4.955 3.428

[0202] When data is input, it is assumed that no template is available and therefore no copies can be detected, resulting in 0 copies and a 0 detection rate.

[0203] Figures 21-23 The results of fitting the Sigmoid Function with 1260, Nad5, and U1 as target genes are shown in the diagrams. Figures 21-23 The number of copies required for a 95% detection rate can be calculated, thus yielding the detection limit. Figures 21-23 According to the fitted data, the detection limit for the 1260 target gene is 6 copies / test, the detection limit for the Nad5 target gene is 5 copies / test, and the detection limit for the U1 target gene is 3.4 copies / test.

[0204] Example 8

[0205] This embodiment provides a detailed description of the specificity of the triple PCR CRISPR detection method for Echinococcus multilocularis.

[0206] The CRISPR detection system for *Echinococcus multilocularis* constructed based on the results of the aforementioned embodiments was used to detect *Candida albicans*, *Staphylococcus aureus*, human cytomegalovirus, and serum samples from hepatitis B and hepatitis C. Specificity was analyzed, and a positive control group (PC) was set up. Detection results are as follows: Figure 24 As shown. From Figure 24 It was found that a total of 5 Staphylococcus aureus (Sau), 4 Candida albicans (Cal), 1 human cytomegalovirus (CMV), 1 hepatitis B (HBV), and 1 hepatitis C (HCV) samples were tested. Based on the comparison of fluorescence intensity, the increase in fluorescence intensity of these samples was less than 10%, indicating a significantly negative result.

[0207] Example 9

[0208] This embodiment provides a detailed description of a method for detecting multilocular echinococcosis using multiplex PCR-CRISPR / Cas12a based on circulating cell-free DNA.

[0209] This embodiment describes a method for detecting multilocular echinococcosis based on multiplex PCR-CRISPR / Cas12a using circulating cell-free DNA, comprising the following steps:

[0210] Step 210: Obtain the cfDNA of the sample as the test sample.

[0211] cfDNA can exist in the blood of patients, and efficient isolation of cfDNA is crucial for the detection of low concentration target sequences. Specifically, the Quick-cfDNA Serum & Plasma kit (No. D4076) purchased from Zymo Research Company was used to extract plasma cfDNA, which showed the best target cfDNA isolation efficiency and stable CRISPR signal. All operation steps were carried out at room temperature, unless otherwise specified, and strictly followed the manufacturer's operation manual. The specific steps are as follows: 1 mL of isolated plasma was mixed with 250 μL S&P 5x digestion buffer and 100 μL proteinase K (20 mg / mL), incubated at 55°C for 30 minutes, then 2.7 mL S&P DNA binding buffer was added, and the target DNA was captured by Zymo-Spin III-S column (centrifuged at 1000g for 2 minutes). After two washes, 400 μL S&P DNA pretreatment buffer and 700 μL S&P DNA wash buffer were used respectively, and finally 50 μL DNA elution buffer was used to elute cfDNA at 60°C, and stored at -80°C for use.

[0212] Step 220: Using the optimized triple PCR and CRISPR detection system, cfDNA samples were detected. Part of the template was detected by triple qPCR (probe method), and part of the template was detected by triple PCR (without fluorescence) and CRISPR detection, and the results between qPCR and CRISPR detection were compared, and the results are shown in Table 20 and Table 21.

[0213] Table 20 Real sample, detection sample preparation and detection results

[0214]

[0215] Table 21 Echinococcus multilocularis real sample cfDNA detection results

[0216] Serial number Sample number qPCR CRISPR 1 Ech001 - Positive 2 Ech002 - Positive 3 Ech003 - - 4 Ech004 - - 5 Ech005 - Positive 6 Ech006 - Positive 7 Ech007 - - 8 Ech008 - - 9 Ech009 34.07(U1) Positive 10 Ech010 - - 11 Ech011 - - 12 Ech012 - - 13 Ech013 - - 14 Ech014 - - 15 Ech015 - - 16 Ech016 - - 17 Ech017 - - 18 Ech018 - - 19 Ech019 - -

[0217] A total of 19 cases of Echinococcus multilocularis cfDNA samples were detected. Among them, 5 cases of samples had significant fluorescence signal rise, with strong positive signal. qPCR only detected one sample, and the CT value came from U1 gene amplification results.

[0218] It can be known from the above examples that the primer pair, kit, system and application of the application based on the multiplex PCR-CRISPR / Cas12a detection of cystic echinococcosis can rapidly and sensitively detect the specific cfDNA of the peripheral blood of a hydatid disease patient. Through a clinical application test verification, the method of the application is faster than a conventional method, less expensive, excellent in specificity, and the detection limit of Em reaches a single copy / test, indicating that the sensitivity is high.

[0219] The above merely provides a specific implementation of the application, but the protection scope of the application is not limited thereto, and any person skilled in the art can easily think of changes or replacements within the technical range disclosed by the application, which should be encompassed in the protection scope of the application.

Claims

1. A primer pair for detecting multilocular hydatid disease based on circulating free DNA by multiplex PCR-CRISPR / Cas12a, characterized in that, PCR primer pairs including Em-1260-F4R3, Em-NAD5-F3R5 and Em-U1-F4R1, Em-1260-F4: TGGTGACAGGGATTAGATACCC; Em-1260-R3: GGTGGACCATCCTTTACTATGC; Em-NAD5-F3: TGATGTTATGTTGTCGTTGTTTCA; Em-NAD5-R5: CAATTTCTAGCTTGAGAACCACC; Em-U1-F4: TCGCTCGGGTGCATAGTTT; Em-U1-R1: CAGTAGGAGTGAGAGAGAGGGATG.

2. The primer pair for detecting hydatid disease based on circulating free DNA by multiplex PCR-CRISPR / Cas12a according to claim 1, characterized in that, For 1260 gene, Nad5 gene and U1 gene, also include probes Em-1260-P2, Em-Nad5-P2 and Em-U1-P1, wherein, Em-1260-P2: AATGGTTTGGCAGTGAGTGATT; Em-Nad5-P2: ATTTATGTTAGTTGGTGACGTAATGA; Em-U1-P1: AGCCTTCGGGCGTCCCTTTC.

3. A kit for detecting multilocular hydatidosis based on circulating free DNA by multiplex PCR-CRISPR / Cas12a, characterized by, The primer pair for detecting hydatid disease based on circulating free DNA by multiplex PCR-CRISPR / Cas12a according to claim 1 or 2.

4. The kit for detecting hydatid disease based on circulating free DNA by multiplex PCR-CRISPR / Cas12a according to claim 3, characterized in that, The triple PCR reaction system comprises: 5U / μL Taq enzyme 0.4 μL; 25mM deoxynucleotide triphosphate 0.2 μL; 10× start solution 2 μL; 10μM Em-1260-F4 0.2 μL; 10μM Em-1260-R3 0.2 μL; 10μM Em-NAD5-F3 0.2 μL; 10μM Em-NAD5-R5 0.2 μL; 10μM Em-U1-F4 0.2 μL; 10μM Em-U1-R1 0.2 μL; Rnase-free water 14.2 μL DNA template 2 μL.

5. The circulating cell-free DNA based multiplex PCR-CRISPR / Cas12a detection kit for hydatid disease according to claim 3, characterized in that, The triple PCR reaction system comprises: 5U / μL Taq enzyme 0.4 μL; 25mM deoxynucleotide triphosphate 0.2 μL; 10× start solution 2 μL; 10μM Em-1260-F4 0.6 μL; 10μM Em-1260-R3 0.6 μL; 10μM Em-1260-P2 0.4 μL; 10μM Em-NAD5-F3 0.6 μL; 10μM Em-NAD5-R5 0.6 μL; 10μM Em-NAD5-P2 0.4 μL; 10μM Em-U1-F4 0.6 μL; 10μM Em-U1-R1 0.6 μL; 10μM Em-U1-P1 0.4 μL; Rnase-free water 6.6 μL DNA template 6 μL.

6. The multiplex PCR-CRISPR / Cas12a based detection kit for hydatid disease according to claim 4 or 5, characterized in that, The reaction conditions of the triple PCR reaction system are as follows: 95 °C 5 min, 95 °C 30 s, 60 °C 45 s, 40 cycles; And / or, the annealing temperature of the triple PCR reaction system is 54 °C.

7. A system for detecting multilocular hydatid disease based on circulating free DNA by multiplex PCR-CRISPR / Cas12a, characterized by, Comprise: 10x Holmes No. 1 buffer 2 μL; 10 μM FAM-8C-BHQ1 1 μL; 10 μM crRNA 1-4 μL; 10 M Lb5Cas12a 1-2.5 μL; Template 2 μL; RNase-free water, and the total volume of the system is supplemented to 20 μL; The template is a PCR product amplified by the kit for detecting hydatid disease based on circulating free DNA multiple PCR-CRISPR / Cas12a according to any one of claims 3 to 6.

8. The circulating cell-free DNA based multiplex PCR-CRISPR / Cas12a system for detecting hydatid disease according to claim 7, characterized in that, The crRNA comprises a combination of Em-1260-crRNA11, Em-Nad5-crRNA6 and Em-U1-crRNA1, wherein, Em-1260-crRNA11: UAAUUUCUACUAAGUGUAGAUAGAACAACCUUACAAAAUAU; Em-Nad5-crRNA6: UAAUUUCUACUAAGUGUAGAUGGUGACGUAAUGAGUGGUAG; Em-U1-crRNA1: UAAUUUCUACUAAGUGUAGAUGCCAGUGGGGAGCCUUCGGG.

9. The system for detecting hydatid disease based on circulating free DNA multiple PCR-CRISPR / Cas12a according to claim 7 or 8 is applied to the detection of hydatid disease.

10. Use of the multiplex PCR-CRISPR / Cas12a detection system based on circulating free DNA for the detection of hydatid disease according to claim 9, characterized in that, The cfDNA of the patient is used as the sample to be tested, wherein the cfDNA is extracted from the peripheral blood of the patient.

Images