Composition, method and kit for identifying African swine fever virus

By designing specific primers and probes and using a triple fluorescent PCR method, the problem of difficulty in identifying different strains of ASFV in existing technologies has been solved, enabling rapid, simple, and efficient ASFV detection with high sensitivity and specificity.

CN120989301APending Publication Date: 2025-11-21SHANGHAI VETERINARY RESEARCH INSTITUTE CAAS (CHINESE ANIMAL HEALTH & EPIDEMIOLOGY CENTER SHANGHAI BRANCH) +4
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410626758.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-05-20
Publication Date
2025-11-21

AI Technical Summary

Technical Problem

Existing technologies are insufficient for rapidly and accurately identifying attenuated, virulent, and genotype II African swine fever virus (ASFV) strains. Furthermore, the B646L gene is highly conserved across different strains, making it unsuitable for differential diagnosis.

Method used

Primers and probes were designed and synthesized. Sequence alignment analysis was performed using SnapGene software. Genes such as A151R, M14L, and B646L were selected. Accurate detection of different ASFV strains was achieved using triple fluorescent PCR. The B646L primers and probes recommended in GB/T 18648—2020 were used, and primers and probes were designed for the A151R and M14L genes.

Benefits of technology

It enables rapid, simple, efficient and accurate detection of ASFV, with high sensitivity and specificity. It can identify different strains at low copy numbers and does not cross-react with other swine pathogens, with good repeatability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120989301A_ABST
    Figure CN120989301A_ABST
Patent Text Reader

Abstract

The nucleic acid composition is used for identifying a gene I type African swine fever virus attenuated virus, a gene I type African swine fever virus virulent virus and a gene II type African swine fever virus, and comprises a first group of A151R gene primers, a second group of M14L gene primers and a third group of B646L gene primers. Through verification in the aspects of sensitivity, specificity, repeatability, clinical sample detection and the like, the lowest detection limit of the nucleic acid composition provided by the invention on the A151R and B646L genes can reach 10 copy numbers, the lowest detection limit of the M14L gene can reach 100 copy numbers, and the sensitivity is high. Only ASFV is specifically amplified, cross reaction with PRRSV, CSFV, JEV, PRV, PADV and PEDV is avoided, and the specificity is good. Besides, the detection variable coefficient is less than 2.17%, the repeatability is good, and the gene I type African swine fever virus attenuated virus, the gene I type African swine fever virus virulent virus and the gene II type African swine fever virus can be effectively identified.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a composition for detection, and more particularly to a composition for identifying African swine fever virus, and a detection kit thereof. Background Technology

[0002] African swine fever (ASF) is an acute, highly contagious disease caused by the African swine fever virus (ASFV). Based on different clinical symptoms, it can be classified into peracute, acute, subacute, and chronic forms. The acute form is the most common, with a mortality rate as high as 100% (Chinese Journal of Veterinary Medicine, 2024, 44(01):1-6). ASF seriously threatens the development of the pig industry, causing significant economic losses to the pig industry and pork product trade in various countries and regions worldwide. It is listed as a notifiable animal disease by the World Organisation for Animal Health (WOAH) and is classified as a Class A animal disease in my country.

[0003] ASFV is the only member of the African swine fevervirus family and the African swine fever virus genus. It is an arbovirus, with arthropod ticks as its host and biological vector (doi:10.1099 / jgv.0.001049). ASFV is an icosahedral enveloped DNA virus with a genome length of 170–193 kb, containing 150–167 open reading frames encoding more than 150 genes. It has variable domains at both ends and conserved regions in the middle. The variable domains encode five multigene families (MGFs) (doi:10.13344 / j.microbiol.china.190023). Based on the 3' sequence difference of its B646L gene encoding the capsid protein P72, ASFV is divided into 24 genotypes (Transboundary and emerging diseases, 2017, 64(5):1393-1404). In 2021, Sun Encheng et al. (Emerging microbes infections, 2021, 10(1):31-30) successfully isolated genotype I ASFV, which has low pathogenicity but high transmissibility and its clinical manifestations are somewhat concealed. Zhao Dongming et al. (Nature communications, 2023, 14(1):3096-3096) isolated three naturally recombinant ASFV genotypes I and II, which have high lethality and high transmissibility. Since there are currently no safe and effective vaccines and drugs, my country mainly relies on quantitative real-time PCR for pathogen detection to promptly identify and eliminate sources of infection, thereby controlling the spread of ASFV. With the emergence of genotype I / II recombinant ASFV, there is an urgent need to establish a detection method that can quickly identify different strains. Currently, the main ASFV detection method is the qPCR method based on the B646L gene, but the B646L gene is highly conserved in different strains and is difficult to use for differential diagnosis. Summary of the Invention

[0004] One object of the present invention is to provide a nucleic acid composition for accurate detection of attenuated genotype I African swine fever virus, virulent genotype I African swine fever virus, and genotype II African swine fever virus.

[0005] Another objective of this invention is to provide a method for identifying ASFV, which uses quantitative real-time PCR to achieve accurate detection of attenuated genotype I African swine fever virus, virulent genotype I African swine fever virus, and genotype II African swine fever virus.

[0006] Another object of the present invention is to provide a kit that meets the needs for rapid, simple, efficient and accurate detection of ASFV.

[0007] Sequence alignment analysis was performed using SnapGene software. Primers and probes were designed and synthesized for seven genes: A118R, B407L, X64R, MGF360-13L (M13L), MGF360-14L (M14L), A151R, and B646L, and different gene combinations were explored. Through sample testing and sensitivity experiments, a triple fluorescent PCR detection method for African swine fever virus (ASFV) using the A151R+M14L+B646L combination was finally determined. This method allows for the simultaneous identification of attenuated, virulent, and ASFV genotype I and ASFV genotype II.

[0008] Among these genes, A151R is a non-structural protein of ASFV that may play an important role in viral replication and assembly, and is expressed in both the early and late stages of viral infection.

[0009] M14L belongs to a multi-gene family and plays an important role in ASFV replication, immune evasion, and pathogenicity.

[0010] The B646L gene, encoding the capsid protein P72, is highly conserved and is a target gene for ASFV nucleic acid detection recommended by the World Organisation for Animal Health (WOAH). This invention uses the B646L primers and probes recommended in GB / T 18648—2020 "African Swine Fever Diagnostic Techniques," and designs and synthesizes primers and probes targeting the conserved regions of the A151R and M14L genes.

[0011] This invention designs primers and probes targeting the A151R gene to accurately identify genotype I ASFV and genotype II ASFV. Simultaneously, primers and probes designed targeting the M14L gene accurately identify attenuated and virulent genotype I ASFV.

[0012] A nucleic acid composition for identifying attenuated genotype I African swine fever virus, virulent genotype I African swine fever virus, and genotype II African swine fever virus, comprising:

[0013] First set of A151R gene primers:

[0014] A151R-F: AAAGCTTATAGAGTGCATCGAA,

[0015] A151R-P: AATGAGGTGCTTAGCGGTGGTACA,

[0016] A151R-R: CAGATCATGATTGGCATTAAAGG;

[0017] Second set of M14L gene primers:

[0018] M14L-F:CCCGCCAATAGAGGTGATTT,

[0019] M14L-P: TTTGGTTTGCCCTGGCATTACGAC,

[0020] M14L-R: GCGCACCACCTATTAACAAAG;

[0021] Third set of B646L gene primers:

[0022] B646L-F: GCTTTCAGGATAGAGATACAGCTCT,

[0023] B646L-P: CCGTAACTGCTCATGGTATCAATCTTATCG,

[0024] B646L-R: CCGTAGTGGAAGGGTATGTAAGAG.

[0025] For suitability for quantitative real-time PCR detection, the nucleic acid compositions of the present invention have the following modifications: the 5' end of the A151R-P sequence is modified with a ROX fluorescent group, and the 3' end with a BHQ2 fluorescent group; the 5' end of the M14L-P sequence is modified with a CY5 fluorescent group, and the 3' end with a BHQ2 fluorescent group; and the 5' end of the B646L-P sequence is modified with a FAM fluorescent group, and the 3' end with a BHQ1 fluorescent group.

[0026] Validated in terms of sensitivity, specificity, repeatability, and clinical sample testing, the nucleic acid composition provided by this invention achieves a detection limit of up to 10 copies for the A151R and B646L genes and up to 100 copies for the M14L gene, demonstrating high sensitivity. It specifically amplifies only ASFV and does not cross-react with other porcine pathogens such as porcine reproductive and respiratory syndrome virus (PRRSV), porcine epidemic diarrhea virus (PEDV), Japanese encephalitis virus (JEV), pseudorabies virus (PRV), classical swine fever virus (CSFV), transmissible gastroenteritis virus (TGEV), and adenovirus (PADV), exhibiting good specificity. Furthermore, the coefficient of variation is less than 2.17%, demonstrating good repeatability and effectively identifying positive nucleic acid samples.

[0027] The detection kit made from the nucleic acid composition of the present invention can simultaneously identify attenuated type I ASFV, virulent type I ASFV, and type II ASFV. Attached Figure Description

[0028] Figure 1 This is a standard curve for triple fluorescence quantitative PCR;

[0029] Figure 2A Amplification curve for A151R gene detection;

[0030] Figure 2B The amplification curve for the M14L gene detection;

[0031] Figure 2C Amplification curve for the B646L gene detection;

[0032] Figure 3 The image shows the results of a specificity test for quantitative real-time PCR. In the image, 1 represents a positive plasmid, which includes three amplification curves from left to right for the genes A151R, B646L, and M14L, respectively. 2 to 8 correspond to PRRSV, CSFV, JEV, PRV, PADV, PEDV, and ddH2O, respectively.

[0033] Figure 4A The amplification curve of the A151R gene of genotype II ASFV strain;

[0034] Figure 4B The amplification curve of the B646L gene of the ASFV type II strain;

[0035] Figure 4C The amplification curve of the M14L gene of the ASFV type II strain;

[0036] Figure 5A The amplification curve of the A151R gene of a virulent ASFV type I strain;

[0037] Figure 5B The amplification curve of the B646L gene of a virulent ASFV type I strain;

[0038] Figure 5C The amplification curve of the M14L gene of a highly virulent ASFV strain of genotype I is shown. Detailed Implementation

[0039] The technical solution of the present invention will be described in detail below with reference to the accompanying drawings. The embodiments of the present invention are only used to illustrate the technical solution of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solution of the invention without departing from the spirit and scope of the technical solution of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention.

[0040] The specific experimental methods used in the following embodiments of the present invention are described below:

[0041] 1) Primers for detecting ASFV

[0042] The primers used for fluorescent PCR detection in this embodiment are shown in Table 1 below.

[0043] Table 1

[0044]

[0045] The determination of the test results is shown in Table 2 below:

[0046] Table 2

[0047]

[0048] 2) Establishment of standard curve

[0049] Using a mixed plasmid of equal concentrations of recombinant plasmids NHV-HN-A151R_pUC57, MGF360-14L_p3xflag-CMV-7.1, and B646L_p3xflag-CMV-7.1 as a template, at a concentration of 1×10⁻⁶... 8 ~1×10 3 After dilution to copies / μL, real-time quantitative PCR amplification was performed. Each dilution was repeated in triplicate, and a standard curve was plotted with the logarithm of the initial template concentration and the Ct value on the x and y axes.

[0050] 3) Sensitivity test

[0051] Using a mixed plasmid of equal concentrations of recombinant plasmids NHV-HN-A151R_pUC57, MGF360-14L_p3xflag-CMV-7.1, and B646L_p3xflag-CMV-7.1 as a template, at a concentration of 1×10⁻⁶... 8 ~1×10 0 After dilution to copies / μL, the sample was analyzed by real-time quantitative PCR to assess the sensitivity of the method.

[0052] 4) Specificity test

[0053] Using the mixed plasmids NHV-HN-A151R_pUC57, MGF360-14L_p3xflag-CMV-7.1, and B646L_p3xflag-CMV-7.1, as well as the nucleic acids of PRRSV, CSFV, JEV, PRV, PADV, and PEDV as templates, and ddH2O as a negative control, the method established in this experiment was used for detection to evaluate the specificity of the method.

[0054] 5) Repeatability

[0055] The 10x series 1.0×10 8 ~1.0×10 0 Using homologous plasmids of equal concentration (copies / μL) as templates, each dilution was tested three times using the method established in our laboratory. The coefficient of variation (Ct) for different testing times at the same dilution was calculated based on different Ct values ​​to evaluate the repeatability and stability of this real-time quantitative PCR method.

[0056] 6) Clinical sample testing

[0057] Select genotype II ASFV strain (titer 10) 7 TCID 50 Viral DNA was extracted from the virus and genotype I ASFV virulent strain ( / mL) and used as templates. After being diluted to different folds, the virus was detected using the triple fluorescence quantitative PCR method established in this study.

[0058] Example 1 Standard Curve

[0059] Using a mixture of recombinant plasmids NHV-HN-A151R_pUC57, MGF360-14L_p3xflag-CMV-7.1, and B646L_p3xflag-CMV-7.1 at equal concentrations as templates, and following a 1×10⁻⁶ ratio... 8 ~1×10 3 Dilute to copies / μL, perform TaqMan probe real-time quantitative PCR amplification, and plot a standard curve. Figure 1 The standard curve equation for NHV-HN-A151R_pUC57 is: y = -3.3529x + 40.554, with a correlation coefficient R. 2 The correlation coefficient R0 was 0.9996, and the amplification efficiency was 98.7%. The standard curve equation for MGF360-14L_p3xflag-CMV-7.1 was: y = -3.3978x + 42.255, with a correlation coefficient R0. 2 The correlation coefficient was 0.9993, and the amplification efficiency was 96.9%. The standard curve equation for B646L_p3xflag-CMV-7.1 was: y = -3.3545x + 39.453, with a correlation coefficient R0. 2 The value was 0.9971, and the amplification efficiency was 98.7%.

[0060] Example 2 Sensitivity Detection

[0061] Using a mixed plasmid of equal concentrations of recombinant plasmids NHV-HN-A151R_pUC57, MGF360-14L_p3xflag-CMV-7.1, and B646L_p3xflag-CMV-7.1 as a template, at a concentration of 1×10⁻⁶... 8 ~1×10 0 Serial dilutions were performed using this method with copies / μL. Results showed that the detection limit for the A151R and B646L genes was as low as 10 copies (μL serial dilutions). Figure 2A , Figure 2C The detection limit for the M14L gene can be as low as 100 copies. Figure 2B ).

[0062] Example 3 Specificity Detection

[0063] The quantitative real-time PCR method established in this study was used to specifically detect the virus, employing recombinant plasmids NHV-HN-A151R_pUC57, MGF360-14L_p3xflag-CMV-7.1, B646L_p3xflag-CMV-7.1, ddH2O, PRRSV, CSFV, JEV, PRV, PADV, and PEDV nucleic acids as templates. Results are as follows: Figure 3 As shown, except for the mixed plasmids of recombinant plasmids NHV-HN-A151R_pUC57, MGF360-14L_p3xflag-CMV-7.1, and B646L_p3xflag-CMV-7.1 which have stable amplification curves, the other viral nucleic acids and the negative control group do not have obvious specific amplification curves, indicating that the nucleic acid composition of the present invention has good specificity for ASFV.

[0064] Example 4 Repeatability Test

[0065] The dilution factor is 1.0 × 10⁻⁶. 8 ~1.0×10 3 Using a mixed plasmid of copies / μL as a template, repeatability tests were performed, and the coefficient of variation was calculated based on the Ct values ​​of real-time PCR with different template concentrations. The coefficient of variation ranged from 0.14% to 2.17% (Table 3), which is less than 3%, demonstrating that the nucleic acid composition of this embodiment has good repeatability for detecting ASFV.

[0066] Table 3 Results of repeatability testing by quantitative real-time PCR

[0067]

[0068] Example 5: Clinical Sample Testing

[0069] 10 inactivated genotype II ASFV strains 7 TCID 50 / mL) and genotype I ASFV virulent strain (10 7 TCID 50 Nucleic acid was extracted using a method ( / mL), and diluted 5, 10, 20, 40, 80, 100, 200, 400, 800, 1,000, 10,000, 100,000, and 1,000,000 times before detection using the real-time quantitative PCR method established in this study. The results are as follows: Figure 4A , Figure 4B , Figure 4C , Figure 5A , Figure 5B and Figure 5C The results showed that the genotype II ASFV strain was diluted to 10... -4 At that time, i.e., the viral titer was 10.3 TCID 50 At a concentration of 10 / mL, qPCR could still detect the Ct value of viral particles; the virulent type I ASFV strain diluted 10... -5 At that time, the viral titer was 10. 2 TCID 50 Even at a concentration of 100 μL, qPCR can still detect the Ct value of viral particles. This method has clinical application value.

[0070] After the test, the samples were subjected to high-temperature and high-pressure treatment as required.

Claims

1. A nucleic acid composition for identifying attenuated type I African swine fever virus, virulent type I African swine fever virus, and type II African swine fever virus, characterized in that... include: First set of A151R gene primers: A151R-F: AAAGCTTATAGAGTGCATCGAA, A151R-P: AATGAGGTGCTTAGCGGTGGTACA, A151R-R: CAGATCATGATTGGCATTAAAGG; Second set of M14L gene primers: M14L-F:CCCGCCAATAGAGGTGATTT, M14L-P: TTTGGTTTGCCCTGGCATTACGAC, M14L-R: GCGCACCACCTATTAACAAAG; Third set of B646L gene primers: B646L-F: GCTTTCAGGATAGAGATACAGCTCT, B646L-P: CCGTAACTGCTCATGGTATCAATCTTATCG, B646L-R: CCGTAGTGGAAGGGTATGTAAGAG.

2. The nucleic acid composition according to claim 1, characterized in that... The 5' end of the A151R-P sequence is modified with a ROX fluorescent group, and the 3' end is modified with a BHQ2 fluorescent group.

3. The nucleic acid composition according to claim 1, characterized in that... The M14L-P sequence is modified with a CY5 fluorescent group at the 5' end and a BHQ2 fluorescent group at the 3' end.

4. The nucleic acid composition according to claim 3, characterized in that... The 5' end of the B646L-P sequence is modified with a FAM fluorescent group, and the 3' end is modified with a BHQ1 fluorescent group.

5. A method for detecting and differentiating between attenuated genotype I African swine fever virus, virulent genotype I African swine fever virus, and genotype II African swine fever virus, characterized in that... Includes the nucleic acid composition according to claim 1.

6. The method for fluorescence quantitative PCR detection according to claim 5, characterized in that... The A151R-P sequence has a 5' end modified with a ROX fluorescent group and a 3' end modified with a BHQ2 fluorescent group; the M14L-P sequence has a 5' end modified with a CY5 fluorescent group and a 3' end modified with a BHQ2 fluorescent group; the B646L-P sequence has a 5' end modified with a FAM fluorescent group and a 3' end modified with a BHQ1 fluorescent group.

7. A kit for identifying attenuated genotype I African swine fever virus, virulent genotype I African swine fever virus, and genotype II African swine fever virus, characterized in that... Includes the nucleic acid composition according to claim 1.

8. The reagent kit according to claim 7, characterized in that... It is used in quantitative real-time PCR to identify attenuated, virulent, and genotype II African swine fever virus (ASFV) of genotype I.

9. The reagent kit according to claim 8, characterized in that... The A151R-P sequence has a 5' end modified with a ROX fluorescent group and a 3' end modified with a BHQ2 fluorescent group; the M14L-P sequence has a 5' end modified with a CY5 fluorescent group and a 3' end modified with a BHQ2 fluorescent group; the B646L-P sequence has a 5' end modified with a FAM fluorescent group and a 3' end modified with a BHQ1 fluorescent group.