Method for evaluating quality of mRNA vaccine based on nanopore sequencing platform

Abstract

The invention relates to an mRNA vaccine quality evaluation method based on a nanopore sequencing platform, which comprises the following steps: S1, preparation and sequencing of a long read length library: carrying out reverse transcription on an mRNA vaccine sample to prepare a cDNA library, and sequencing to obtain full-length cDNA sequencing data of the sample; s2, sequencing data acquisition and quality control: performing real-time sequencing, and then performing quality control to obtain clean reads data; s3, sequencing data comparison and analysis: comparing clean reads data to a design sequence, carrying out mRNA structural integrity analysis, and identifying sequence information, and S4, mRNA vaccine quality evaluation system construction and verification: establishing a multi-dimensional quality evaluation index system including sequence purity, integrity, fracture sites, sequence consistency and PolyA length. According to the method, the key quality attributes of the mRNA vaccine can be comprehensively measured, so that the production efficiency and reliability of the mRNA vaccine are improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of vaccine quality evaluation, and relates to an mRNA vaccine quality evaluation method based on a nanopore sequencing platform. BACKGROUND

[0002] The mRNA vaccine technology is a major breakthrough in the field of biological medicine, and has played a key role in combating the COVID-19 pandemic. This innovative vaccine introduces mRNA encoding specific viral proteins to guide human cells to synthesize corresponding antigens, thereby activating the body's immune response. The mRNA vaccine not only shows the advantages of rapid development and large-scale production, but also has proven significant protective efficacy and good safety in clinical trials.

[0003] However, the quality control and evaluation system of mRNA vaccines still faces challenges. The current widely used analysis methods include reverse transcription polymerase chain reaction, capillary gel electrophoresis, reversed-phase high-pressure liquid chromatography, ion exchange reversed-phase high-pressure liquid chromatography, and immunoblotting, etc. Although these methods are reliable, they are often time-consuming and labor-intensive, and each can only evaluate a single quality indicator. Therefore, there is an urgent need to develop a comprehensive analysis method that can simultaneously, quickly and accurately evaluate the key quality attributes of mRNA vaccines, including sequence accuracy, integrity and purity indicators. Establishing such a quality evaluation system is of great significance to ensure the quality control of the whole process of mRNA vaccine production.

[0004] At present, the existing evaluation methods have the following defects and deficiencies:

[0005] (1) Time-consuming and high cost: The existing mRNA vaccine quality evaluation methods involve multiple analysis techniques. These methods are not only complex to operate, but also time-consuming, thereby increasing the cost of production and quality control.

[0006] (2) Unable to comprehensively evaluate key quality attributes: The existing evaluation methods can only detect a certain specific indicator of mRNA vaccines, and cannot provide a comprehensive analysis including mRNA sequence consistency, integrity, poly(A) tail length and DNA and RNA contamination, etc. key quality attributes, thereby limiting the accurate evaluation of the overall quality of mRNA vaccines, which may result in insufficient protection of the effectiveness and safety of the vaccine.

[0007] (3) Sensitivity and accuracy limitations: Existing technologies have great challenges in sensitivity and accuracy when detecting key quality characteristics, and cannot effectively identify and quantify contaminants in mRNA vaccines.

[0008] Therefore, it is necessary to provide an mRNA vaccine quality evaluation method based on a nanopore sequencing platform, which can comprehensively measure the key quality attributes of the mRNA vaccine, thereby improving the efficiency and reliability of mRNA vaccine production. SUMMARY

[0009] The purpose of the present application is to provide an mRNA vaccine quality evaluation method based on a nanopore sequencing platform, which can comprehensively measure the key quality attributes of the mRNA vaccine, thereby improving the efficiency and reliability of mRNA vaccine production.

[0010] To solve the above technical problems, the technical solution adopted by the present application is that the mRNA vaccine quality evaluation method based on a nanopore sequencing platform, the specific steps are: S1 Long read library preparation and sequencing: reverse transcription is performed on the mRNA vaccine sample, a cDNA library is prepared using a special reagent kit suitable for nanopore sequencing, and full-length cDNA sequencing data of the sample is obtained by sequencing on a nanopore sequencing platform; S2 Sequencing data acquisition and quality control: real-time sequencing is performed on the nanopore sequencing platform, and after obtaining the raw sequencing data, quality control operations are performed to obtain high-quality clean reads data; the quality control operations include base quality filtering, length screening, and adapter sequence removal steps; S3 Sequencing data alignment and analysis: align the high-quality clean reads data obtained in step S2 to the design sequence, perform mRNA structure integrity analysis, identify sequence variation, deletion, and insertion information, and obtain consistent sequences generated based on nanopore sequencing data; S4 mRNA vaccine quality evaluation system construction and verification: based on the sequencing analysis results of step S3, a multi-dimensional quality evaluation index system including sequence purity, integrity, fragmentation site, sequence consistency, and PolyA length is established, and a standardized mRNA vaccine quality evaluation process is formed.

[0011] By comparing and verifying with traditional quality control methods (such as capillary electrophoresis, Sanger sequencing, HPLC, etc.), the advantages of the method in sensitivity, accuracy, and detection range are confirmed, and the method can comprehensively measure the key quality attributes of the mRNA vaccine, thereby improving the efficiency and reliability of mRNA vaccine production.

[0012] Preferably, the specific steps of step S1 are: S11 Reverse transcription adapter connection: mix mRNA with a PolyA tail with a reverse transcription adapter cDNA RT Adapter (CRTA) and annealing buffer (AB), then add nuclease-free water, incubate, then add reaction buffer and ligase, mix and incubate again; S12 Adapter digestion: add Lambda exonuclease and uracil-specific excision reagent to the reaction system of step S11, incubate at 37°C, then mix with RNA Clean XP magnetic beads, adsorb the magnetic beads, discard the supernatant, wash the magnetic beads several times with short fragment buffer (SFB), dry, and elute with nuclease-free water; S13 Reverse transcription primer RTP annealing: mix reverse transcription primer RTP, deoxyribonucleotide triphosphate dNTPs, and purified eluate, and incubate at room temperature; S14 Chain conversion primer SSPII connection: add buffer matched with reverse transcriptase, ribonuclease inhibitor RNaseOUT, and chain conversion primer II (SSPII), and incubate; then add reverse transcriptase, perform reverse transcription and chain conversion, obtain reverse transcription product, perform heat inactivation, and store; S15 PCR amplification: take the reverse transcription product, add barcode primer, nuclease-free water, and PCR premix, pre-denature, and perform multiple cycles of amplification, then extend after the cycles are completed, and obtain PCR product; S16 Purification and adapter addition: after the reaction is completed, add exonuclease I for incubation, and use a thermal cycler to maintain; then add AMPure XP magnetic beads to purify the PCR product, dry, and elute with elution buffer (EB); add rapid sequencing library adapter to the purified PCR product, react at room temperature, and complete library preparation; S17 Sequencing: load the prepared library onto a sequencing chip, use a sequencer to perform sequencing, convert the raw data into cDNA sequences, and perform data splitting, thereby obtaining sequencing data, i.e., sample sequencing data.

[0013] Preferably, the quality control conditions set in the quality control operation of step S2 include: a sequencing length greater than 500 bp and a sequencing quality greater than 9 and containing RTP primer sequence and SSPII primer sequence; if the sample sequencing data simultaneously meet the set conditions, it is determined that the sequencing data quality control standard is passed, referred to as clean_reads; wherein the nucleotide sequence of the RTP primer is shown as SEQ ID NO. 1, and the nucleotide sequence of the SSPII primer is shown as SEQ ID NO. 2. SEQ ID NO. 1: TTGCCTGTCGCTCTATCTTC; SEQ ID NO. 2: TCTGTGGTGTGCTGATATTGC.

[0014] Preferably, the mRNA vaccine quality evaluation index in the step S4 includes mRNA integrity, mRNA purity, mRNA break site analysis, mRNA sequence information, and mRNA PolyA length.

[0015] Preferably, the specific determination method of mRNA purity in the mRNA vaccine quality evaluation index in the step S4 is: The sequencing data after quality control is aligned to the design sequence using alignment software such as minimap2, and the proportion of the sequencing data after quality control that can be aligned to the design sequence is defined as the mRNA purity Purity. The specific formula is: Purity=(mapped_reads / clean_reads)×100%; Wherein, mapped_read: the number of reads aligned to the design sequence; clean_reads: the total number of reads after quality control, i.e. the total number of sequencing data that meets the sequencing data quality control standard. Reads is the nucleotide sequence generated by a single sequencing reaction of a sequencer, i.e. the number of sequencing sequences.

[0016] Preferably, the specific determination method of mRNA integrity in the mRNA vaccine quality evaluation index in the step S4 is: set the condition defined as complete mRNA sequence, a Read that meets the set condition is judged as complete mRNA sequence information, and the proportion of complete mRNA sequence in the sequencing data after quality control is defined as mRNA integrity Integrity. The specific formula is: Integrity=(Integrity_mRNA_reads / clean_reads)×100%; Wherein, Integrity_mRNA_read: the total number of reads that meet the following two conditions; clean_reads: the total number of reads after quality control; The condition that a Read is a complete mRNA sequence must meet the following conditions: 1) has a PolyA tail; 2) contains the design sequence site in the two intervals of 50-100 and (L-50)-L, wherein L is the total length of the design sequence after removing the PolyA.

[0017] Preferably, the specific method of mRNA break site identification in the mRNA vaccine quality evaluation index in the step S4 is: The sequence that can be aligned to the design sequence but is not a complete mRNA in the sequencing data after quality control is extracted from the original sequencing data. Using the minimap2 tool to align to the design sequence, using tools such as samtools to count the sequencing depth of each site in the design sequence, and by setting the sliding window size to k bp, calculating the average depth drop ratio of the front and rear intervals exceeding p% to identify the breakage site, wherein k is a natural number of 1-1000, and p is a natural number of 5-100; wherein, for site i, the sequencing depth drop ratio Drop_Ratio(i) is calculated, and the formula is: Drop_Ratio(i) = (D_before(i) - D_after(i)) / D_before(i) x 100%; wherein, D_before(i) = (1 / k) x ∑(depth[j]), j ∈ [i-k, i); D_after(i) = (1 / k) x ∑(depth[j]), j ∈ [i, i+k); depth[j] = sequencing depth at position j; wherein, k is the sliding window size, and is a natural number of 10-1000; The breakage site determination condition is: if Drop_Ratio(i) > p%, then site i is a breakage site, wherein p is a natural number of 5-100.

[0018] Preferably, the specific method of mRNA sequence accuracy verification in the mRNA vaccine quality evaluation index of step S4 is: using medaka, Canu and Nanopolish tools to generate consistent sequences, and by comparing the differences between the consistent sequences generated based on the nanopore sequencing data in step S3 and the consistent sequences generated by the tools, base mutations, insertions or deletions introduced in the production process are identified.

[0019] Preferably, the specific method of mRNA PolyA length evaluation in the mRNA vaccine quality evaluation index of step S4 is: using Nanopolish or Tailfindr tools to directly analyze FAST5 raw electrical signal files, and based on machine learning models to capture more subtle signal changes, more accurate PolyA length evaluation is achieved; and based on the PolyA length of each Read obtained by Nanopolish or Tailfindr, the PolyA length is determined based on the PolyA length density distribution diagram.

[0020] Preferably, in the step S4, if the mRNA purity is not less than 99%, the integrity is not less than 90%, there is no broken site, the mRNA sequence is completely consistent with the designed sequence, and the PolyA length and the designed sequence differ by not more than 20 bp, it is determined that the mRNA vaccine is qualified.

[0021] Compared with the prior art, the beneficial effects of the present application: the evaluation method of mRNA vaccine quality based on nanopore sequencing platform can quickly and comprehensively evaluate the key quality attributes of mRNA vaccine, including purity, integrity, sequence accuracy, PolyA length and other indicators, significantly improving the efficiency and accuracy of quality evaluation; at the same time, compared with the traditional method, the evaluation method can accurately identify the broken site in the mRNA vaccine, which provides key information for optimizing the stability of the product, and the traditional method cannot achieve this. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 Flowchart of the evaluation method of mRNA vaccine quality based on nanopore sequencing platform of the present application; Figure 2 RCS PolyA tail length distribution chart in the application example of the evaluation method of mRNA vaccine quality based on nanopore sequencing platform of the present application; Figure 3 COVID-19 mRNA PolyA tail length distribution in the application example of the evaluation method of mRNA vaccine quality based on nanopore sequencing platform of the present application; Figure 4 COVID-19 mRNA sequencing depth chart in the application example of the evaluation method of mRNA vaccine quality based on nanopore sequencing platform of the present application. DETAILED DESCRIPTION

[0023] The technical solutions in the embodiments of the present application will be described clearly and completely below with reference to the accompanying drawings in the embodiment diagrams of the present application.

[0024] Embodiment: As shown in the figure, the evaluation method of mRNA vaccine quality based on nanopore sequencing platform, the specific steps are: Figure 1 ​S1 Long read library preparation and sequencing: The mRNA vaccine sample is reverse transcribed, a long read (cDNA) library is prepared using a cDNA library preparation kit specially designed for nanopore sequencing, and full-length cDNA sequencing data of the sample is obtained by sequencing on a nanopore sequencing platform; in this embodiment, a cDNA-PCR mixed sample sequencing kit is used to prepare a cDNA library; here, the SQK-PCB111.24 kit (manufacturer: Oxford Nanopore Technologes; batch number: PCB1124.10.0004) is used to prepare a cDNA library according to the instructions; The specific steps of step S1 are as follows: S11 Reverse transcription adapter connection: mix the mRNA with a PolyA tail, a reverse transcription adapter cDNA RT Adapter (CRTA) and annealing buffer (AB), then add nuclease-free water, incubate, then add reaction buffer and ligase, mix and incubate again; specifically: mix 4 ng of mRNA with a PolyA tail, 1 μL of cDNA RT Adapter (CRTA) and 1 μL of annealing buffer (AB), add nuclease-free water to a total volume of 12 μL, incubate at 60°C for 5 minutes, then cool at room temperature for 10 minutes; incubate at 60°C for 5 minutes, then cool at room temperature for 10 minutes; add 3.6 μL of NEBNext® fast ligation reaction buffer, 1.4 μL of T4 DNA ligase (2 MU / ml) and 1 μL of RNaseOUT, mix and incubate at room temperature for 10 minutes; S12 Adapter digestion: add 1 μL of Lambda exonuclease and 1 μL of uracil-specific excision reagent (USER) to the reaction system of step S11, incubate at 37°C for 15 minutes, then add 36 μL of RNA Clean XP magnetic beads, mix evenly, adsorb the magnetic beads, discard the supernatant, wash the magnetic beads twice with short fragment buffer (SFB), dry, and elute with 12 μL of nuclease-free water; S13 Reverse transcription primer RTP annealing: mix 1 μL of reverse transcription primer RTP, 10 mM deoxyribonucleotide triphosphates dNTPs and 12 μL of purified eluate, and incubate at room temperature for 15 minutes; S14 strand switch primer SSP II ligation: add the buffer matched with the reverse transcriptase, ribonuclease inhibitor RNase OUT and strand switch primer II (SSP II), and incubate; then add the reverse transcriptase, and perform reverse transcription and strand switching to obtain a reverse transcription product, which is then heat-inactivated and stored; specifically: add 4.5 μL of Maxima H Minus 5x RT Buffer, 1 μL of RNase OUT and 2 μL of strand switch primer II (SSP II), incubate at 42°C for 2 minutes, add 1 μL of Maxima H Minus reverse transcriptase, and perform reverse transcription and strand switching at 42°C for 90 minutes, heat-inactivate at 85°C for 5 minutes, and then keep at 4°C (which can be stored overnight); S15 PRC amplification: take the reverse transcription product, add barcode primers, nuclease-free water and PRC premix, pre-denature, and then perform multiple cycles of amplification, and then extend after the cycles to obtain a PCR product; specifically: take 5 μL of the reverse transcription product, add 0.75 μL of barcode primers (BP01-24), 6.75 μL of nuclease-free water and 12.5 μL of LongAmp Hot Start Taq Master Mix; pre-denature at 95°C for 30 seconds, then perform 18 cycles of amplification, with the cycle conditions being denaturation at 95°C for 15 seconds, annealing at 62°C for 15 seconds, extension at 65°C for 60 seconds, and then extend at 65°C for 6 minutes after all the cycles of amplification, and keep at 4°C; S16 purification and linker addition: after the reaction is completed, add Exonuclease I for incubation, and use a thermal cycler to keep; then add AMPure XP magnetic beads to purify the PCR product, dry, and then elute with elution buffer (EB); add a rapid sequencing library linker to the purified PCR product, and react at room temperature to complete the preparation of the library; specifically: after the reaction is completed, add 1 μL of Exonuclease I, incubate at 37°C for 15 minutes, and keep at 80°C for 15 minutes by using a thermal cycler; add 20 μL of AMPure XP magnetic beads to purify the PCR product, dry, and then elute with 12 μL of elution buffer (EB); add 1 μL of a rapid sequencing library linker to 10 μL of the purified PCR product, and react at room temperature for 5 minutes; thus, the preparation of the library is completed; S17 On-machine sequencing: load the prepared library onto a sequencing chip, use a sequencer to sequence, convert raw data into cDNA sequences and perform data splitting to obtain sequencing data, i.e. sample sequencing data; specifically: load the prepared library onto a FLO-MIN106 sequencing chip (manufacturer: Oxford Nanopore Technologes; version number: R9.4.1), use a sequencer GridION FLO-MIN106 to sequence for 72h, and use the instrument's built-in MinKNOW Core 5.7.5 to perform BaseCalling and data splitting; S2 Sequencing data acquisition and quality control: real-time sequencing is performed on a nanopore sequencing platform, and after obtaining the raw sequencing data, quality control operations are performed to obtain quality-controlled sequencing data, i.e. high-quality Clean reads data; quality control operations include base quality filtering, length screening and adapter sequence removal, etc. The quality control conditions set in the quality control operation of step S2 include: sequencing length greater than 500bp and sequencing quality greater than 9 and containing RTP primer sequence and SSPII primer sequence; if the sample sequencing data meets the set conditions at the same time, it is judged to pass the sequencing data quality control standard, referred to as clean_reads; wherein the nucleotide sequence of the RTP primer is shown as SEQ ID NO. 1, and the nucleotide sequence of the SSPII primer is shown as SEQ ID NO. 2; wherein the nucleotide sequence of the RTP primer is shown as SEQ ID NO. 1, and the nucleotide sequence of the SSPII primer is shown as SEQ ID NO. 2. SEQ ID NO. 1: TTGCCTGTCGCTCTATCTTC; SEQ ID NO. 2: TCTGTGGTGTGCTGATATTGC; S3 Sequencing data alignment and analysis: align the high-quality Clean reads data obtained in step S2 to the designed sequence to perform mRNA structure integrity analysis, while identifying sequence variation, deletion and insertion information, and obtain consistent sequences generated based on nanopore sequencing data; S4 mRNA vaccine quality evaluation system construction and verification: based on the sequencing analysis results of step S3, a multi-dimensional quality evaluation index system including sequence purity, integrity, fragmentation site, sequence consistency and PolyA length is established, and a standardized mRNA vaccine quality evaluation process is formed; through comparison and verification with traditional quality control methods (such as capillary electrophoresis, Sanger sequencing, HPLC, etc.), the advantages of the method in sensitivity, accuracy and detection range are confirmed; The mRNA vaccine quality evaluation index in the step S4 includes mRNA integrity, mRNA purity, mRNA break site analysis, mRNA sequence information, and mRNA PolyA length. (1) mRNA purity: The purity of mRNA directly affects the effectiveness and safety of the vaccine, and contaminants can cause non-specific reactions of the immune system; the specific judgment method of mRNA purity in the mRNA vaccine quality evaluation index of the step S4 is as follows: The sequencing data after quality control is aligned to the design sequence using alignment software such as minimap2, and the proportion of the sequencing data after quality control that can be aligned to the design sequence is defined as the mRNA purity Purity; the specific formula is as follows: Purity=(mapped_reads / clean_reads)×100%; Wherein, mapped_read: the number of reads aligned to the design sequence; clean_reads: the total number of reads after quality control, i.e., the total number of sequencing data that meets the sequencing data quality control standard; reads are nucleotide sequences generated by a single sequencing reaction of a sequencer, i.e., the number of sequencing sequences; (2) mRNA integrity: The integrity of mRNA affects the translation efficiency of mRNA, and further affects the expression level of protein, which is a key indicator of vaccine potency; The specific judgment method of mRNA integrity in the mRNA vaccine quality evaluation index of the step S4 is as follows: a condition for defining a complete mRNA sequence is set, and a read that meets the set condition is judged as a complete mRNA sequence; the proportion of complete mRNA sequences in the sequencing data after quality control is defined as the mRNA integrity Integrity; the specific formula is as follows: Integrity=(Integrity_mRNA_reads / clean_reads)×100%; Wherein, Integrity_mRNA_read: the total number of reads that meet the following two conditions; clean_reads: the total number of reads after quality control; The condition that a read is a complete mRNA sequence must meet the following conditions: 1) has a PolyA tail; 2) contains the design sequence site in the two intervals of 50-100 and (L-50)-L, wherein L is the total length of the design sequence after removing the PolyA tail; (3) mRNA break site identification: The identification of break sites can determine the region of mRNA that is prone to degradation, and further guide the improvement of stability and optimization of production process. The sequences that can be aligned to the design sequence but are not complete mRNA in the sequencing data after quality control are used to determine the break site; The specific method for identifying mRNA breakage sites in the mRNA vaccine quality evaluation index of step S4 is as follows: The sequences that can be aligned to the design sequence but are not complete mRNA in the quality-controlled sequencing data are extracted from the original sequencing data; The sequences are aligned to the design sequence using the minimap2 tool, and the sequencing depth of each site in the design sequence is counted using tools such as samtools. A sliding window size of k bp is set, and the average depth drop ratio of the interval before and after is calculated to identify breakage sites, where k is a natural number of 1-1000, representing that k consecutive bases are taken as a window each time; p is a natural number of 5-100; Wherein, for site i, the sequencing depth drop ratio Drop_Ratio(i) is calculated, and the formula is: Drop_Ratio(i)=(D_before(i)-D_after(i)) / D_before(i)×100%; Wherein, D_before(i)=(1 / k)×∑(depth[j]),j∈[i-k,i); D_after(i)=(1 / k)×∑(depth[j]),j∈[i,i+k); depth[j]=sequencing depth at position j; Wherein, k is the size of the sliding window, and is a natural number of 10-1000; wherein D_before(i) represents the window sequencing depth before site i, and D_after(i) represents the window sequencing depth after site i; The determination condition of the breakage site is: if Drop_Ratio(i)>p%, then site i is a breakage site, wherein p is a natural number of 5-100; (4) mRNA sequence accuracy verification: The mRNA sequence accuracy verification is to ensure that the mRNA sequence is completely consistent with the design sequence, to find possible base mutations, insertions or deletions introduced in the production process in a timely manner, and to ensure the safety and effectiveness of the vaccine; The specific method for the mRNA sequence accuracy verification in the mRNA vaccine quality evaluation index of step S4 is as follows: tools such as medaka, Canu and Nanopolish are used to generate consistent sequences, and the differences between the consistent sequences generated based on the nanopore sequencing data in step S3 and the consistent sequences generated by the tools are compared to identify base mutations, insertions or deletions introduced in the production process; (5) mRNA PolyA length evaluation: PolyA tail length affects mRNA stability and protein expression efficiency, and is an important indicator for evaluating vaccine storage conditions. During nanopore sequencing, the polyA produces repeated electrical signals, and the accuracy of Basecaller in processing such repeated sequences is significantly reduced, and the PolyA tail length cannot be accurately identified; The specific method of mRNA PolyA length evaluation in the mRNA vaccine quality evaluation index of step S4 is: using Nanopolish or Tailfindr and other tools to directly analyze the FAST5 original electrical signal file, capturing more subtle signal changes based on machine learning models, thereby achieving more accurate mRNA PolyA length evaluation; and based on the PolyA length of each Read obtained by Nanopolish or Tailfindr, determining the PolyA length based on the PolyA length density distribution diagram; In step S4, if the mRNA purity is not less than 99%, the integrity is not less than 90%, there is no breakpoint, the mRNA sequence and the design sequence are completely consistent, and the PolyA length and the design sequence differ by not more than 20 bp, it is determined that the mRNA vaccine is qualified.

[0025] Specific embodiments: Performance verification of COVID-19 vaccine quality evaluation method system.

[0026] To evaluate the performance of the specific embodiment - COVID-19 vaccine quality evaluation method system, the performance verification is carried out from two aspects of method repeatability and detection accuracy.

[0027] (1) Method repeatability The official quality control product RCS of nanopore was used for method repeatability evaluation, and the same sample was detected for 3 times at different times, the total length of the sequence was 1344 bp, and the PolyA tail length was 30 bp. The method repeatability detection results are shown in Table 1.

[0028] Table 1 Method repeatability detection results Number of repetitions Purity (%) Completeness (%) Break point Sequence accuracy verification Poly A length (bp) 1st 100.00 96.04 No Completely consistent with the design sequence 37 2nd 100.00 98.39 No Completely consistent with the design sequence 37 3rd 99.95 98.44 No Completely consistent with the design sequence 37 From the 3 detection results in Table 1, the fluctuation of purity is not more than 0.1%, the fluctuation of integrity is not more than 2.5%, the breakpoint, sequence accuracy verification and PolyA length 3 results are completely consistent, and the length is 37 bp (see Figure 2 shown), indicating that the detection system is relatively stable.

[0029] (2) Detection accuracy

[0030] One COVID-19 mRNA vaccine sample was selected for accuracy evaluation by comparing the results of the mRNA vaccine quality evaluation method based on the nanopore sequencing platform of the present application with those of the traditional method. The total sequence length was 4276 bp, and the PolyA tail length was 110 bp. The comparative detection results are shown in Table 2.

[0031] Table 2 Comparison of detection results of the mRNA vaccine quality evaluation method based on the nanopore sequencing platform of the present application with those of the traditional method Detection method Purity (%) Completeness (%) Break point Sequence accuracy verification Poly A length (bp) Traditional method / 85.10 Unable to judge Completely consistent with the design sequence 112 The application 100.00 77.97 3586bp Completely consistent with the design sequence 129 In terms of integrity detection, the method of the present application (77.97%) was slightly lower than the traditional method (85.10%), but considering the characteristics of different detection technologies, this difference was within a reasonable range. In terms of sequence accuracy verification, the sequences measured by the present application and the traditional method were completely consistent with the designed sequence, and the measured PolyA length (129 bp) was Figure 3 not more than 20 bp different from the actual value of the sample (110 bp). In addition, the present application could accurately identify the break site at 3586 bp, as shown in Figure 4 This unique advantage could provide direct guidance for improving the stability of mRNA vaccines, while the traditional method could not achieve this. Therefore, based on the above results, the evaluation method of the present application not only exhibits reliable detection accuracy, but also provides more comprehensive quality characteristic information, and is an effective detection means for mRNA vaccine quality control. The traditional method for detecting integrity uses capillary electrophoresis; the traditional method for verifying sequence accuracy uses Sanger sequencing; and the traditional method for detecting PolyA length uses high-performance liquid chromatography.

[0032] The above specific embodiments further illustrate the purpose, technical solutions and beneficial effects of the present application. It should be understood that the above description is only for specific embodiments of the present application and is not intended to limit the present application. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present application, such as changes in certain reagents or materials, should be included within the protection scope of the present application.

Claims

1. A method for evaluating the quality of mRNA vaccine based on a nanopore long read sequencing platform, characterized in that, The specific steps are: S1 long read library preparation and sequencing: mRNA vaccine samples are reverse transcribed, cDNA library is prepared using a cDNA library preparation kit suitable for nanopore sequencing, and full-length cDNA sequencing data of the sample is obtained by sequencing on a nanopore sequencing platform; S2 sequencing data acquisition and quality control: real-time sequencing is performed on the nanopore sequencing platform, and after obtaining the raw sequencing data, quality control operations are performed to obtain the quality-controlled sequencing data, referred to as clean reads data; S3 sequencing data alignment and analysis: align the clean reads data obtained in step S2 to the design sequence, perform mRNA structure integrity analysis, and simultaneously identify sequence variation, deletion and insertion information to obtain consistent sequences generated based on nanopore sequencing data; S4 mRNA vaccine quality evaluation system construction and verification: based on the sequencing analysis results of step S3, a multi-dimensional quality evaluation index system including sequence purity, integrity, breakpoint, sequence consistency and PolyA length is established, and a standardized mRNA vaccine quality evaluation process is formed.

2. The method of evaluating the quality of mRNA vaccine based on a nanopore sequencing platform according to claim 1, characterized in that, The specific steps of step S1 are: S11 reverse transcription adapter connection: mix mRNA with a PolyA tail, reverse transcription adapter cDNA RT Adapter and annealing buffer, then add nuclease-free water, incubate, then add reaction buffer and ligase, mix and incubate again; S12 adapter digestion: add Lambda exonuclease and uracil-specific excision reagent to the reaction system of step S11, incubate at 37°C, then mix with RNA Clean XP magnetic beads, adsorb the magnetic beads, discard the supernatant, wash the magnetic beads several times with short fragment buffer, dry, and elute with nuclease-free water; S13 reverse transcription primer RTP annealing: mix reverse transcription primer RTP, deoxyribonucleotide triphosphate dNTPs and purified eluate, and incubate at room temperature; S14 chain conversion primer SSPII connection: add buffer matched with reverse transcriptase, ribonuclease inhibitor RNaseOUT and SSPII, and incubate; then add reverse transcriptase, perform reverse transcription and chain conversion, obtain reverse transcription product, and save after heat inactivation; S15 PCR amplification: take the reverse transcription product, add barcode primer, nuclease-free water and PCR master mix, pre-denature, and then perform multiple cycles of amplification, and then extend to obtain PCR product; S16 purification and adapter addition: after the reaction is completed, incubate with exonuclease I, and use a thermal cycler to maintain; then purify the PCR product with AMPure XP magnetic beads, dry, and elute with elution buffer EB; add rapid sequencing library adapter to the purified PCR product, and react at room temperature to complete library preparation; S17 sequencing: load the prepared library onto a sequencing chip, use a sequencer to perform sequencing, convert the raw data into sequencing sequences, and perform data splitting to obtain sample sequencing data.

3. The method of evaluating the quality of mRNA vaccine based on a nanopore sequencing platform according to claim 2, characterized in that, The quality control condition set in the quality control operation in the step S2 includes: a sequencing length greater than 500 bp and a sequencing quality greater than 9 and containing an RTP primer sequence and an SSPII primer sequence; if the sample sequencing data simultaneously satisfies the set condition, it is judged to pass the sequencing data quality control standard, referred to as clean_reads; wherein the nucleotide sequence of the RTP primer is shown as SEQ ID NO. 1, and the nucleotide sequence of the SSPII primer is shown as SEQ ID NO.

2.

4. The method of evaluating the quality of mRNA vaccine based on a nanopore sequencing platform according to claim 3, characterized in that, The mRNA vaccine quality evaluation index in the step S4 includes mRNA integrity, mRNA purity, mRNA break site analysis, mRNA sequence information and mRNA PolyA length.

5. The method of evaluating the quality of mRNA vaccine based on a nanopore sequencing platform according to claim 4, characterized in that, The specific judgment method of the mRNA purity in the mRNA vaccine quality evaluation index in the step S4 is: The sequencing data after quality control is aligned to the design sequence using alignment software, and the proportion of the sequencing data after quality control that can be aligned to the design sequence is defined as the mRNA purity Purity; the specific formula is: Purity=(mapped_reads / clean_reads)×100%; Wherein, mapped_read: the number of reads aligned to the design sequence; clean_reads: the total number of reads after quality control.

6. The method of evaluating the quality of mRNA vaccine based on a nanopore sequencing platform according to claim 4, wherein, The specific judgment method of the mRNA integrity of the mRNA vaccine quality evaluation index in the step S4 is: setting the condition defined as the complete mRNA sequence, a Read satisfying the set condition is judged as the complete mRNA sequence, and the proportion of the complete mRNA sequence in the sequencing data after quality control is defined as the mRNA integrity Integrity; the specific formula is: Integrity=(Integrity_mRNA_reads / clean_reads)×100%; Wherein, Integrity_mRNA_read: the total number of reads satisfying the following two conditions; clean_reads: the total number of reads after quality control; The condition that a Read is a complete mRNA sequence needs to satisfy the following conditions at the same time: 1) has a PolyA tail; 2) contains design sequence sites in two intervals of 50-100 and (L-50)-L, wherein L is the total length of the design sequence after removing PolyA.

7. The method of evaluating the quality of mRNA vaccine based on a nanopore sequencing platform according to claim 4, characterized in that, The specific method of mRNA break site identification in the mRNA vaccine quality evaluation index in the step S4 is: The sequence that can be aligned to the design sequence but is not a complete mRNA in the sequencing data after quality control is extracted from the original sequencing data; Using a tool to align to the design sequence, using a tool to count the sequencing depth of each site in the design sequence, and by setting a sliding window size of k bp, calculating the average depth drop ratio of the front and rear intervals exceeding p% to identify the break site, wherein k is a natural number of 1-1000, and p is a natural number of 5-100; Drop_Ratio(i) = (D_before(i) - D_after(i)) / D_before(i) x 100%; Drop_Ratio(i) = (D_before(i) - D_after(i)) / D_before(i) x 100%; D_before(i) = (1 / k) x ∑(depth[j]), j ∈ [i-k, i); D_after(i) = (1 / k) x ∑(depth[j]), j ∈ [i, i+k); depth[j] = sequencing depth at position j; wherein k is a sliding window size, and is a natural number between 10 and 1000; wherein D_before(i) represents the window sequencing depth before site i, and D_after(i) represents the window sequencing depth after site i. The determination condition of the breakage site is that if Drop_Ratio(i) > p%, then site i is a breakage site, wherein p is a natural number between 5 and 100. The specific method of mRNA sequence information accuracy verification in the mRNA vaccine quality evaluation index in step S4 is that a tool is used to generate a consensus sequence, and by comparing the difference between the consensus sequence generated based on the nanopore sequencing data in step S3 and the consensus sequence generated by the tool, base mutations, insertions or deletions introduced in the production process are identified.

8. The method of evaluating the quality of mRNA vaccine based on a nanopore sequencing platform according to claim 4, characterized in that, The specific method of mRNA PolyA length evaluation in the mRNA vaccine quality evaluation index in step S4 is that a tool is used to directly analyze the FAST5 original electric signal file, capture signal changes based on a machine learning model, and then obtain the PolyA length of each Read based on Nanopolish or Tailfindr, and determine the PolyA length based on the PolyA length density distribution map. 9.The method of evaluating mRNA vaccine quality based on a nanopore sequencing platform according to claim 4, characterized in that, In step S4, if the mRNA purity is not less than 99%, the integrity is not less than 90%, there is no breakage site, the mRNA sequence information and the design sequence are completely consistent, and the difference between the mRNA PolyA length and the design sequence is not more than 20 bp, it is determined that the mRNA vaccine is qualified.

10. The method of evaluating the quality of mRNA vaccine based on a nanopore sequencing platform according to claim 4, characterized in that, ​

Images