Lactobacillus muci genus fermentation strain with anti-aging function and application thereof
By screening for fermenting Lactobacillus mucinus LF11, the uncertainties in the safety and efficacy of existing anti-aging drugs have been resolved, achieving significant antioxidant, anti-aging, and multiple health benefits.
Patent Information
- Application Number
- CN202511587742.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-03
- Publication Date
- 2026-04-07
- Estimated Expiration
- 2045-11-03
AI Technical Summary
Existing anti-aging drugs have safety and side effects issues. Probiotics have potential in regulating gut microbiota and anti-aging, but the efficacy of different strains varies greatly. It is necessary to screen out superior strains with antioxidant, anti-aging and multiple beneficial effects.
Limosilactobacillus fermentum LF11 was screened from the gut microbiota of centenarians. Its significant antioxidant activity and anti-aging function were verified through in vitro antioxidant capacity evaluation and in vivo aging model experiments, and it can be applied to the preparation of anti-aging products.
Fermented Lactobacillus mucinus LF11 can scavenge various free radicals, inhibit the expression of aging-related genes induced by oxidative damage, improve memory, alleviate chronic inflammation, regulate gut microbiota, improve energy metabolism, and protect liver function, thus possessing multiple beneficial effects.
Smart Images

Figure CN121022695B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the fields of microbial and fermentation engineering technology, and in particular to a fermentation-promoting Lactobacillus strain with anti-aging function and its application. Background Technology
[0002] The relationship between oxidative damage and aging is primarily manifested in the generation and cumulative damage of intracellular free radicals. During metabolism, especially in mitochondrial energy production, cells generate reactive oxygen species (ROS). As highly reactive free radicals, ROS cause oxidative damage to DNA, proteins, and lipids. This damage gradually accumulates and becomes difficult to repair completely with age, leading to cellular functional decline and tissue structural damage. As antioxidant defense mechanisms weaken with age, the efficiency of ROS scavenging decreases, causing free radicals to accumulate in the body and further increasing oxidative damage. Oxidative damage accelerates the aging process: on the one hand, by damaging cellular DNA and organelles, it leads to abnormal cell proliferation or apoptosis; on the other hand, it disrupts cellular homeostasis, triggering chronic inflammation, protein aggregation, and other hallmark changes of aging. Long-term accumulated oxidative damage becomes a high-risk factor for age-related diseases such as cancer and cardiovascular disease. Therefore, oxidative damage is not only a result of aging but also an accelerator of aging; the two mutually promote each other, accelerating the aging process of the body.
[0003] Recent studies have indicated that two key cellular proteins, P16 and P21, are closely related to aging. When cells are damaged by oxidative stress, P16 expression is upregulated, promoting cellular senescence and cell cycle arrest. This cell cycle arrest is one of the hallmarks of aging. Furthermore, oxidative stress can upregulate P21 expression by activating the P53 pathway, and prolonged P21 activation may lead to tissue dysfunction. In summary, P16 and P21 promote cell cycle arrest and maintain an aging state in response to oxidative damage signals, and their continued activation accelerates the aging process.
[0004] Currently, various drugs are being researched to slow down the aging process. Their main advantage lies in their ability to target specific biological pathways related to aging, potentially effectively delaying the aging process. For example, metformin, NAD+ precursors (such as nicotinamide riboside), and GLP-1 receptor agonists have shown potential in animal studies to slow aging and extend healthy lifespan. However, these drug interventions also have limitations. Many anti-aging drugs have not yet undergone long-term, large-scale clinical trials. For instance, while rapamycin can extend lifespan in animals, long-term use may suppress the immune system. Metformin may affect the exercise adaptability of healthy individuals, and high doses of NAD+ precursors may increase the risk of cancer.
[0005] Probiotics have gained increasing attention in the anti-aging field due to their regulatory effects on the gut microbiota and their high safety profile. Studies show that the structure and function of the gut microbiota gradually change with age. The diversity of the gut microbiota in older adults typically decreases, with a reduction in dominant bacteria (such as short-chain fatty acid-producing bacteria) and an increase in some potentially pathogenic bacteria (such as Escherichia coli and Clostridium difficile). This change leads to a weakened intestinal barrier function, triggering oxidative damage and low-grade chronic inflammation, which in turn affects the immune system and accelerates the aging process. Furthermore, the gut microbiota plays a crucial role in regulating metabolic changes during aging. The gut microbiota of healthy, long-lived individuals is often rich in bacteria that produce short-chain fatty acids. These metabolites not only strengthen the intestinal barrier but also regulate the antioxidant defense system and immune response, thereby slowing aging. However, in older adults, these beneficial metabolites decrease, while the accumulation of harmful metabolites (such as lipopolysaccharides) increases, further exacerbating age-related responses.
[0006] Probiotic supplementation may slow down the aging process. In Europe, studies have shown that supplementation with *Lactococcus lactis* subsp. *lactococcus* can increase IFN-α induction activity, reduce age-related skin thinning, increase the proportion of naive T cells, increase the expression of tight junction-related genes, and inhibit the expression of muscle atrophy-related genes. Mice supplemented with probiotics showed a significant reduction in aging scores. In Japan, Morinaga Milk Industry Co., Ltd., in collaboration with Tokyo Medical and Health University, conducted a nationwide survey involving over 20,000 middle-aged and elderly individuals. The results showed that respondents who regularly supplemented with *Bifidobacterium longum* BB536 had lower rates of fractures and certain diseases, and experienced improvements in daily life symptoms such as forgetfulness and quality of life, supporting the anti-aging benefits of *Bifidobacterium longum* BB536. In China, researchers at Nanchang University isolated four potential probiotic strains from the feces of centenarians in Jiangxi Province. In mouse experiments, they found that these probiotic combinations may exert anti-aging effects by regulating gut microbiota and inhibiting TLR4 / NFκB-induced inflammation, providing a theoretical basis for the future development and utilization of these probiotics.
[0007] Lactobacillus fermentum ( Lactobacillus fermentum In 2022, based on changes in international microbial classification, this bacterium was renamed *Lactobacillus fermentum*. Limosilactobacillus fermentum Recent studies have reported that *Lactobacillus fermentum* exhibits certain antioxidant and anti-aging potential, and some reports also indicate that it can improve memory. However, due to the high variability and degeneration of microbial strains, the efficacy and overall effectiveness of different strains often vary considerably. Therefore, the screening and isolation of superior strains remains a key challenge. Summary of the Invention
[0008] This invention aims to develop a fermented Lactobacillus probiotic resource with strong antioxidant and anti-aging functions and a variety of beneficial effects.
[0009] The purpose of this invention is to provide a fermentation method for Lactobacillus mucinus ( Limosilactobacillus fermentum LF11.
[0010] Another object of the present invention is to provide the application of fermented Lactobacillus mucinus LF11.
[0011] Another objective of this invention is to provide an identification technique for Lactobacillus fermentans LF11.
[0012] The above-mentioned objective of this invention is achieved through the following technical solution:
[0013] This invention, through extensive research and exploration, established a strain bank of 1023 probiotic strains based on the gut microbiota of centenarians. Further, through in vitro antioxidant capacity evaluation and in vivo verification of its antioxidant and anti-aging effects, a strain of *Lactobacillus mucinus* LF11 was obtained, possessing strong antioxidant and anti-aging functions, and exhibiting multiple beneficial effects such as regulating gut microbiota, aiding memory improvement, and alleviating chronic inflammation. In vitro antioxidant activity evaluation and in vivo D-galactose-induced aging model experiments showed that LF11 can scavenge multiple free radicals and has significant antioxidant activity (including total antioxidant activity, ABTS free radical scavenging capacity, DPPH free radical scavenging capacity, hydroxyl free radical scavenging capacity, and superoxide anion scavenging capacity). Using a D-galactose-induced PC12 cell senescence model, the effects of fermented Lactobacillus mucinus LF11 and other probiotics on the expression of senescence-related genes P16 and P21 in PC12 cells were examined. Mice subjected to D-galactose-induced oxidative damage and aging were fed live bacteria, and the levels of glutathione (GSH), malondialdehyde (MDA), glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), lipopolysaccharide (LPS), and inflammatory factors (IL-1β, IL-10) in the mouse blood were detected. The expression levels of senescence markers and senescence genes in the mouse liver and colon tissues were also detected. Pathological sections of mouse liver and colon tissues were analyzed, ultimately verifying that this bacterium has a good effect in alleviating oxidative damage and delaying aging.
[0014] Therefore, this invention claims protection for:
[0015] A strain of fermenting lactobacillus ( Limosilactobacillus fermentum LF11, this bacterium was deposited on August 27, 2025 at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 66877, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.
[0016] A fermentation agent of *Lactobacillus mucinus* LF11, comprising *Lactobacillus mucinus* LF11 or its fermentation broth. Preferably, the amount of *Lactobacillus mucinus* LF11 in the agent is 10.3 ~10 12 cfu / g.
[0017] An anti-aging product contains freeze-dried Lactobacillus fermentum LF11 or its fermentation product. Preferably, the amount of Lactobacillus fermentum LF11 in the product is 10. 3 ~10 12 cfu / g.
[0018] The fermentation broth is a liquid obtained by fermentation culture after the strain is inoculated into a liquid culture medium, and it contains bacterial cells and secretions.
[0019] As a preferred embodiment, the liquid culture medium may be MRS liquid culture medium.
[0020] Preferably, the MRS liquid culture medium consists of: 8-12g tryptone, 8-12g beef extract, 3-7g yeast extract, 15-25g glucose, 3-7g anhydrous sodium acetate, 2-3g dipotassium hydrogen phosphate trihydrate, 1.5-2.5g diammonium hydrogen citrate, 0.05-0.15g magnesium sulfate heptahydrate, 0.03-0.07g manganese sulfate monohydrate, and distilled water to make up to 1L.
[0021] More preferably, the MRS liquid culture medium consists of: 10g tryptone, 10g beef extract, 5g yeast extract, 20g glucose, 5g anhydrous sodium acetate, 2.6g dipotassium hydrogen phosphate trihydrate, 2g diammonium hydrogen citrate, 0.1g magnesium sulfate heptahydrate, 0.05g manganese sulfate monohydrate, and distilled water to make up to 1L.
[0022] Optionally, the fermentation broth is prepared by inoculating the LF11 strain into MRS liquid medium and culturing it at 30–38°C for 24–48 hours. Preferably, it is cultured at 37°C for 24–48 hours.
[0023] The fermentation product refers to the product after removing the bacterial cells from the fermentation broth.
[0024] In a preferred embodiment, the fermentation product may be the fermentation supernatant. Optionally, the fermentation broth is centrifuged at 10,000 r / min for 10 minutes at 4°C, and the supernatant is collected.
[0025] The present invention also claims protection for the following applications:
[0026] The application of the fermented Lactobacillus mucinus LF11 in the preparation of products that can delay aging.
[0027] The application of the fermented Lactobacillus mucinus LF11 in the preparation of products that contribute to antioxidant activity.
[0028] The application of the fermented Lactobacillus mucinus LF11 in the preparation of products that help regulate the intestinal flora.
[0029] The application of the fermented Lactobacillus mucinus LF11 in the preparation of products that help improve memory.
[0030] The fermented Lactobacillus mucinus LF11 is used in the preparation of products that help alleviate chronic inflammation caused by aging due to oxidative damage.
[0031] This invention also provides specific molecular targets and identification primers for LF11, and establishes a PCR-based specific detection method.
[0032] The specific molecular target of the fermenting Lactobacillus mucinus LF11 has a nucleotide sequence as shown in SEQ ID NO.1.
[0033] Reagents that can specifically detect the specific molecular target can be used to identify the fermenting Lactobacillus LF11.
[0034] As an alternative implementation, the reagent may be a primer.
[0035] Preferably, the primer sequences are as shown in SEQ ID NO.2 and SEQ ID NO.3.
[0036] Based on this, we provide the application of the specific molecular target and detection reagent in the identification of fermenting Lactobacillus mucinus LF11.
[0037] Specifically, a method for detecting or identifying Lactobacillus fermentans LF11 involves using the specific molecular target as the target for detection or identification.
[0038] As an alternative implementation method, the detection or identification method of Lactobacillus fermentatus LF11 includes the following steps: extracting DNA from the sample to be tested, and then performing PCR amplification using primers SEQ ID NO.2 and SEQ ID NO.3. If a band of 223 bp is obtained, the sample to be tested is Lactobacillus fermentatus LF11; otherwise, it is not.
[0039] Optionally, the PCR amplification system includes 2×PCR Mix, template DNA, primer set and sterile double-distilled water.
[0040] Optionally, the PCR amplification system consists of 10 μL of 2×PCR Mix, 1 μL of template DNA, 1 μL of 10 μmol / L primers, and 8 μL of sterile double-distilled water.
[0041] Optionally, the PCR amplification program is as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 20 s; 65℃ annealing for 30 s; 72℃ extension for 20 s; denaturation, annealing, and extension are performed for a total of 30 cycles; and finally, 72℃ extension for 5 min.
[0042] The present invention has the following beneficial effects:
[0043] This invention screened a strain of fermenting *Lactobacillus mucinus* from the gut microbiota of long-lived individuals. Limosilactobacillus fermentum LF11. Experimental results show that this bacterium has the following multiple functions:
[0044] Antioxidant: This bacterium can scavenge various free radicals, reduce serum malondialdehyde levels, and increase the activity of superoxide dismutase, glutathione, and glutathione peroxidase, thus alleviating oxidative damage.
[0045] Delaying aging: This bacterium inhibits the overexpression of aging-related genes P16 and P21 induced by oxidative damage, improves cell proliferation and slows down tissue aging; and improves the decline in memory recall ability caused by aging.
[0046] Relieving chronic inflammation: This bacterium can reduce serum lipopolysaccharide levels and regulate inflammatory factor levels to alleviate chronic inflammation caused by aging due to oxidative damage.
[0047] Improving Gut Microbiota Imbalance: Gut microbiota analysis experiments showed that this bacterium can also improve aging-induced gut microbiota imbalance and reshape a healthy gut microecological network; LF11 treatment significantly improved... Lactobacillus The abundance of this genus indicates that it is widely believed to have antioxidant, immunomodulatory, and barrier repair functions.
[0048] Improving energy metabolism: This bacterium can alleviate mitochondrial dysfunction, protect mitochondrial function, significantly reduce serum adiponectin (ADPN) and significantly increase leptin (LEP) levels, thus improving energy metabolism and demonstrating potential for anti-fat deposition and metabolic regulation.
[0049] Protecting liver function: This bacterium significantly improved lipid deposition in the liver of aging mice and significantly reduced the levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT), demonstrating a good protective effect on liver function.
[0050] Therefore, this bacterium can be used to develop products with multiple beneficial functions, such as delaying aging, aiding in anti-oxidation, helping to improve memory, and helping to regulate gut microbiota. Moreover, *Lactobacillus mucinus* LF11 has advantages such as high safety, strong gastrointestinal tolerance, and good colonization ability, and has great application value and prospects.
[0051] This invention also provides specific molecular targets and identification primers for LF11, and establishes a PCR-based specific detection method with good effectiveness and specificity. Attached Figure Description
[0052] Figure 1 Example 1 includes fermenting *Lactobacillus mucinus* ( Limosilactobacillus fermentum The graph shows the results of in vitro antioxidant evaluation indicators (total antioxidant capacity, hydroxyl radical scavenging capacity, superoxide anion radical scavenging capacity, ABTS radical scavenging capacity, and DPPH radical scavenging capacity) of eight strains with strong antioxidant properties, including LF11. The horizontal axis of the graph represents the strain numbers PP10, PP17, PP8, PP2, LF6, LP3, LF11, LF14, PP23, PP15, LF12, and LF18, and the vertical axis represents the antioxidant level or free radical scavenging rate of the fermentation supernatant of the strains.
[0053] Figure 2 This is a graph showing the expression levels of P21 and P16 mRNA, which are related to senescence in PC12 cells, in Example 2.
[0054] Figure 3 The effect of the eight probiotic strains in Example 2 on PC12 cell senescence; Figure 3 In section I, the staining analysis results of β-galactosidase, a marker of aging, are presented. Figure 3 In Figures II-IV, the quantitative detection of superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-PX) in the cellular antioxidant system was performed, respectively. C: Normal cell group; M: Senescent cell group; LF11, PP-2, PP-8, PP-10, PP-17, LF-6, LF-13, and LF-14: Probiotic fermentation broth pretreatment groups. p <0.01.
[0055] Figure 4 The effect of LF11 on the mitochondrial membrane potential of PC12 senescent cells in Example 2; Figure 4 Image I shows mitochondrial fluorescence staining. Figure 4 Figure II shows the quantitative analysis of mitochondrial fluorescence. JC-1 aggregates: JC-1 aggregates, used to represent normal mitochondria; JC-1 monomers: JC-1 monomers, used to represent mitochondria with decreased membrane potential; C: normal cell group; M: senescent cell group; LF11, LF-12: probiotic fermentation broth pretreatment group. Observed and photographed using an Olympus IX73 microscope at 400X field of view.
[0056] Figure 5The effect of LF11 on the expression of the apoptosis-related protein BAX in Example 2; C: normal cell group; M: senescent cell group; LF11: probiotic fermentation broth pretreatment group. p <0.01, * p <0.05.
[0057] Figure 6 The colony morphology of fermented Lactobacillus mucinus LF11 in Example 3 is shown.
[0058] Figure 7 This is a diagram showing the behavioral results of mice in Example 4.
[0059] Figure 8 The graph shows the levels of oxidative stress-related indicators MDA, SOD, GSH-PX, GSH, lipopolysaccharide LPS, and inflammatory factors IL-1β and IL-10 in mouse blood in Example 4.
[0060] Figure 9 The image shows the histopathological examination results of the liver and colon tissues of mice in Example 4.
[0061] Figure 10 This is a graph showing the expression levels of aging-related genes P21 and P16 mRNA in the liver of mice in Example 4.
[0062] Figure 11 This is a diagram showing the results of staining analysis of β-galactosidase, a marker of aging, in the liver and colon of mice in Example 4.
[0063] Figure 12 The figure shows the results of α-diversity analysis and β-diversity analysis of mouse gut microbiota in Example 4.
[0064] Figure 13 The results are the species composition analysis of the mouse gut microbiota in Example 4.
[0065] Figure 14 The results of species difference analysis of mouse gut microbiota in Example 4 are shown.
[0066] Figure 15 The results show the lipid accumulation in the mouse liver in Example 4.
[0067] Figure 16 The image shows the results of liver function analysis in mice in Example 4.
[0068] Figure 17 The image shows the results of mouse adipokines analysis in Example 4.
[0069] Figure 18 The graph shows the levels of oxidative stress-related indicators MDA, SOD, GSH-PX, and GSH in rat blood in Example 5.
[0070] Figure 19 This is a graph showing the expression levels of aging-related genes P21 and P16 mRNA in rat liver in Example 5.
[0071] Figure 20 The graph shows the results of the self-aggregation ability of fermented Lactobacillus mucin LF11 in Example 6.
[0072] Figure 21 This is a diagram showing the detection of the specific molecular target of Lactobacillus LF11 in Example 7.
[0073] Figure 22 This is a schematic diagram of the real-time Ct value and the bacterial concentration standard curve of the qPCR method for quantitative detection of the molecular target LF11 of Lactobacillus fermentans in Example 7.
[0074] Figure 23 This is a comparison chart of the PMA-qPCR and conventional qPCR results for fermented Lactobacillus mucinus LF11 in Example 7.
[0075] Figure 7-17 In the mean group, C: normal mice, M: aging mice, LP3: LP3 pretreated mice, LF11: LF11 pretreated mice; *: P<0.05, **: P<0.01, ***: P<0.001, ns: no significant difference. Detailed Implementation
[0076] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.
[0077] Unless otherwise specified, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.
[0078] A survey of the gut microbiota of centenarians revealed that their gut flora possessed strong oxidoreductase activity. Therefore, a high-throughput screening model was established to select high-quality strains from longevity villages, identifying probiotic strains with anti-aging functions. A total of 1023 probiotic strains were isolated from the feces of centenarians, establishing a probiotic strain bank for the longevity family. Further evaluation of the strains' anti-aging functions was conducted through in vitro antioxidant capacity assessment and the establishment of a rapid aging animal model. The probiotic characteristics and safety of the strains were evaluated at multiple levels and modally, including genomic, phenotypic, cellular, and animal studies, resulting in the acquisition of a fermenting *Lactobacillus mucinus* strain LF11.
[0079] The 1023 strains of longevity family gut probiotics used in the experiments in the following examples were provided by the Institute of Microbiology, Guangdong Academy of Sciences.
[0080] Example 1: Preliminary screening of the in vitro antioxidant capacity of probiotics
[0081] 1. First, the ABTS free radical scavenging ability of 1023 probiotic strains from the longevity family gut probiotic strain bank was tested, and 94 strains with strong ABTS free radical scavenging ability were obtained. Further in-depth screening of the antioxidant activity of these 94 strains was conducted, including the following steps:
[0082] (1) Preparation of probiotic fermentation supernatant
[0083] Probiotics from the Longevity Family Intestinal Probiotics strain bank were inoculated into 5 mL of MRS liquid medium and cultured at 37°C for 24 hours. The resulting culture was then used as the inoculum, and 2% of the culture was added to 15 mL of MRS liquid medium. After further static incubation for 24 hours, the strain culture was obtained. The culture was then centrifuged at 10,000 r / min for 10 minutes at 4°C, and the supernatant was collected for use as the fermentation supernatant.
[0084] MRS liquid culture medium composition: 10.00g tryptone, 10.00g beef extract, 5.00g yeast extract, 20.00g glucose, 5.00g anhydrous sodium acetate, 2.60g dipotassium hydrogen phosphate trihydrate, 2.00g diammonium hydrogen citrate, 0.10g magnesium sulfate heptahydrate, 0.05g manganese sulfate monohydrate, and distilled water to make up to 1L. Sterilize at 121℃ for 15min. (Do not include Tween-80 to avoid interference with antioxidant experiments).
[0085] (2) The determination of the in vitro antioxidant activity of probiotics is carried out by the following steps:
[0086] S1. Total antioxidant activity
[0087] Take 0.05 mL of probiotic fermentation supernatant, add 0.25 mL of PBS solution and 0.25 mL of 1% (m / v) potassium ferricyanide solution, mix, and incubate at 37°C for 10 minutes. Then, quickly cool the mixture to room temperature in ice water, add 0.25 mL of 10% trichloroacetic acid (TCA), mix thoroughly, centrifuge at 10000 r / min for 10 minutes to remove protein and other precipitates, and take 0.15 mL of supernatant. Next, add 0.05 mL of 0.1% (m / v) FeCl3 solution, shake thoroughly to mix, incubate for 10 minutes, and then measure the absorbance of the reaction system at 700 nm. Using L-cysteine as a standard, the same procedure was performed with L-cysteine standard solutions of different concentrations (0–800 μmol / L) to plot a standard curve to represent the total antioxidant activity of the probiotics.
[0088] S2.ABTS free radical scavenging ability
[0089] Take 0.05 mL of probiotic fermentation supernatant and add 0.15 mL of ABTS solution (mix 0.1 mol / L phosphate buffer (pH 7.4) and ABTS at a 1:1 ratio, add an appropriate amount of hydrogen peroxide, and place at room temperature for 30 minutes until the absorbance (734 nm) stabilizes at 0.7~0.8). After mixing thoroughly, react at 37℃ in the dark for 10 min and measure the absorbance of the sample at a wavelength of 515 nm.
[0090]
[0091] S3. DPPH free radical scavenging ability
[0092] Take 0.05 mL of probiotic fermentation supernatant, add 0.15 mL of DPPH solution (DPPH was prepared by dissolving in anhydrous ethanol to a final concentration of 0.2 mmol / L), mix well, and react at 37℃ in the dark for 10 min. Measure the absorbance of the sample at a wavelength of 515 nm.
[0093]
[0094] S4. Hydroxyl radical scavenging ability
[0095] Take 200 µL of probiotic fermentation supernatant, add 200 µL of 1 mmol / L H₂O₂ solution, 200 µL of 1 mmol / L FeSO₄ solution, and 200 µL of 1 mmol / L pyrogallol solution. Gently mix and incubate at 37 °C for 30 minutes. After incubation, measure the absorbance at a wavelength of 510 nm.
[0096]
[0097] S5. Superoxide anion radical scavenging ability
[0098] Add 2.0 mL of PBS (pH=7.8), 0.5 mL of probiotic fermentation supernatant and 0.5 mL of pyrogallol solution (50 μmol / L) in sequence, mix thoroughly, and react in the dark at 25℃ for 5 minutes; immediately after the reaction is completed, measure the absorbance at a wavelength of 325 nm.
[0099]
[0100] A1 indicates a sample that does not contain pyrogallol;
[0101] A2 contains samples but does not contain pyrogallol;
[0102] A3 contains the sample and pyrogallol.
[0103] 2. Results
[0104] In this experiment, the antioxidant activity of probiotic fermentation supernatants was evaluated by detecting their total reducing activity, ABTS free radical scavenging ability, DPPH free radical scavenging ability, hydroxyl free radical scavenging ability, and superoxide anion free radical scavenging ability. Eight strains with strong antioxidant activity were screened and recorded as PP10, PP17, PP8, PP2, LF6, LP3, LF11, and LF14. Four strains with weaker antioxidant activity were identified as PP23, PP15, LF12, and LF18.
[0105] Figure 1 The antioxidant activity data of 8 strains with strong antioxidant activity and 4 strains with weak antioxidant capacity are presented.
[0106] Microbiological identification was conducted by the Guangdong Academy of Sciences Institute of Microbiology. Among them, *Lactobacillus fermentans* (…) Limosilactobacillus fermentum (The identification data for LF11 is shown in Example 3). The above eight strains with strong antioxidant activity are as follows:
[0107] Fermented Lactobacillus mucinus ( Limosilactobacillus fermentum LF11,
[0108] Fermented Lactobacillus mucinus ( Limosilactobacillus fermentum LF6,
[0109] Fermented Lactobacillus mucinus ( Limosilactobacillus fermentum LF14,
[0110] Lactobacillus plantarum ( Lactobacillus plantarum strain LP3,
[0111] Pediococcus pentosaceus ( Pediococcus pentosaceus strain PP2,
[0112] Pediococcus pentosaceus ( Pediococcus pentosaceus s train) PP8,
[0113] Pediococcus pentosaceus ( Pediococcus pentosaceus strain PP10,
[0114] Pediococcus pentosaceus ( Pediococcus pentosaceus strain )PP17.
[0115] The anti-aging ability of these 8 strains will be further tested below.
[0116] Example 2: Screening of anti-aging functions in PC12 senescent cells
[0117] 1. Prepare fermentation supernatants of the following lactic acid bacteria: Lactobacillus fermentatus LF11, Lactobacillus fermentatus LF6, Lactobacillus fermentatus LF14, Lactobacillus plantarum LP3, Pediococcus pentosaceus PP2, Pediococcus pentosaceus PP8, Pediococcus pentosaceus PP10, and Pediococcus pentosaceus PP17.
[0118] Cytotoxicity experiments were conducted on the fermentation supernatant. The results showed that no significant toxic effects were observed when the amount of fermentation supernatant added was no more than 6%. Therefore, all subsequent experiments were conducted at a concentration of 6%.
[0119] 2. Cell culture and construction of senescent cell models
[0120] Remove the PC12 cell cryovials from the liquid nitrogen container and quickly place them in a 37°C water bath, gently shaking until the cryopreservation solution is completely thawed. Immediately transfer the thawed cells to a 15 mL centrifuge tube, add 10 mL of pre-warmed resuscitation medium (DMEM medium containing 10% FBS), centrifuge at 800 r / min for 3 minutes, and remove the supernatant. Transfer the resuscitated cell suspension to a cell culture flask, add an appropriate amount of culture medium (high-glucose DMEM medium containing 10% FBS and 1% penicillin-streptomycin) to a total volume of 5 mL, ensuring even cell distribution. Place the culture flask in a 5% CO2, 37°C incubator and incubate statically overnight to allow cell adhesion. When the cells reached 90% confluence, they were digested with 0.25% trypsin and seeded into six-well plates at 50,000 cells per well. The cells were then incubated statically for 24 hours. Cell senescence was induced by culturing the cells in a medium containing 60 mg / ml D-galactose for 8 hours. The culture medium was then replaced with a medium containing 6% probiotic fermentation supernatant for another 24 hours. Cells were then extracted and relevant indicators were measured.
[0121] The results showed that after PC12 cells were treated with 60 mg / mL D-galactose, the cell survival rate was 61%, the malondialdehyde (MDA) content was the highest (0.9 μm / mgprot), and the activity of the aging marker β-galactosidase was the highest. At this time, PC12 cells exhibited a more severe aging phenotype.
[0122] 3. Detection of aging-related genes P16 and P21
[0123] RNA was extracted from cells, and the expression of aging-related genes P21 and P16 was detected by RT-qPCR.
[0124] Table 1 Primer set for PCR detection of P21 and P16 genes in PC12 cells
[0125]
[0126] The expression levels of P21 and P16 genes in PC12 senescent cells treated with probiotics in each group are as follows: Figure 2 As shown:
[0127] Intervention with *Lactobacillus fermentum* LF11 significantly inhibited the increase in P21 and P16 gene expression. *Lactobacillus plantarum* LP3 also showed a certain degree of inhibition of the increase in P21 and P16 gene expression.
[0128] Lactobacillus fermentum (LF6, LF14) and Pediococcus pentosaceus (PP2, PP8, PP10, PP17) did not show significant inhibitory effects on the expression of aging genes.
[0129] 4. Detection of aging-related secretory factors
[0130] In the senescent cell model, the secretion of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α) was significantly increased, while the secretion of anti-inflammatory cytokines (IL-10) was significantly decreased. The activity of the endogenous pro-inflammatory protein NF-κB was also elevated, indicating that senescent cells undergo aseptic chronic inflammation and influence surrounding cells to produce senescent chemotaxis. LF11 pretreatment significantly inhibited the development of chronic inflammation, and its effect was significantly superior to other probiotics, demonstrating a good function in delaying cell senescence.
[0131] 5. Staining of β-galactosidase, a marker of aging, and its impact on the intracellular antioxidant system.
[0132] Based on the D-galactose-induced PC12 cell senescence model, the anti-aging function of eight probiotic strains was evaluated by detecting the activity of β-galactosidase, a senescence marker, and the intracellular antioxidant system.
[0133] The results showed that LF11 could significantly reduce the activity of β-galactosidase, a marker of aging, and effectively enhance the intracellular antioxidant system, alleviate oxidative stress caused by cell damage, and maintain cellular oxidative balance; the other seven strains did not show significant effects in reducing the activity of β-galactosidase, a marker of aging, or in enhancing the intracellular antioxidant system.
[0134] like Figure 3 As shown, the antioxidant system of the senescent cell model was significantly weakened (SOD, CAT, and GSH-PX activities were significantly lower than those of normal cells), and the level of oxidative stress was significantly increased (MDA level was significantly higher than that of normal cells). LF11 pretreatment significantly improved these problems and was significantly more effective than other probiotics.
[0135] Glutathione (GSH), an important intracellular antioxidant, plays a crucial role in maintaining oxidative homeostasis. In senescent cell models, GSH levels and glutathione reductase (GR) activity are significantly reduced, leading to GSH accumulation and indicating a decreased ability of senescent cells to cope with external stress. Pretreatment with LF11 significantly alleviated these problems, demonstrating superior efficacy compared to other probiotics, suggesting that LF11 can maintain cellular health and delay senescence.
[0136] 6. Effects on mitochondrial membrane potential
[0137] Aging is accompanied by partial mitochondrial outer membrane permeability, and these two phenomena are mutually causal. When mitochondrial outer membrane permeability occurs, it indicates functional impairment of the mitochondria, further leading to mitochondrial DNA release and cell damage. Mitochondrial membrane potential is an important indicator of mitochondrial health; a decrease in mitochondrial membrane potential indicates the occurrence of mitochondrial outer membrane permeability.
[0138] This invention constructs a JC-1 cell probe for detecting mitochondrial membrane potential. When the mitochondrial membrane potential is normal, JC-1 exists in the mitochondrial matrix in polymer form and emits red fluorescence; when the mitochondrial membrane potential decreases, JC-1 is released and distributed in the cytoplasm in monomer form, producing green fluorescence. Figure 4 The results showed that a small number of mitochondrial outer membranes became permeable in senescent cells, indicating a decrease in mitochondrial membrane potential. LF11 significantly inhibited this downward trend in mitochondrial membrane potential, demonstrating a beneficial effect on maintaining mitochondrial function.
[0139] 7. Effects on mitochondrial function and apoptosis
[0140] BAX protein is associated with cell damage. Oligomerization of BAX opens a protein pore in the mitochondrial membrane, causing mitochondrial membrane permeability and releasing mitochondrial DNA into the cytoplasm, leading to apoptosis or cell damage. The effect of LF11 on BAX protein was investigated. Figure 5 The results showed that BAX expression was upregulated in senescent cells, showing a significant difference compared to normal cells; while LF11 treatment significantly inhibited BAX protein expression, indicating that LF11 is an inhibitor of BAX. Therefore, it is speculated that LF11 is beneficial for improving mitochondrial function and inhibiting apoptosis.
[0141] Based on the screening results, considering both antioxidant capacity and anti-aging activity, *Lactobacillus fermentum* LF11 showed the strongest efficacy. Furthermore, the anti-aging mechanism of LF11 was systematically elucidated at the cellular level. In short, LF11 delays cellular aging by enhancing the intracellular antioxidant system, maintaining cellular oxidative balance, increasing cellular resistance to external stress, alleviating aseptic chronic inflammation, and reducing mitochondrial dysfunction. *Lactobacillus plantarum* LP3 showed the second-best anti-aging effect; therefore, subsequent animal experiments (Example 4) will continue to compare the anti-aging effects of LF11 and LP3.
[0142] Example 3 Identification of strain LF11
[0143] 1. Morphological identification
[0144] like Figure 6 As shown, Lactobacillus fermentum LF11 is a milky white, round colony, about 1-2 mm in diameter, with a smooth and moist surface, moderate elevation, and no pigment secretion.
[0145] 2. Molecular identification
[0146] The preserved LF11 bacterial strain was inoculated onto MRS liquid medium and cultured anaerobically at 37°C for 24 h. The bacterial pellet was obtained by centrifugation at 10000 r / min, 4°C for 5 min. A suitable amount of bacterial pellet was taken, and genomic DNA was extracted using a commercial DNA extraction kit (Huankai). Next, using the extracted DNA as a template, PCR amplification was performed using universal 16S rRNA gene primers (forward primer 27F and reverse primer 1525R). The PCR reaction volume was 25 µL, including 1 µL of DNA template, 1 µL of each 10 µmol / L primer, 10 µL of 2×PCR Master Mix, and 12 µL of sterile deionized water. The reaction conditions were: 95°C pre-denaturation for 5 min, 94°C denaturation for 1 min, 55°C annealing for 1 min, 72°C extension for 1.5 min, for a total of 30 cycles, with a final extension at 72°C for 10 min. Finally, the obtained 16S rRNA gene sequence was compared with the 16S rRNA gene sequences of known strains using the NCBI BLAST database to confirm that the 16S rRNA gene sequence of strain LF11 is consistent with... Limosilactobacillus fermentum The consistency rate was 99.7%.
[0147] Based on the comprehensive identification results, strain LF11 is *Lactobacillus fermentatus* (…). Limosilactobacillus fermentum It was deposited on August 27, 2025, at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 66877, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.
[0148] Example 4: Animal experiment verification of the function of strain LF11 in delaying oxidative damage-induced aging.
[0149] This experiment conducted in vivo mouse experiments on Lactobacillus fermentum LF11 and compared it with Lactobacillus plantarum LP3.
[0150] (1) Mouse experimental design
[0151] Forty-eight ten-week-old male Kunming mice were divided into four groups:
[0152] ① Normal group: 0.2 mL of normal saline was injected intraperitoneally and 0.2 mL of normal saline was administered by gavage daily;
[0153] ②Aging group (oxidative damage induced): D-galactose (500 mg / kg) was injected intraperitoneally daily, and 0.2 mL of normal saline was administered by gavage.
[0154] ③ Pretreatment group of *Lactobacillus mucinus* LF11: D-galactose (500 mg / kg) was injected intraperitoneally daily, and 0.2 mL of 1±0.1 x 10 g / L was administered orally. 10 CFU / mL fermented Lactobacillus mucin LF11 bacterial culture;
[0155] ④ *Lactobacillus plantarum* LP3 pretreatment group: Daily intraperitoneal injection of D-galactose (500 mg / kg) and gavage administration of 0.2 mL of a concentration of 1 ± 0.1 x 10⁻⁶. 10 CFU / mL of Lactobacillus plantarum LP3 bacterial suspension.
[0156] All mice were kept in an SPF-grade animal laboratory with free access to food and water, maintained at 24±2℃ and 50±5% humidity. Biological samples were collected from all mice after 8 weeks of continuous intervention.
[0157] (2) Mouse behavioral experiments
[0158] After 8 weeks of continuous intervention, all mice underwent behavioral experiments. The procedure for the mouse behavioral dark avoidance experiment was as follows: Before the experiment, the mice were acclimatized to the experimental environment for 20 minutes. First, the mice were gently placed in the bright chamber of the dark avoidance device, facing away from the entrance of the dark chamber, and the timer was started. Mice usually enter the dark chamber due to their attraction to darkness and exploratory behavior. Immediately after the mouse entered the dark chamber, the electric shock system of the dark avoidance device was triggered, and the mouse was given a mild electric shock. After the shock, the mouse was removed from the dark avoidance device and returned to its cage to rest. After 24 hours, this procedure was repeated, and the latency time for the mouse to enter the dark chamber from the bright chamber was recorded, i.e., the time to enter the dark chamber. At the same time, the number of times the mouse entered the dark chamber within 5 minutes was also recorded to observe the mouse's learning and memory abilities.
[0159] The results are as follows Figure 7 As shown, the time for the first electric shock was significantly shorter in the aging group than in the normal group, while the time for the first electric shock was significantly longer in the LF11 pretreatment group, reflecting that LF11 pretreatment can significantly improve the decline in learning and memory abilities caused by aging; and the effect is significantly better than LP3. The number of errors made in the LF11 pretreatment group within 5 minutes was significantly lower than that in the aging group, indicating that LF11 intervention can significantly improve the decline in memory recall ability caused by aging; and the effect is significantly better than LP3.
[0160] (3) Collection of mouse serum and detection of oxidative stress markers and inflammatory factors
[0161] Blood was collected from the mouse eyeballs into blood collection tubes containing sodium heparin, centrifuged at 3000 r / min for 10 min, and the supernatant plasma was collected to determine biochemical indicators.
[0162] Oxidative stress markers: malondialdehyde (MDA), superoxide dismutase (SOD), glutathione peroxidase (GSH-PX), and reduced glutathione (GSH) were measured using commercially available kits manufactured by Nanjing Jiancheng, strictly following the instructions.
[0163] Interleukin-1β (IL-1β), interleukin-10 (IL-10), and lipopolysaccharide (LPS) were measured using commercially available kits manufactured by Dongge Boye Biotechnology Co., Ltd., strictly following the instructions.
[0164] The results are as follows Figure 8 As shown, compared to aging mice, both the LF11 and LP3 pretreatment groups significantly reduced lipid peroxidation (MDA) levels and increased glutathione peroxidase (GSH-px) activity. Furthermore, LF11 intervention significantly increased superoxide dismutase (SOD) activity and increased GSH levels; while LP3 intervention showed decreased SOD activity and reduced GSH levels. This indicates that LF11 possesses excellent antioxidant capabilities and is significantly more effective than LP3.
[0165] In addition, the level of lipopolysaccharide (LPS) in the serum of mice pretreated with LF11 was significantly reduced, the content of pro-inflammatory factor IL-1β was significantly reduced, and the content of anti-inflammatory factor IL-10 was significantly increased; indicating that LF11 can reduce LPS entering the bloodstream, improve chronic inflammation, and its effect is slightly better than that of LP3.
[0166] (4) Histopathological evaluation of liver and colon tissues
[0167] Histopathological evaluation of mouse liver and colon tissues was performed using HE staining.
[0168] The results are as follows Figure 9 As shown:
[0169] No histopathological changes were observed in the liver tissue of normal mice; in the liver tissue of aging mice, hepatocytes were enlarged, hepatic cords were slightly disordered, and hepatic sinusoids were narrowed. In addition, inflammatory infiltration and a large number of vacuolar degenerations were observed. In contrast, no inflammatory infiltration was observed in the LF11 pretreatment group, and the degree of vacuolar degeneration was also reduced compared with that in the aging group.
[0170] No histopathological changes were observed in the colon tissue of normal mice; a small amount of inflammatory infiltration was observed in the colon tissue of aging mice; while no inflammatory infiltration was observed in the LF11 pretreatment group.
[0171] (5) Detection of expression of liver aging genes P16 and P21
[0172] RNA was extracted from mouse liver tissue, and the expression of aging-related genes P21 and P16 was detected by RT-qPCR.
[0173] Table 2 Primer set for PCR detection of mouse liver P21 and P16 genes
[0174]
[0175] The results are as follows Figure 10 As shown, the expression levels of aging-related genes P21 and P16 in the liver of aging mice were significantly increased, while LF11 pretreatment significantly inhibited the expression of P21 and P16; indicating that LF11 has excellent anti-aging ability.
[0176] (6) Detection of β-galactosidase, a marker of aging in liver and colon tissues
[0177] During aging, cells typically increase in size and exhibit high enzymatic activity of β-galactosidase at pH 6.0. Catalyzed by this aging-specific β-galactosidase, the galactosidic bond in the substrate X-ga1 is hydrolyzed, producing a deep blue product.
[0178] like Figure 11 As shown, no β-galactosidase was observed in the liver and colon tissues of normal mice, while a small amount of β-galactosidase was observed in the liver and colon of aging mice, indicating that D-galactose induces early aging in mice; no β-galactosidase was observed in the liver and colon of mice in the LF11 intervention group.
[0179] (7) Intestinal flora analysis
[0180] Mouse feces were collected and 16S rDNA sequencing was performed to elucidate the beneficial effects of fermenting Lactobacillus mucin LF11 in alleviating age-induced gut microbiota dysbiosis.
[0181] like Figure 12 As shown, based on α-diversity analysis and β-diversity analysis, the gut microbiota species composition of the LF11 intervention group was significantly different from that of the aging group mice.
[0182] like Figure 13 As shown, the species venn diagram reveals 949 annotated OTUs in the normal group, 1120 in the aging group, and 778 in the LF11 intervention group, with the LF11 intervention group containing 62 unique OTUs. At the phylum level, LF11 intervention increased the abundance of Firmicutes and Actinobacteria, with the abundance of these two phyla positively correlated with intestinal barrier function and anti-inflammation, while decreasing the abundance of Bacteroidetes and Campylobacteria, with Campylobacteria abundance positively correlated with inflammation. At the family level, LF11 intervention increased the abundance of Lactobacillus and... Eggerthellaceae The abundance of both bacterial families was positively correlated with anti-inflammatory and antioxidant effects; at the genus level, LF11 intervention increased the abundance of Lactobacillus, Bacteroides, and [other bacteria / organisms]. Alloprevotella The abundance of Helicobacter genus was positively correlated with anti-inflammatory effects, barrier protection, and mood improvement.
[0183] like Figure 14 As shown, species difference analysis revealed that D-galactose treatment led to changes in gut microbiota. Parasutterella Significant reduction, accompanied by Mucispirillum , Oscillibacter , Anaerotruncus The significantly elevated levels of certain substances indicate that D-galactose-induced aging involves a certain degree of stress or inflammation. LF11 treatment significantly improved... Lactobacillus The abundance of this genus indicates that it is widely believed to have antioxidant, immunomodulatory, and barrier repair functions.
[0184] Overall, D-galactose intervention led to the remodeling of the gut microbiota network structure in mice, with central nodes... Bacteroidota The flora is predominantly phylum-specific, exhibiting characteristics of microecological imbalance. LF11 may regulate... Lactobacillus The study investigated the ecological status of *Lactobacillus mucinus* LF11 and its negatively related genera, thereby mitigating gut microbiota imbalance and reshaping a healthy gut microbiota network. These findings suggest that fermenting *Lactobacillus mucinus* LF11 can alleviate age-induced gut microbiota dysbiosis.
[0185] (8) Effects on lipid accumulation in the liver of aging mice
[0186] Aging is often accompanied by a decline in liver function, one manifestation of which is the accumulation of lipids in hepatocytes. Oil Red O staining can stain the fat in hepatocytes red, allowing observation of lipid accumulation in the liver.
[0187] The results are as follows Figure 15 As shown, no lipid deposition was observed in the livers of normal mice; some degree of fat accumulation was observed in aging mice; the LP3 group also showed some degree of fatty liver, but lipid deposition was alleviated compared to the aging group; no lipid deposition was observed in the livers of LF11 mice. This indicates that LF11 can significantly reduce lipid accumulation in the livers of aging mice.
[0188] (9) Effects on liver function in aging mice
[0189] like Figure 16 As shown, compared with the normal group of mice, the levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were significantly increased in the aging group of mice. LF11 significantly reduced the levels of AST and ALT, demonstrating a good protective effect on liver function.
[0190] (10) Effects on adipokines in aging mice
[0191] Adiponectin (ADPN) is a cytokine secreted by adipose tissue. It is an adipocyte-specific transcript and an important regulator in the body's lipid metabolism and glucose homeostasis regulatory network. Adiponectin is also known as the ghrelin hormone; its serum concentration increases during fasting, increasing food intake and decreasing energy expenditure, exhibiting the opposite central effects to leptin (LEP).
[0192] like Figure 17 As shown, compared with the aging group mice, LF11 significantly reduced the level of ADPN in serum and significantly increased the level of LEP in serum, which explains why the aging group mice ate more food than the LF11 group during the feeding period; and according to previous research reports, restricting energy intake has certain anti-aging functions.
[0193] Example 5: In vivo dose-response experiment on the effect of strain LF11 in delaying oxidative damage and aging.
[0194] This study investigated the dose-response relationship of the beneficial effects of fermented Lactobacillus mucin LF11 in a D-galactose-induced oxidative damage-aging animal model of SD rats.
[0195] (1) Animal experimental design
[0196] Thirty ten-week-old female SD rats, except for the blank control group (C), were used to induce a D-galactose model via intraperitoneal injection of 1200 mg / kg BW once daily for 6 weeks. Blood samples were collected to measure MDA levels, and the rats were grouped according to their MDA levels. They were divided into an aging group (M) and three test sample dosage groups:
[0197] Low-dose pretreatment group of *Lactobacillus mucinus* LF11 (LF11L): administered via gavage at a concentration of 2 ± 0.1 x 10⁻⁶ mL. 9 CFU / mL fermented Lactobacillus mucilaginosus LF11 bacterial suspension;
[0198] Medium-dose pretreatment group of Lactobacillus fermentum LF11 (LF11M): 0.5 mL of 2±0.1x10 mL was administered daily by gavage. 10 CFU / mL fermented Lactobacillus mucilaginosus LF11 bacterial suspension;
[0199] High-dose pretreatment group of *Lactobacillus mucinus* LF11 (LF11H): 0.5 mL of 2±0.1 x 10⁻⁶ mL was administered daily via gavage. 11 CFU / mL fermented Lactobacillus mucilaginosus LF11 bacterial suspension;
[0200] The aging group was given the same volume of solvent. At the same time as the test sample was given, the model control group and each dose group continued to be given the same dose of D-galactose intraperitoneally. Biological samples were collected after 4 weeks of continuous intervention.
[0201] (2) Collection of rat serum and detection of oxidative stress markers
[0202] Blood was collected from the hepatic vein of rats into blood collection tubes containing sodium heparin, centrifuged at 3000 r / min for 10 min, and the supernatant plasma was collected for biochemical analysis. Oxidative stress markers—malondialdehyde (MDA), superoxide dismutase (SOD), glutathione peroxidase (GSH-PX), and reduced glutathione (GSH)—were measured using commercially available kits manufactured by Nanjing Jiancheng, strictly following the instructions.
[0203] The results are as follows Figure 18 As shown, compared with the aging group rats, the low, medium and high dose groups of LF11 all reduced the level of lipid peroxidation product MDA in serum, restored the activity of antioxidant enzymes SOD and GSH-PX, and increased the level of antioxidant GSH, indicating that fermented Lactobacillus mucinus LF11 has a good antioxidant effect.
[0204] (3) Detection of the expression of liver aging genes P21 and P16
[0205] RNA was extracted from rat liver tissue, and the expression of aging-related genes P21 and P16 was detected by RT-qPCR.
[0206] Table 3 Primer set for PCR detection of P21 and P16 genes in rat liver
[0207]
[0208] The results are as follows Figure 19 As shown, the expression levels of aging-related genes P21 and P16 in the liver of aging rats were significantly increased, while low, medium and high doses of LF11 pretreatment significantly inhibited the expression of P21 and P16 in the liver of rats; indicating that LF11 has excellent anti-aging ability.
[0209] Example 6: Safety and functional characterization of strain LF11
[0210] 1. Evaluation Methods
[0211] (1) Hemolysis test of fermented Lactobacillus mucinus LF11
[0212] LF11 stored in glycerol tubes at -80℃ was inoculated into MRS medium at a volume fraction of 2% and cultured at 37℃ for 24 hours as the first generation of bacteria. The bacteria were cultured for two consecutive generations to fully restore their viability. The activated strain was then inoculated into fresh MRS medium at a volume fraction of 2% and cultured at 37℃ for 18 hours. The bacterial cells were collected, washed twice with PBS, and then mixed with an equal proportion of PBS. The resulting bacterial solution was the seed culture.
[0213] Use a pipette to apply 2 μL of LF11 seed culture to a blood agar plate and incubate at 37°C for 18 h. If a transparent ring is observed around the colony, it indicates β-hemolysis; brown or green indicates α-hemolysis; and no phenomenon indicates γ-hemolysis.
[0214] (2) Antibiotic resistance test of fermented Lactobacillus mucinus LF11
[0215] The method was followed according to the international standard ISO 10932. First, LF11 seed culture with a turbidity of 0.5 McFarland was prepared. 100 μL of seed culture was evenly spread on an MRS plate, and a drug susceptibility test disc was gently placed on the culture medium. The plate was incubated at 37°C for 18 h. The diameter of the inhibition zone was observed and measured. Based on the interpreted values, the susceptibility of the strain was divided into resistant (R), moderately sensitive (I), and sensitive (S). Each experiment was repeated three times.
[0216] (3) Gastrointestinal fluid tolerance test of fermented Lactobacillus mucinus LF11
[0217] a) Preparation of simulated gastric juice: Take sterile phosphate buffer (pH=7.2) and prepare a 3 mg / mL pepsin (1:10000) solution. Adjust the pH to 3.0 using 1 mol / L hydrochloric acid. After mixing thoroughly, filter through a 0.22 μm microporous membrane for sterilization and set aside.
[0218] b) Preparation of simulated intestinal fluid: Take sterile phosphate buffer (pH 7.2), dissolve trypsin (1:250) to a final concentration of 1 mg / mL, add 0.3% ox bile salt, and adjust the pH to 8.0 using 1 mol / L sodium hydroxide. After mixing thoroughly, filter through a 0.22 μm microporous membrane for sterilization, and set aside for later use.
[0219] c) Gastrointestinal fluid tolerance test: After two consecutive subcultures to activate the LF11 strain, it was inoculated into MRS liquid medium at a 2% (v / v) inoculum and cultured at 37°C for 18 h. 5 mL of culture was collected by centrifugation at 8000 r / min, 4°C for 10 min, and the cells were washed twice with sterile phosphate buffer (pH 7.2). The bacterial cells were resuspended in 5 mL of simulated gastric or intestinal fluid and cultured in simulated gastric fluid for 3 h and simulated intestinal fluid for 4 h. The viable cell count was calculated using the plate spread method. The experiment was repeated three times to ensure the accuracy of the results.
[0220]
[0221] In the formula: S represents the survival rate of lactic acid bacteria (%); Nt represents the number of viable lactic acid bacteria after treatment under different conditions (CFU / mL); N0 represents the number of viable lactic acid bacteria at 0 h (CFU / mL).
[0222] (4) Evaluation of the self-aggregating ability of fermenting Lactobacillus mucinus LF11
[0223] Centrifuge 1 mL of bacterial suspension at 6000 rpm for 10 min, remove the supernatant, wash twice with PBS, add 3 mL of sterile PBS to the bacterial cells, mix by vortexing for 10 s, and then take 200 μL of the bacterial suspension to measure OD600. Afterward, incubate the bacterial suspension at room temperature for 2, 4, and 6 h, and then repeat the experiment to measure OD600. Perform triplicate for each bacterial strain. Calculate the aggregation rate using the following formula:
[0224]
[0225] In the formula, H is the self-polymerization ability of Lactobacillus (%); OD0 is the OD600 value of the bacterial culture at 0h; and ODt is the OD600 value at different times t (2, 4, 6h).
[0226] 2. Results
[0227] (1) The hemolysis test showed that strain LF11 was γ-hemolytic and had no risk of hemolysis.
[0228] (2) Antibiotic susceptibility results showed that strain LF11 was sensitive to a variety of common antibiotics, as shown in Table 4. Furthermore, no antibiotic resistance-related genes were found in the subsequent gene annotation of LF11.
[0229] Table 4. Antibiotic susceptibility of strain LF11
[0230]
[0231] (3) Gastrointestinal fluid tolerance test showed that LF11 maintained a high survival rate of 93.42% after treatment with simulated gastric fluid and a high survival rate of 86.67% after treatment with simulated intestinal fluid, indicating good digestive tract tolerance, which helps it survive in the gastrointestinal tract.
[0232] (4) The self-aggregation ability of bacterial strains plays an important role in competing for host binding sites and the cell matrix. Strains with strong self-aggregation ability are more likely to successfully colonize in the intestine, thereby effectively preventing pathogens from binding to the host. Based on different self-aggregation rates, they can be divided into three levels: 16%~35% is low cohesion, 35%~50% is medium cohesion, and above 50% is high cohesion. The results of the self-aggregation ability evaluation experiment in this study (e.g.) Figure 20 The self-aggregation rate of LF11 gradually increased over time, reaching 68.25% after 6 hours of culture, indicating that LF11 has a high self-aggregation ability, which is beneficial for its adhesion and colonization in the host.
[0233] 3. In addition, whole genome sequencing, KEGG annotation and metabolic pathway analysis were performed on strain LF11.
[0234] No pathogenic genes such as hemolysin, toxin, or invasive factors were found in the genome, indicating good safety; no drug resistance-related genes were found, and there is no risk of drug resistance gene transmission.
[0235] KEGG enrichment analysis revealed that the functional genes of LF11 are mainly concentrated in carbohydrate, amino acid and energy metabolism pathways, and are also closely related to the immune system, environmental adaptation and cellular processes, reflecting its strong metabolic and environmental adaptability.
[0236] Example 7: Discovery and Validation of Specific Molecular Targets in Strain LF11
[0237] Discovery and validation of specific molecular targets for Lactobacillus fermentans LF11:
[0238] (1) Based on the pan-genome analysis results of Lactobacillus fermentatus, the unique gene sequence of Lactobacillus fermentatus LF11 was obtained, which is the specific molecular target. The nucleotide sequence is shown in SEQ ID NO.1.
[0239] Specific molecular target sequence of Lactobacillus fermentans LF11 (SEQ ID NO.1):
[0240] TGGGTTCAGCTAGTAAAACTACAATTCGCCGATTCTTGCAAGATTTTAAAAAGGCTCTCAGTCATGGAGACTGGGAAATTGTTCAGCGCAGATGGAATACGCTCAGGTAACTGAAATGACGCCTGAATCAATTAAAATCATACTCATGAAACTTACCCCC GATGACTATGTAAAGGGGCCTGAATTAGATAGGGATAGACCTGATGAGTACCTGTGGGTTTTCTACAAAAATGGTGAAACTGAAAAGTGCTTATACATAAAGTTAAAACTCATGAATGGACACGCCAAGGTCATTTCATTTCATGAAACTATTTACGACTAA
[0241] (2) Primer design for detecting the specific molecular target of Lactobacillus fermentans LF11:
[0242] Design a specific PCR amplification primer set (including forward and reverse primers) based on SEQ ID NO.1, as shown in Table 5.
[0243] Table 5 Primer set for specific sequence PCR detection
[0244]
[0245] (3) Steps for detecting the specific molecular target of Lactobacillus fermentans LF11:
[0246] Step S1. Prepare DNA template:
[0247] Lactobacillus fermentum LF11 was enriched in MRS liquid medium, and bacterial genomic DNA was extracted using a bacterial genomic DNA extraction kit as a template for testing; at the same time, DNA from non-LF11 strains as shown in Table 6 was extracted.
[0248] Table 6 shows that all strains were obtained from the Longevity Family Probiotics Strain Bank, which contains 1023 strains of probiotics, provided by the Institute of Microbiology, Guangdong Academy of Sciences, and preserved by the Institute of Microbiology, Guangdong Academy of Sciences.
[0249] Step S2. PCR amplification:
[0250] PCR amplification system: 2×PCR Mix, 10 μL; forward primer (10 μmol / L), 0.5 μL; reverse primer (10 μmol / L), 0.5 μL; template DNA, 1 μL; ddH2O, 8 μL.
[0251] PCR amplification program: 94℃ preheating for 20s; 94℃ denaturation for 20s, 65℃ annealing for 30s, 72℃ extension for 20s (30 cycles); 72℃ extension for 5 min.
[0252] Step S3. Electrophoresis:
[0253] Perform gel electrophoresis on the PCR amplification products and observe whether only *Lactobacillus fermentum* LF11 shows a single amplification band at the position corresponding to the product size of the primer set. If only *Lactobacillus fermentum* LF11 shows a single amplification band, it indicates that the corresponding target is a strain-specific molecular target.
[0254] PCR amplification product gel results as follows Figure 21 As shown: Well M is the lane well for fermenting *Lactobacillus mucinus* LF11, wells 1-73 are lane wells for other *Lactobacillus mucinus* strains, wells 74-123 are lane wells for non-target *Lactobacillus* strains, and wells 124-138 are lane wells for non-*Lactobacillus* strains.
[0255] The strains used and the test results are shown in Table 6 and Figure 21 As shown in Table 6; in the results, "+" indicates positive and "-" indicates negative.
[0256] Table 6. Detection results of specific molecular targets of Lactobacillus fermentans LF11
[0257]
[0258] Depend on Figure 21 It can be seen that fermenting *Lactobacillus mucinus* LF11 contains a specific band, and only the target strain LF11 shows a specific amplification band. Neither the non-target lactobacilli nor the non-lactobacilli contain a specific band, indicating that only the target strain contains a specific molecular target in this method.
[0259] (2) The effectiveness of quantitative real-time PCR in detecting the specific molecular recognition target of Lactobacillus fermentans LF11.
[0260] The effectiveness and specificity of the specific detection primers shown in SEQ ID NO.2 and SEQ ID NO.3 were further verified using real-time PCR. First, *Lactobacillus fermentum* LF11 was inoculated into MRS liquid medium and cultured for 16 h, then the viable count was adjusted to 10⁻⁶. 9 CFU / mL, diluted 10-fold with physiological saline to obtain a concentration of 10. 3 10 4 10 5 10 6 10 7 10 8 10 9 DNA was extracted from pure cultures of the strain at CFU / mL to serve as qPCR standards. Each template was run in triplicate. A standard curve was plotted with Cq(Ct) in qPCR on the ordinate and the logarithm of the concentration of the pure culture of the standard on the abscissa.
[0261] qPCR reaction system preparation: 2×SYBR Green Premix, 10μL; forward primer (10μmol / L), 0.5μL; reverse primer (10μmol / L), 0.5μL; template DNA, 1μL; ROX II, 0.4μL; ddH2O, 7.6μL.
[0262] qPCR amplification program: Preheat at 95℃ for 3 min; 95℃ for 20 s, 65℃ for 30 s (40 cycles).
[0263] Figure 22 Figure A shows the real-time Ct values of the qPCR quantitative detection method using primers SEQ ID NO.2 and SEQ ID NO.3. Figure 22 Figure B shows the standard curves for primers SEQ ID NO.2 and SEQ ID NO.3. The results show that when the bacterial concentration is ≥10... 5 At CFU / mL, the Ct fluorescence curve is relatively stable, therefore the detection limit of this primer is 10. 5 CFU / mL, the fitted standard curve was y = -2.6248x + 39.98, R0 2=0.978. Therefore, this target primer has good specificity and can be used to specifically detect Lactobacillus fermentans LF11.
[0264] (3) Detection of viable bacteria count by PMA (propidium azidobromide) real-time PCR
[0265] First, *Lactobacillus fermentum* LF11 was inoculated into MRS liquid medium and cultured for 24 h. 1.5 mL of the bacterial suspension was then heated at 95°C for 10 min to inactivate the bacteria. The complete inactivation was confirmed using the plate culture method. Two 500 µL aliquots of the inactivated bacteria were placed in clean centrifuge tubes; one tube was not treated with PMA, and the other was treated with 50 µmol / L PMA. Simultaneously, two live bacterial aliquots were prepared and treated using the same method.
[0266] The specific procedure for the PMA reaction is as follows: Add 500 µL of the sample to be tested to a 1.5 mL transparent centrifuge tube, then add 12.5 µL of 2 mmol / L PMA (final concentration 50 µmol / L), mix gently, and react at 4 °C in the dark for 15 min. Then, place the centrifuge tube horizontally on ice and irradiate it with a 650 W halogen lamp for 10 min, with a distance of 20 cm between the centrifuge tube and the halogen lamp bulb. After the reaction, centrifuge the tube at 8000 rpm for 3 min, discard the supernatant, resuspend the bacterial cells in physiological saline, wash twice repeatedly to remove residual PMA, collect the bacterial cells, and extract DNA using a bacterial DNA extraction kit.
[0267] The two types of samples were simultaneously detected using PMA-qPCR and conventional qPCR, respectively. The viable bacterial count of the samples was calculated using the qPCR reaction system and amplification program, and the above standard curve was used.
[0268] The results are as follows Figure 23 The results showed that the viable cell counts in the live bacteria + PMA-qPCR treatment group and the groups amplified by ordinary qPCR (live bacteria-qPCR and dead bacteria-qPCR) were basically the same, indicating that ordinary qPCR could not accurately distinguish between live and dead bacteria. However, there was a significant difference between the live bacteria + PMA-qPCR group and the dead bacteria + PMA-qPCR group. These results indicate that PMA-qPCR has the selective detection capability to detect the number of viable bacteria above the detection line for *Lactobacillus fermentum* LF11.
[0269] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A strain of fermenting *Lactobacillus mucilaginosus* ( Limosilactobacillus fermentum LF11, characterized in that, The bacteria were deposited at the Guangdong Provincial Center for Microbial Culture Collection on August 27, 2025, with accession number GDMCC No: 66877.
2. A fermentation agent for Lactobacillus mucilaginosus LF11, characterized in that, Contains the fermenting Lactobacillus LF11 as described in claim 1.
3. A product for delaying aging, characterized in that, Contains the freeze-dried Lactobacillus mucilaginosus LF11 of claim 1.
4. The use of the fermented Lactobacillus mucinus LF11 of claim 1, the bacterial agent of claim 2, or the product of claim 3 in the preparation of products capable of delaying aging.
5. The use of the fermented Lactobacillus mucinus LF11 of claim 1, the bacterial agent of claim 2, or the product of claim 3 in the preparation of products that contribute to antioxidant activity.
6. The use of the fermented Lactobacillus mucinus LF11 of claim 1, the bacterial agent of claim 2, or the product of claim 3 in the preparation of products that help regulate the intestinal flora.
7. The use of the fermented Lactobacillus mucinus LF11 of claim 1, the bacterial agent of claim 2, or the product of claim 3 in the preparation of products that help improve memory.
8. The use of the fermented Lactobacillus mucinus LF11 of claim 1, the bacterial agent of claim 2, or the product of claim 3 in the preparation of products that help alleviate chronic inflammation caused by aging due to oxidative damage.
9. The specific molecular target of *Lactobacillus fermentans* LF11 as described in claim 1, characterized in that, The nucleotide sequence is shown in SEQ ID NO.
1.
10. A primer for identifying *Lactobacillus fermentans* LF11 as described in claim 1, characterized in that, The primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.
3.
11. A kit for identifying *Lactobacillus fermentans* LF11 as described in claim 1, characterized in that, Contains the primers described in claim 10.
12. The use of the specific molecular target of claim 9, the primer of claim 10, or the kit of claim 11 in the identification of the fermenting Lactobacillus myxobolus LF11 of claim 1.
13. A method for identifying the fermenting *Lactobacillus mucinus* LF11 of claim 1, characterized in that, Identification was performed using the specific molecular target described in claim 9 as the target.
Citation Information
Patent Citations
Probiotic strain for ageing, muscle and bone, gut, hyperlipidemia, skin and brain
CN112955539A
KR20230153832A