Method for inducing common tobacco endogenous gene silencing based on tobacco embrittlement virus

Abstract

The invention belongs to the technical field of plant gene function research, and particularly relates to a method for inducing endogenous gene silencing of common tobacco (Nicotiana tabacum) by using a tobacco embrittlement virus. In order to solve the problems of unstable silencing efficiency, poor systematic silencing effect and the like of the existing TRV-VIGS technology in common tobacco, various key parameters about tobacco varieties, virus inoculation methods and plant culture conditions in the implementation process of the TRV-VIGS technology are determined, and the problems of common tobacco are effectively solved by adopting the method provided by the invention. The endogenous NtPDS gene of common tobacco is successfully silenced, and the silencing efficiency is as high as 99.02%.

Description

Technical Field

[0001] This invention belongs to the field of plant gene function research technology, specifically relating to a method for inducing common tobacco (Tobacco rattle virus, TRV) to function. Nicotiana tabacum The method of silencing endogenous genes is applicable to fields such as tobacco gene function research, metabolic regulation, and disease-resistant breeding. Technical Background Virus-induced gene silencing (VIGS) is an immune mechanism in plants against viral infection. When a virus or a viral vector carrying cDNA infects a plant, it forms an intermediate double-stranded RNA (dsRNA) during replication and expression. dsRNA is a key elicitor for gene silencing. First, it is cleaved in the cell by the RNase III family-specific endonuclease Dicer into small interfering RNA (siRNA) of 21–24 nt. siRNAs are further amplified in plant cells by RNA-dependent RNA polymerase 1 (RDR1), RDR2, or RDR6, and then bind to the Agronaute1 (AGO1) protein in single-stranded form to form an RNA-induced silencing complex (RISC). Homologous RNA-specific interactions in the cytoplasm of RISC cells lead to homologous RNA degradation, resulting in post-transcriptional gene silencing (PTGS) and transcriptional gene silencing (TGS). Artificial VIGS technology does not rely on stable plant genetic transformation, is simple to operate, has a short cycle time, and is low in cost. It can rapidly and efficiently silence single genes or multiple homologous genes in a family, and is widely used in plant gene function research.

[0002] Currently, over 40 viral vectors (RNA viruses, DNA viruses, and satellite viruses) have been successfully applied in VIGS. RNA viruses include Tobacco mosaic virus (TMV), Potato virus X (PVX), Tobacco rattle virus (TRV), Tomato golden mosaic virus (TGMV), and Cabbage leaf curl virus (CbLCV). DNA viruses include Beet curly top virus (BCTV) and Tomato leaf curl virus (ToLCV). Satellite viruses include Tomato yellow leaf curl Chinavirus (TYLCV) and Tobacco curly shoot virus (TbCSV). Among these, TRV viral vectors have a broad host range, high silencing efficiency, and mild viral symptoms, thus they are widely used in the construction of VIGS vectors.

[0003] TRV-VIGS technology has been applied to tomatoes and tobacco (Ben's tobacco). Nicotiana benthamiana It is widely used in model plants such as tobacco, but not in common tobacco ( Nicotiana tabacum The silencing efficiency in common tobacco still suffers from instability and poor systemic silencing effects, severely limiting research on gene function verification and metabolic pathway analysis. While *Nicotiana benthamiana* serves as a model organism for plant research, common tobacco (…) Nicotiana tabacum (This refers to a specific type of tobacco used in cigarette or cigar production, and the two are not interchangeable.) Therefore, there is an urgent need to develop an efficient and stable method for TRV-induced endogenous gene silencing in common tobacco. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a method for treating ordinary tobacco ( Nicotiana tabacum The endogenous gene silencing method lays the foundation for functional genomics research and molecular breeding in common tobacco.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows: One of the technical solutions provided by this invention is a TRV-induced method targeting ordinary tobacco ( Nicotiana tabacumThe gene silencing infection method, wherein the common tobacco is specifically the Samsun tobacco variety; the infection method is to infect the tobacco leaves with an infection solution; the infection timing is when the second true leaf of the tobacco has just emerged; the infection site is the two cotyledons of the tobacco. Furthermore, the mode of infection is: injection infection; Furthermore, the infection solution is an infection solution containing pTRV1 plasmid and pTRV2-target gene fragment recombinant plasmid; Furthermore, the monoclonal bacterial solutions obtained by transforming pTRV1 plasmid and recombinant plasmid pTRV2-target gene fragment recombinant plasmid into Agrobacterium were mixed to obtain gene silencing infection solution; Furthermore, before injecting the infected tobacco, the tobacco plants were kept dry and dark for 24 hours. Furthermore, after injecting and infecting tobacco, the tobacco plant cultivation conditions were controlled at a temperature of 22°C, a humidity of 60%, and 16 hours of light / 8 hours of darkness.

[0006] The second technical solution provided by this invention is a TRV-induced common tobacco ( Nicotiana tabacum Gene silencing methods include the following steps: (1) The target gene fragment of common tobacco was ligated to the pTRV2 plasmid to construct the pTRV2-target gene fragment recombinant plasmid; Furthermore, the target gene fragment in common tobacco is a 300-500 bp fragment on the target gene to be silenced, and its screening meets the requirements of VIGS technology; (2) The monoclonal bacterial solutions obtained by transforming pTRV1 plasmid and pTRV2-target gene fragment recombinant plasmid into Agrobacterium are mixed to obtain gene silencing infection solution; Specifically, the pTRV1 plasmid and the pTRV2-target gene fragment recombinant plasmid were transformed into Agrobacterium competent cells GV3101, and then propagated to obtain single-clone culture of Agrobacterium containing pTRV1 and single-clone culture of Agrobacterium containing pTRV2-target gene fragment. More specifically, the monoclonal bacterial suspensions of Agrobacterium containing pTRV1 and Agrobacterium containing the pTRV2-target gene fragment were centrifuged separately, and the supernatants were discarded. The monoclonal bacterial suspensions of Agrobacterium containing pTRV1 and Agrobacterium containing the pTRV2-target gene fragment were then resuspended separately using MMA resuspension. The resuspension of the monoclonal bacterial suspensions of Agrobacterium containing pTRV1 and Agrobacterium containing the pTRV2-target gene fragment were then mixed to obtain the gene silencing infection solution. Preferably, a monoclonal bacterial suspension of Agrobacterium containing pTRV1 and a monoclonal bacterial suspension of Agrobacterium containing the pTRV2 target gene fragment are mixed at a viable cell ratio of 1:1; more preferably, the OD values ​​of the two monoclonal bacterial suspensions are... 600 All are 3.0; (3) Inject the infection solution into ordinary tobacco leaves to achieve silencing of the target gene in ordinary tobacco; Furthermore, the common tobacco specifically refers to the Samsun tobacco variety; Furthermore, the timing of infection is selected as follows: when the second true leaf of tobacco has just emerged, the two cotyledons are injected with the infection. Furthermore, before injecting the infected tobacco, the tobacco plants were kept dry and treated in the dark for 24 hours; Furthermore, after injecting and infecting tobacco, the tobacco plant cultivation conditions were controlled at a temperature of 22°C, a humidity of 60%, and 16 hours of light / 8 hours of darkness.

[0007] Beneficial effects: Regarding the existing TRV-VIGS technology in ordinary tobacco ( Nicotiana tabacum The TRV-VIGS technology suffers from problems such as unstable silencing efficiency and poor systemic silencing effect. This invention identifies key parameters related to tobacco variety, virus inoculation method, and plant culture conditions during the implementation of the TRV-VIGS technology. The method provided by this invention effectively solves the aforementioned problems in common tobacco, successfully silencing endogenous viruses in common tobacco. NtPDS Gene silencing, with a silencing efficiency of up to 99.02%. Attached Figure Description

[0008] Figure 1 The image shows the pTRV2-NtPDS plasmid.

[0009] Figure 2 Phenotypic images of leaves of *Tobacco Benedictine* and common tobacco after inoculation with TRV virus vector, based on conventional infection parameters.

[0010] Figure 3 Photograph of the injection site for common tobacco.

[0011] Figure 4 Phenotypic diagram of ordinary tobacco leaves after inoculation with TRV virus vector based on modified infection parameters.

[0012] Figure 5 To determine the expression level of TRV1 virus in common tobacco leaves after inoculation with TRV virus vector based on modified infection parameters.

[0013] Figure 6 To determine the expression level of TRV2 virus in common tobacco leaves after inoculation with TRV virus vector based on modified infection parameters.

[0014] Figure 7 Based on modified infection parameters, after inoculation with TRV virus vector, the levels of TRV virus in ordinary tobacco leaves were [data missing]. NtPDS mRNA abundance of genes. Detailed Implementation

[0015] The present invention will be described in full and in detail below through examples, which are intended to help readers thoroughly understand the contents disclosed herein, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples are all commercially available.

[0016] The following are some of the biological materials used in this invention: The pTRV1 plasmid (pYL192, GenBank accession AF406990), pTRV2 plasmid (pYL156, accession AF406991), and pTRV2-NbPDS plasmid (from Sophien Kamoun, doi: 10.1007 / s11103-004-0590-7) are all commercial vectors purchased from Boyuan Biotechnology Co., Ltd.

[0017] Example 1: NtPDS VIGS target design for genes Phytoene desaturase (PDS) is a key enzyme in the carotenoid synthesis pathway. PDS When genes are silenced, the carotenoid synthesis pathway is blocked, leading to an albinism phenotype in plants. Therefore, PDS The gene is commonly used as a reporter gene in the plant VIGS silencing system.

[0018] First, blast to the NCBI public genome database NtPDS

[0019] Based on the above NtPDS Gene CDS sequences were used to design target site sequences using the SGN VIGS Tool with the following parameters: n-mer size = 21, fragment length = 400, mismatches = 0, and the database being Nicotiana tabacumv4.5 Edwards 2017. Finally, a 400 bp target was identified. NtPDSs Specific gene silencing fragments, located in NtPDS The region from 697 to 1069 bp of the gene CDS sequence is named NtPDS target region, the nucleic acid sequence is as follows: 5'-TGGCCCGAAAAAGTCAAATTTGCTATTGGACTCTTGCCAGCAATGCTTGGAGGGCAATCTTATGTTGAAGCTCAAGACGGTTTAAGTGTTAAGGACTGGATGAGAAAGCAAGGTGTGCCTGATAGGGTGACAGATGAGGTGTTCATTGCCATGTCAAAGGCACTTAACTTCATAAACCCTGACGAGCTTTCGA TGCAGTGCATTTTGATTGCTTTGAACAGATTTCTTCAGGAGAAACATGGTTCAAAAATGGCCTTTTTAGATGGTAACCCTCCTGAGAGACTTTGCATGCCGATTGTTGAACATATTGAGTCAAAAGGTGGCCAAGTCAGACTAAACTCACGAATAAAAAAGATTGAGCTCAATGAGGATGGAAGTGTCAAATGTTTTATACTGAATA-3'.

[0020] Example 2: Construction of pTRV2-NtPDS plasmid Total RNA extraction (CTAB method): 0.2 g of common tobacco leaves were placed in a 2 mL centrifuge tube, one sterile steel bead was added, and the mixture was frozen in liquid nitrogen and ground using a ball mill. 1000 μL of CTAB extraction buffer was added, and the mixture was incubated at 65°C for 1 h, inverting several times every 15 min during incubation. 300 μL of chloroform:isopropanol (24:1) was added, inverted, and centrifuged at 13000 rpm at 4°C for 5 min. The supernatant was transferred to a new 2 mL centrifuge tube. 500 μL of chloroform:isopropanol (24:1) was added, inverted, and centrifuged at 13000 rpm at 4°C for 5 min. The supernatant was transferred to a new 2 mL centrifuge tube. 300 μL of lithium chloride (8M) was added, and the mixture was precipitated at -20°C for 3 h. The mixture was centrifuged at 13000 rpm at 4°C for 5 min, the supernatant was discarded, and the mixture was washed with 75% ethanol. Dissolve in 50 μL of RNase-free ddH2O and store at -80℃.

[0021] RNA was reverse transcribed into cDNA using the Novizan HiScript III RT SuperMix for qPCR (+gDNA wiper) kit. The genomic DNA removal reaction mixture was as follows: 1 μg plant RNA, 4 μL 4 × gDNA wiper Mix, and RNase-free ddH2O to a final volume of 16 μL. Genomic DNA removal reaction conditions: 42℃ for 2 min. Then, 4 μL of 5 × HiScript III qRT SuperMix was added. Reverse transcription reaction conditions: 37℃ for 15 min, 85℃ for 5 s. After the reaction, the cDNA was diluted 10-fold with RNase-free ddH2O and used as a template for subsequent PCR reactions.

[0022] PCR amplification was performed using common tobacco cDNA obtained from reverse transcription as a template. NtPDS The target region fragment is represented by the forward primer: NtPDS-F- Xba I: 5'-AAGGCCATAAGTCATATTTTGTAAACTG-3', reverse primer: NtPDS-R- BamHI: 5'-GGTACCACCGGGCTTTTTCAGTTTAAACG-3'. PCR amplification was performed using TakaRa PrimeSTAR Max DNA polymerase. The reaction mixture consisted of: 10 × Buffer 5 μL, 10 mM dNTP 2 μL, forward primer 2 μL, reverse primer 2 μL, DNA polymerase 1 μL, and cDNA 1 μL. PCR conditions were: 95℃ for 5 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 35 cycles; extension at 72℃ for 5 min. PCR products were detected by 1% agarose gel electrophoresis. NtPDS The target region fragment size is 400 bp, which is in line with the expected size.

[0023] Purified PCR gene fragments ( NtPDS target region fragment) Xba I and Bam After double digestion with HI, and with Xba I and Bam The pTRV2 plasmid, double-digested with HI, was ligated using T4-DNA ligase. The ligation product was transformed into *E. coli* DH5α competent cells and plated on LB solid medium (containing 50 mg / L kanamycin). The cells were incubated overnight at 37°C with the medium inverted. Single colonies grew, and these colonies were picked and transferred to liquid LB medium (containing 50 mg / L kanamycin) and cultured at 37°C with shaking at 250 rpm for 12 hours. The plasmid was then extracted. After sequencing verification, the positive plasmid was named pTRV2-NtPDS. Figure 1 (As shown).

[0024] Example 3: Agrobacterium-mediated transformation pTRV1, pTRV2, pTRV2-NbPDS, and pTRV2-NtPDS containing the NtPDS gene silencing fragment were transformed into GV3101 Agrobacterium competent cells. The transformation conditions were as follows: 5 μL of plasmid was added to 100 μL of competent cells, gently mixed, and then subjected to liquid nitrogen cold shock for 2 min; the cells were incubated in a 37°C water bath for 30 min; 1 mL of LB liquid medium was added, and the cells were incubated at 28°C for 3 h; the bacterial suspension was centrifuged at 8000 rpm for 2 min, 900 μL of supernatant was discarded, the bacterial cells were resuspended, and spread onto LB solid medium (containing 50 mg / L rifampin, 50 mg / L gentamicin, and 50 mg / L kanamycin), and incubated in the dark at 28°C for 48 h. Agrobacterium cells carrying the target fragment were screened by colony PCR.

[0025] Example 4: Tobacco Inoculation and Adjustment of Related Parameters 1. Preparation of the infiltration solution Monoclonal plaques of Agrobacterium containing pTRV1, Agrobacterium containing pTRV2, Agrobacterium containing pTRV2-NbPDS, and Agrobacterium containing pTRV2-NtPDS were respectively inoculated into 2 mL of YEP liquid medium (containing 50 mg / L rifampin, 50 mg / L gentamicin, and 50 mg / L kanamycin) and incubated at 28℃ and 220 rpm for 24 h.

[0026] Then, monoclonal bacterial suspensions of Agrobacterium containing pTRV1, Agrobacterium containing pTRV2, Agrobacterium containing pTRV2-NbPDS, and Agrobacterium containing pTRV2-NtPDS were inoculated into YEP liquid medium (containing 50 mg / L rifampicin, 50 mg / L gentamicin, and 50 mg / L kanamycin) at a volume ratio of 1:100 and cultured at 28℃ and 220 rpm for 24 h to obtain the monoclonal bacterial suspensions of Agrobacterium containing pTRV1, Agrobacterium containing pTRV2, Agrobacterium containing pTRV2-NbPDS, and Agrobacterium containing pTRV2-NtPDS with the best viability. Centrifuge at 8000 rpm for 2 min, collect the bacterial cells, and resuspend in MMA solution (containing 10 mM MES, 10 mM MgCl2 and 0.2 mM Acetosyringone), adjusting to OD. 600 =3.0. The resuspension of Agrobacterium containing pTRV1 was mixed with the resuspensions of Agrobacterium containing pTRV2, pTRV2-NbPDS, and pTRV2-NtPDS at a 1:1 volume ratio to obtain mixed infection solutions. The solutions were then incubated at room temperature in the dark for 2 hours before use.

[0027] 2. Existing Benedictine tobacco ( Nicotiana benthamiana TRV-VIGS technology in conventional tobacco ( Nicotiana tabacum Applicability in ) The commonly used infection parameters for *Nicotiana benthamiana* TRV-VIGS in existing technologies are as follows: Inject infection into the true leaves when the 5th-6th true leaves are fully expanded; the OD of the injected bacterial solution... 600 >1; Before injecting and infecting tobacco, the tobacco plants were kept dry and dark for 24 hours; after injecting and infecting tobacco, the cultivation conditions of the tobacco plants were controlled at a temperature of 22℃, humidity of 60%, and 16 hours of light / 8 hours of darkness.

[0028] Based on the above infection parameters, *Nicotiana benthamiana* was inoculated with a mixed infection solution of pTRV1 and pTRV2-NbPDS (NbPDS is the phytoene dehydrogenase gene of *Nicotiana benthamiana*), while common tobacco (Samsun variety) was inoculated with a mixed infection solution of pTRV1 and pTRV2-NtPDS. Figure 2 As shown, 14 days after inoculation, the newly grown leaves of Nicotiana benthamiana exhibited whitishness. NbPDS The gene was successfully silenced; and the newly grown leaves of the common tobacco (Samsun variety) did not turn white. NtPDS The gene was not silenced; instead, a hazard response (HR) was observed in the inoculated leaves after infection with the pathogen. Therefore, the existing Nicotiana benthamiana (Nicotiana benthamiana) Nicotiana benthamiana TRV-VIGS technology is not suitable for regular tobacco ( Nicotiana tabacum ).

[0029] To address the aforementioned issues with common tobacco (Samsun variety) NtPDS The technical issue of gene silencing led to a further adjustment of the inoculation timing and site for common tobacco (Samsun variety). Inoculation was performed when the second true leaf bud had just emerged, injecting a mixed infection solution of pTRV1 and pTRV2-NtPDS into both cotyledons (cotyledon position as shown in the image). Figure 3 (As shown), other parameters remained unchanged. 14 days after inoculation, tobacco leaves showed signs of whitening (…). Figure 4 ).

[0030] Furthermore, the tobacco variety Samsun was replaced with other common tobacco varieties (see Table 1 for details), and inoculated with a mixed infection solution of pTRV1 and pTRV2-NtPDS using the same parameters (injecting two cotyledons when the second true leaf of the tobacco plant had just emerged). Observations were conducted within 30 days after inoculation, and no whitening occurred in any of the tobacco varieties (Table 1). It is evident that tobacco variety and the timing of infection are two key factors affecting the VIGS efficiency of common tobacco.

[0031] Table 1. Leaf albino phenotypes after inoculation with pTRV1+pTRV2-NtPDS in different tobacco varieties

[0032] Example 5: Silent Efficiency Determination For the Samsun variety of tobacco, in Example 4, when the second true leaf of the tobacco plant was just emerging, two cotyledons were injected with a mixed infection solution of pTRV1 and pTRV2-NtPDS. The degree of leaf whitening was observed and photographed at 0 days, 7 days, and 30 days after injection to assess the VIGS effect. The cellular composition of the tobacco leaves was also measured. NtPDS The mRNA abundance of the gene and the expression level of TRV virus were used to further evaluate the gene silencing efficiency.

[0033] Total RNA extraction (CTAB method): 0.2 g of *S. sambac* leaves were placed in a 2 mL centrifuge tube, one sterile steel bead was added, and the mixture was frozen in liquid nitrogen and ground using a ball mill. 1000 μL of CTAB extraction buffer was added, and the mixture was incubated at 65°C for 1 h, inverting several times every 15 min during incubation. 300 μL of chloroform:isopropanol (24:1) was added, inverted, and centrifuged at 13000 rpm at 4°C for 5 min. The supernatant was transferred to a new 2 mL centrifuge tube. 500 μL of chloroform:isopropanol (24:1) was added, inverted, and centrifuged at 13000 rpm at 4°C for 5 min. The supernatant was transferred to a new 2 mL centrifuge tube. 300 μL of lithium chloride (8M) was added, and the mixture was precipitated at -20°C for 3 h. The mixture was centrifuged at 13000 rpm at 4°C for 5 min, the supernatant was discarded, and the mixture was washed with 75% ethanol. Dissolve in 50 μL of RNase-free ddH2O and store at -80℃.

[0034] RNA was reverse transcribed into cDNA using the Novizuma HiScript III RT SuperMix for qPCR (+gDNA wiper) kit. The genomic DNA removal reaction mixture was as follows: 1 μg plant RNA, 4 μL 4 × gDNA wiper Mix, and RNase-free ddH2O to a final volume of 16 μL. Genomic DNA removal reaction conditions: 42℃ for 2 min. Then, 4 μL of 5 × HiScript III qRT SuperMix was added. Reverse transcription reaction conditions: 37℃ for 15 min, 85℃ for 5 s. After the reaction, the cDNA was diluted 10-fold with RNase-free ddH2O and used as a template for the qPCR reaction.

[0035] Real-time quantitative qPCR was performed using the Novizan ChamQ SYBR Color qPCR Master Mix kit. The reaction mixture consisted of: 10 μL 2× ChamQ SYBR Color qPCR Master Mix, 0.5 μL Primer F (10 µM), 0.5 μL Primer R (10 µM), 1 μL cDNA, and 8.5 μL RNase-free ddH2O. The qPCR reaction conditions were: 95℃ pre-denaturation for 30 s; 95℃ for 10 s, 60℃ for 30 s, for 40 cycles; and 95℃ for 10 s, 60℃ for 30 s, 95℃ for 10 s.

[0036] Primer information for qRT-PCR: qRT- NtPDSThe forward primer is 5'-AACCCCAATCAGTCTATGTTGG-3'; qRT- NtPDS The reverse primer is 5'-AGCTTTCCTGATAAGACAGCAC-3'; qRT- NtActin The forward primer for the (internal reference gene) is 5'-GATGAAGATACTCACAGAAAGA-3'; qRT- NtActin The reverse primer for the (internal reference gene) is 5'-GTGGTTTCATGAATGCCAGCA-3'; The forward primer for qRT-TRV1 is 5'-TTTAAGTGCCCTGGATCTAGG-3'; The reverse primer for qRT-TRV1 is 5'-CTATCTGAGCGCAAAAGTACAC-3'; The forward primer for qRT-TRV2 is 5'-CTTTAAGTAGATCCGTGTCTGAAG-3'; The reverse primer for qRT-TRV2 is 5'-AACAACACAAACAAAGTCCGTTCC-3'.

[0037] Using a mixed infection solution containing the pTRV1+pTRV2 viral vector combination without the target gene fragment as a negative control, the color of tobacco leaves and the expression levels of NtPDS, TRV1, and TRV2 in the leaves were analyzed at 7 days and 30 days after inoculation with the mixed infection solution containing the pTRV1 and pTRV2-NtPDS viral vector combination with the target gene fragment. The results showed that 7 days after inoculation with pTRV1 and pTRV2-NtPDS containing the target gene fragment, tobacco leaves began to show whitening. Figure 4 The viruses (TRV1 and TRV2) are highly expressed in the leaves. Figure 5 and Figure 6 ), tobacco endogenous NtPDS Gene expression levels decreased by approximately 40-fold. Figure 7 ); 30 days after inoculation, tobacco leaves continued to turn white ( Figure 4 The expression levels of the viruses (TRV1 and TRV2) decreased slightly. Figure 5 and Figure 6 ), tobacco endogenous NtPDS The gene is hardly expressed ( Figure 7 ).

[0038] Therefore, this invention, through strict control of key parameters regarding tobacco variety, virus inoculation method, and plant culture conditions during the TRV-VIGS technology implementation process, successfully controlled endogenous viruses in ordinary tobacco. NtPDSGene silencing, with a silencing efficiency of up to 99.02%.

[0039] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0040] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A TRV-induced inhibitor targeting conventional tobacco ( Nicotiana tabacum The gene silencing infection method is characterized by, The common tobacco is specifically the Samsun tobacco variety; the infection method is to use an infection solution to infect the tobacco leaves; the infection timing is when the second true leaf of the tobacco has just emerged; the infection site is the two cotyledons of the tobacco.

2. The infection method as described in claim 1, characterized in that, The infection solution is an infection solution containing pTRV1 plasmid and pTRV2-target gene fragment recombinant plasmid.

3. The infection method as described in claim 1, characterized in that, The infection method was: injection infection; before injecting the tobacco plants, the water was controlled and the plants were darkened for 24 hours; after injecting the tobacco plants, the cultivation conditions were controlled at 22℃, 60% humidity, 16 hours of light / 8 hours of darkness.

4. A TRV-induced common tobacco ( Nicotiana tabacum The gene silencing method is characterized by, Includes the following steps: (1) The target gene fragment of common tobacco was ligated to the pTRV2 plasmid to construct the pTRV2-target gene fragment recombinant plasmid; (2) The monoclonal bacterial solutions obtained by transforming pTRV1 plasmid and pTRV2-target gene fragment recombinant plasmid into Agrobacterium are mixed to obtain gene silencing infection solution; (3) Inject the infection solution into ordinary tobacco leaves to achieve the silencing of the target gene in ordinary tobacco; the timing of the infection is: when the second true leaf of tobacco has just emerged, inject the two cotyledons to infect it.

5. The gene silencing method as described in claim 4, characterized in that, In step (1), the common tobacco target gene fragment is a 300-500 bp fragment on the target gene to be silenced, and its screening meets the requirements of VIGS technology.

6. The gene silencing method as described in claim 4, characterized in that, In step (2), the pTRV1 plasmid and the pTRV2-target gene fragment recombinant plasmid were transformed into Agrobacterium competent cells GV3101, and then propagated to obtain single-clone culture of Agrobacterium containing pTRV1 and single-clone culture of Agrobacterium containing pTRV2-target gene fragment. The monoclonal bacterial suspensions of Agrobacterium containing pTRV1 and Agrobacterium containing the pTRV2-target gene fragment were centrifuged separately, and the supernatants were discarded. The monoclonal bacterial suspensions of Agrobacterium containing pTRV1 and Agrobacterium containing the pTRV2-target gene fragment were then resuspended separately using MMA resuspension buffer. The resuspension buffers of Agrobacterium containing pTRV1 and Agrobacterium containing the pTRV2-target gene fragment were then mixed to obtain the gene silencing infection solution.

7. The gene silencing method as described in claim 6, characterized in that, In step (2), the monoclonal bacterial suspension of Agrobacterium containing pTRV1 and the monoclonal bacterial suspension of Agrobacterium containing the pTRV2-target gene fragment are mixed at a ratio of 1:1 for the number of viable bacteria.

8. The gene silencing method as described in claim 4, characterized in that, In step (3), the common tobacco is specifically the Samsun tobacco variety.

9. The gene silencing method as described in claim 4, characterized in that, In step (3), before injecting the tobacco plants, the water was controlled and the plants were darkened for 24 hours. After injecting the tobacco plants, the cultivation conditions were controlled at 22°C, 60% humidity, and 16 hours of light / 8 hours of darkness.

Images