An ascas12f split expression mediated gene editing method

Abstract

The application provides an AsCas12f gene segment expression mediated gene editing method. The gist is that the AsCas12f gene is divided into two parts, which are respectively cloned into expression vectors, and gene editing is realized after co-expression of the two vectors. Preferably, the first half of the AsCas12f gene comprises REC, WED and Linker sequences, the second half comprises Linker, RuvC and TNB sequences, gRNA sequences and target gene sequences, the two parts contain overlapping Linker sequences, the 3' end of the first half is added with the 5' end sequence of an Intein, the 5' end of the second half is added with the 3' end sequence of the Intein, the two parts are respectively expressed by plant virus vectors TRV (tobacco rattle virus) and PVX (potato virus X), and gene editing on the target gene is realized.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to an AsCas12f gene segment expression mediated gene editing method and application thereof. BACKGROUND

[0002] The CRISPR / Cas gene editing technology has great application value in the fields of biological medicine, biological breeding and the like. At present, the most commonly used Cas protein for CRISPR / Cas gene editing is Cas9, but the gene thereof is large (about 4.2 kb), and it is difficult to use a viral vector for gene delivery. AsCas12f is a small Cas protein, only 422 amino acids, which greatly improves the feasibility of using a viral vector for gene delivery. Although AsCas12f is less than 1 / 3 of the size of Cas9, the AsCas12f gene plus a nuclear localization signal, and a gRNA sequence, exceeds 1.4 kb, still exceeding the range of many viral vectors for stable expression of exogenous genes. To solve this problem, the application segments the expression of the AsCas12f gene, further reduces the length of the exogenous gene expressed by the viral vector, so that the length of each part of the AsCas12f gene does not exceed 700 bp. After co-expression of the two parts, a functional AsCas12f is formed, and the gene editing effect on the target gene is achieved. SUMMARY

[0003] In view of the problems in the prior art, the application provides an AsCas12f gene segment expression gene editing vector, a gene editing method and application thereof. The AsCas12f gene segment expression method is that the first half part is a 645 bp sequence including REC, WED and Linker, the second half part is a 639 bp sequence including Linker, RuvC and TNB, and a gRNA sequence and a target gene sequence, the two parts contain an overlapping sequence of Linker, and the 3' end of the first half part is added with a 5' end sequence of an Intein, and the 5' end of the second half part is added with a 3' end sequence of the Intein. The two parts are expressed by using plant viral vectors TRV (tobacco rattle virus) and PVX (potato virus X), and a functional AsCas12f is formed after co-expression in plant leaves, so that gene editing on a target gene is achieved.

[0004] Specifically, the first aspect of the present invention provides a gene editing vector for segmented expression of the AsCas12f gene, characterized in that the gene editing vector is a plant virus vector, and the gene editing vector utilizes the plant virus to segmentally express gene editing elements nCas12f-InteinN expression cassette and InteinC-cCas12f-Linker expression cassette, forming independently expressed gene editing vectors containing nCas12f-InteinN expression cassette structure and InteinC-cCas12f-Linker expression cassette structure, respectively.

[0005] In a preferred embodiment of the present invention, the sequence of the nCas12f-InteinN expression cassette is shown in SEQ ID NO.1 and the sequence of the nCas12f-InteinN expression cassette is shown in SEQ ID NO.2, wherein N is the editing site sequence of the target gene and the number of bases of N ranges from 15 to 25.

[0006] In a preferred embodiment of the present invention, the carrier is obtained through the following steps:

[0007] The nCas12f-InteinN expression cassette and the InteinC-cCas12f-Linker expression cassette were cloned into the multiple cloning site of the plant virus vector, respectively.

[0008] Preferably, the molar ratio of pNC-TRV2-OE vector to nCas12f-InteinN expression cassette or InteinC-cCas12f-Linker expression cassette in the cloning reaction system is 1:3 to 1:1.

[0009] Preferably, the cloning reaction system contains 60 ng of pNC-TRV2-OE vector, 30-50 ng of nCas12f-InteinN expression cassette or InteinC-cCas12f-Linker expression cassette, 5 μL of Nimble Mix reaction solution, and a total system volume of 10 μL. The reaction conditions are 50 °C for 30 minutes.

[0010] Optionally, the cloning reaction system can be scaled up or down proportionally according to the aforementioned reaction system.

[0011] In another preferred embodiment, the nCas12f-InteinN expression cassette and the InteinC-cCas12f-Linker expression cassette are cloned into the multiple cloning site of the PVX plant virus vector, respectively.

[0012] In a preferred embodiment of the present application, the vector comprises a vector with the nucleotide sequences shown in SEQ ID NO. 22 and SEQ ID NO. 23, wherein N is an editing site sequence of a target gene, and the number of bases of N ranges from 15 to 25.

[0013] In another preferred embodiment of the present application, the gene editing vector expressed by the AsCas12f gene fragment comprises a vector with the nucleotide sequences shown in SEQ ID NO. 24 and SEQ ID NO. 25, wherein N is an editing site sequence of a target gene, and the number of bases of N ranges from 15 to 25.

[0014] Another aspect of the present application provides a method for constructing a plant virus gene editing vector, characterized in that the method is to clone the gene editing elements AsCas12f and its gRNA fragments into the multiple cloning sites of the plant virus vector, and use the plant virus to express the gene editing elements AsCas12f and its gRNA fragments, to form a gene editing vector comprising an independently expressed nCas12f-InteinN expression frame and an independently expressed InteinC-cCas12f-Linker expression frame, respectively.

[0015] Preferably, the sequence of the nCas12f-InteinN expression frame is shown in SEQ ID NO. 1, and the sequence of the InteinC-cCas12f-Linker expression frame is shown in SEQ ID NO. 2, wherein N is an editing site sequence of a target gene, and the number of bases of N ranges from 15 to 25.

[0016] Preferably, the number of bases of N ranges from 18 to 20.

[0017] Preferably, the number of bases of N is 20.

[0018] Preferably, the vector construction method comprises the following steps:

[0019] Cloning the nCas12f-InteinN expression frame and the InteinC-cCas12f-Linker expression frame into the cloning sites of the plant virus vector, respectively.

[0020] Preferably, the molar ratio of the pNC-TRV2-OE vector to the nCas12f-InteinN expression frame or the InteinC-cCas12f-Linker expression frame in the cloning reaction system is 1:3 to 1:1.

[0021] Preferably, the cloning reaction system is 60 ng of pNC-TRV2-OE vector, 30-50 ng of nCas12f-InteinN expression frame or InteinC-cCas12f-Linker expression frame, 5 ul of Nimble Mix reaction solution, and a total system of 10 ul, and the reaction conditions are 50℃ for 30 minutes.

[0022] Alternatively, the cloning reaction system can be proportionally enlarged or reduced according to the foregoing reaction system.

[0023] In another preferred embodiment, the nCas12f-InteinN expression frame and the InteinC-cCas12f-Linker expression frame are respectively cloned into the multiple cloning sites of the PVX plant virus vector.

[0024] Another aspect of the present application provides a plant virus-mediated gene editing method, and the specific steps are as follows:

[0025] 1) Transforming Agrobacterium with any of the foregoing vectors or the vector obtained by the method described in any of the foregoing.

[0026] 2) Using the Agrobacterium containing the vector obtained in step 1) to infect the target plant, preferably using injection or infiltration method to infect the target plant.

[0027] The present application also provides a kit, characterized in that the kit comprises a pNC-TRV2-OE vector, an nCas12f-InteinN expression frame and an InteinC-cCas12f-Linker expression frame, and further comprises a reaction solution for constructing the vector, the sequence of the nCas12f-InteinN expression frame is shown in SEQ ID NO. 1, the sequence of the nCas12f-InteinN expression frame is shown in SEQ ID NO. 2, wherein N is an editing site sequence of a target gene, the number of bases of N ranges from 15 to 25, and the reaction solution is a Nimble Mix reaction solution.

[0028] The present application also provides a kit, characterized in that the kit comprises a PVX vector, an nCas12f-InteinN expression frame and an InteinC-cCas12f-Linker expression frame, and further comprises primers and a reaction solution for constructing the vector, the sequence of the nCas12f-InteinN expression frame is shown in SEQ ID NO. 1, the sequence of the InteinC-cCas12f-Linker expression frame is shown in SEQ ID NO. 2, wherein N is an editing site sequence of a target gene, the number of bases of N ranges from 15 to 25, and the reaction solution is a NEBuilder enzyme solution.

[0029] The application also provides the use of the vector of any one of the preceding aspects, or the vector obtained by the method of any one of the preceding aspects, or the kit of the preceding aspect in plant gene editing.

[0030] Compared with the prior art, the technical solution provided by the application has the following advantages:

[0031] By segmenting expression of the AsCas12f gene (including a nuclear localization signal and a gRNA sequence), the gene length is further reduced, the vector expression is more stable, and after co-expression, a functional AsCas12f can be formed to achieve gene editing effect. BRIEF DESCRIPTION OF DRAWINGS

[0032] The beneficial effects of the application will be described in detail below in combination with the drawings and specific embodiments.

[0033] Figure 1 Figure 1 is an amplification electrophoretogram of a target fragment of a TRV vector constructed without Intein. 1: nCas12f (containing a nuclear localization signal); 2: cCas12f-Linker (containing a gRNA and a target sequence); 3: cCas12f-RuvC (containing a gRNA and a target sequence); M: DL2000Marker.

[0034] Figure 2 Figure 1 is an amplification electrophoretogram of a target fragment of a TRV vector constructed without Intein. 1: nCas12f (containing a nuclear localization signal); 2: cCas12f-Linker (containing a gRNA and a target sequence); 3: cCas12f-RuvC (containing a gRNA and a target sequence); M: DL2000Marker.

[0035] Figure 3 Figure 1 is an amplification electrophoretogram of a target fragment of a TRV vector constructed without Intein. 1: nCas12f (containing a nuclear localization signal); 2: cCas12f-Linker (containing a gRNA and a target sequence); 3: cCas12f-RuvC (containing a gRNA and a target sequence); M: DL2000Marker.

[0036] Figure 4 Figure 1 is an amplification electrophoretogram of a target fragment of a TRV vector constructed without Intein. 1: nCas12f (containing a nuclear localization signal); 2: cCas12f-Linker (containing a gRNA and a target sequence); 3: cCas12f-RuvC (containing a gRNA and a target sequence); M: DL2000Marker.

[0037] Figure 5 Figure 1 is an amplification electrophoretogram of a target fragment of a TRV vector constructed without Intein. 1: nCas12f (containing a nuclear localization signal); 2: cCas12f-Linker (containing a gRNA and a target sequence); 3: cCas12f-RuvC (containing a gRNA and a target sequence); M: DL2000Marker.

[0038] Figure 6 Figure 1 is an amplification electrophoretogram of a target fragment of a TRV vector constructed without Intein. 1: nCas12f (containing a nuclear localization signal); 2: cCas12f-Linker (containing a gRNA and a target sequence); 3: cCas12f-RuvC (containing a gRNA and a target sequence); M: DL2000Marker. DETAILED DESCRIPTION

[0039] The technical solutions in the embodiments of the present application will be clearly and completely described below. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative work fall within the protection scope of the present application.

[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0041] Part of the nucleotide sequences involved in the present application are as follows:

[0042] SEQ ID NO. 1

[0043] Atggctccgaagaagaagaggaaggttatgattaaggtttacaggtatgaaattgtgaaaccacttgatttggattggaaggagtttggtaccattctgcgacagcttcagcaggaaacacgttttgctttaaacaaagctacgcagttggcttgggaatggatgggattttcatccgactacaaagataatcatggagaatatccaaaatctaaggatattcttggttacaccaatgttcatgggtatgcttaccacactataaaaacaaaggcttatcgcttgaattctggaaatctttcccaaaccatcaaacgagctactgataggttcaaggcatatcaaaaggagatcctaaggggcgatatgtctatcccgtcttacaagagggatcatcctctggatttgataaaagaaaatatctctgtcaatagaatgaatcacggagattatattgctagtttaagcttgttgtccaaccctgcaaaacaagaaatgaacgtgaagagaaaaataagtgtaataatcatagtacgtggggcgggaaaaactatcatggatagaattctctcgggcgagtatcaggtgtcggcctctcagataattcataaagaccggaagaataagtggtatcttaatatctcatataggtttgaacctcaaacaagggtactatgtctttcctatgaaactgaaatcctcaccgtagaatatggtttgctacccatcgggaaaattgtcgagaagagaattgagtgcacggtgtacagcgttgataacaatggcaacatctacacacaaccggtggcgcagtggcatgatcggggggagcaagaggtgttcgagtactgccttgaagatggatcattaatacgcgccaccaaggaccacaagttcatgacagttgacggccagatgctgcctattgatgaaatatttgagagggagctggatctcatgagggtcgacaacctgccaaattga;

[0044] SEQ ID NO. 2

[0045] Atgatcaagatcgccaccaggaagtacctcggcaagcagaacgtctatgatataggggtggagcgcgaccacaacttcgcgctgaaaaatggatttattgcttccgaacctcaaacaagggtactagatctcaataaaattatggggatagatctgggagttgccgttgcagcatacatggcatttcagcacacaccagccaggtataaactcgaaggtggtgagattgagaactttagaagacaagttgagagcagacgaatttcaatgttacggcagggaaagtatgcagggggagcccgtggaggtcatggcagagataaaagaattaagcccattgaacaattacgtgacaagatcgccaacttccgggacactactaaccatcgttattcccgctacattgttgacatggctataaaggagggatgtggtacaattcaaatggaggatctaacaaacatacgcgacattggcagtaggttcttgcaaaattggacttactatgatcttcaacaaaaaattatatataaggctgaagaagctggtattaaggtcatcaagattgatccacagtatacttcacaaagatgcagtgaatgtgggaacatcgacagtggtaatagaattggtcaagctattttcaaatgcagagcttgtggatatgaggcaaatgctgattacaatgcagcgaggaatatcgctattcctaatatcgataagataatagcagagtcaattaaatctggtaagcggccagcggcgacgaagaaggcggggcaggcgaagaagaagaagtgaaacaaagcaccagtggtctagtggtagaatagtaccctgccacggtacagacccgggttcgattcccggctggtgcaggattcgtcggttcagcgacgataagccgagaagtgccaataaaactgttaagtggtttggtaacgctcggtaaggtccgaaaggagaaccactgaacnttttttt;

[0046] SEQ ID NO. 3 agtggtctctgtccagtcctatggctccgaagaagaagag;

[0047]

[0048] SEQ ID NO. 5 agtggtctctgtccagtcctatggaacctcaaacaagggtact;

[0049]

[0050] SEQ ID NO. 7 agtggtctctgtccagtcctatggatctcaataaaattatggg;

[0051]

[0052] SEQ ID NO. 9 aacctcaaacaagggtactatgtctttcctatgaaactga;

[0053]

[0054] SEQ ID NO. 11 agtggtctctgtccagtcctatgatcaagatcgccaccag;

[0055]

[0056] SEQ ID NO. 13 aaaatggatttattgcttccgaacctcaaacaagggtact;

[0057]

[0058] SEQ ID NO. 15 aggtcagcaccagctagcatatggctccgaagaagaagag; ​​​​​​​​​​​​​

[0059] SEQ ID NO. 16 acttaaccgt tcatcggcgg tcgactcaat ttggcaggtt gtcga;

[0060] SEQ ID NO. 17 aggtcagcac cagctagcat atgatcaaga tcgccaccag ;

[0061] SEQ ID NO. 18 acttaaccgt tcatcggcgg tcgacaaaaa atcgctacta ccaaaac;

[0062] SEQ ID NO. 19 gaccgccgat gaaacggtta ag;

[0063] SEQ ID NO. 20 atgctagctg gtgctgacct ;

[0064] SEQ ID NO. 21

[0065] Tgtctttcct atgaaactga aatcctcacc gtagaatatg gtttgctacc catcgggaaa attgtcgaga agagaattga gtgcacggtg tacagcgttg ataacaatgg caacatctac acacaaccgg tggcgcagtg gcatgatcgg gggagcaaga ggtgttcgag tactgccttg aagatggatc attaatacgc gccaccaag gaccacaagt tcatgacagt tgacggccag atgctgccta ttgatgaaat atttgagagg gagctggatc tcagcagggt cgacaacctg ccaaatatga tcaagatcgc caccaggaag tacctcggca agcagaacgt ctatgatatag gggtggagcg cgaccacaac ttcgcgctga aaaatggatt tattgcttcc ;

[0066] SEQ ID NO. 26

[0067]

[0068] Example 1 TRV viral vector construction of different structures of AsCas12f gene segment expression and its gene editing efficiency

[0069] (1) TRV viral vector construction of AsCas12f gene segment expression without Intein

[0070] According to the nucleic acid sequence of AsCas12f (with nuclear localization signal at the front and back) and its gRNA (containing Nicotiana benthamiana PDS gene target sequence) (AsCas12f-tRNA-gRNA), a pair of primers was designed to amplify the 5' end sequence of AsCas12f gene (containing REC, WED and Linker) and the nuclear localization signal at its 5' end, the upstream primer was SEQ ID NO. 3, and the downstream primer was SEQ ID NO. 4; a pair of primers was designed to amplify the 3' end sequence of AsCas12f gene (containing Linker, RuvC and TNB) and gRNA (containing Nicotiana benthamiana PDS gene target sequence), the upstream primer was SEQ ID NO. 5, and the downstream primer was SEQ ID NO. 6; a pair of primers was designed to amplify the 3' end sequence of AsCas12f gene (containing RuvC and TNB, not containing Linker) and gRNA (containing Nicotiana benthamiana PDS gene target sequence), the upstream primer was SEQ ID NO. 7, and the downstream primer was the same as SEQ ID NO. 6. Using AsCas12f-tRNA-gRNA synthesized artificially (Shanghai Generay) as a template, the above three pairs of primers were used to perform PCR amplification using PrimeSTAR high-fidelity polymerase (Takara Company), and the PCR amplification program was as follows: 98℃ for 30 seconds; 98℃ for 10 seconds, 55℃ for 20 seconds, 72℃ for 30 seconds, 28 cycles; finally 72℃ for 1 minute. The PCR product was detected by agarose gel electrophoresis, and the target band was recovered by cutting gel Figure 1). The recovered three fragments were respectively subjected to Nimble Cloning cloning reaction with the TRV viral vector pNC-TRV2-OE (patent publication number: CN116064647B). The cloning reaction system was 50-70 ng of the vector, 30-50 ng of the recovered fragment, 5 ul of Nimble Mix reaction solution (you line biological), and a total system of 10 ul. The reaction condition was 50°C for 30 minutes. 5 ul of the ligation product was transformed into E. coli competent cells, and after overnight culture, single colonies obtained were identified by PCR and sequencing to obtain three TRV viral vectors containing AsCas12f gene fragments with correct sequences, which were respectively named as pTRV2-nCas12f (containing SEQ ID NO. 3 and SEQ ID NO. 4 amplified fragments), pTRV2-cCas12f-Linker (containing SEQ ID NO. 5 and SEQ ID NO. 6 amplified fragments), and pTRV2-cCas12f-RuvC (containing SEQ ID NO. 7 and SEQ ID NO. 6 amplified fragments).

[0071] (2) TRV viral vector construction for segmented expression of AsCas12f gene containing Intein

[0072] According to the nucleic acid sequence of AsCas12f (both before and after the addition of nuclear localization signal) and its gRNA (containing the target sequence of PDS gene of Nicotiana benthamiana) and the nucleic acid sequence of artificially synthesized Intein (SEQ ID NO. 15), a pair of primers was designed to amplify the 5' end sequence of AsCas12f gene (containing REC, WED and Linker) and the nuclear localization signal at its 5' end (named as nCas12f), the upstream primer being the same as SEQ ID NO. 3 and the downstream primer being SEQ ID NO. 8; a pair of primers was designed to amplify the 5' end sequence of Intein (named as InteinN), the upstream primer being SEQ ID NO. 9 and the downstream primer being SEQ ID NO. 10, wherein SEQ ID NO. 8 and SEQ ID NO. 9 have an overlapping sequence of 20 bp for the ligation of two fragments; a pair of primers was designed to amplify the 3' end sequence of Intein (named as InteinC), the upstream primer being SEQ ID NO. 11 and the downstream primer being SEQ ID NO. 12; a pair of primers was designed to amplify the 3' end sequence of AsCas12f gene (containing Linker, RuvC and TNB) and gRNA sequence (named as cCas12f-Linker), the upstream primer being SEQ ID NO. 13 and the downstream primer being the same as SEQ ID NO. 6; a pair of primers was designed to amplify the 3' end sequence of AsCas12f gene (containing RuvC and TNB, not containing Linker) and gRNA sequence (named as cCas12f-RuvC), the upstream primer being SEQ ID NO. 14 and the downstream primer being the same as SEQ ID NO. 6, wherein SEQ ID NO. 12 and SEQ ID NO. 13-14 have an overlapping sequence of 20 bp for the ligation of two fragments. Artificially synthesized AsCas12f-tRNA-gRNA (SEQ ID NO. 26, wherein the N base is ttatgttttggtagtagcga) and Intein (Shanghai Generay Biotech, SEQ ID NO. 21) were used as templates, and the above-mentioned five pairs of primers were used for PCR amplification, and the amplification conditions were the same as above. The amplification products were detected by agarose gel electrophoresis, and the target bands were recovered by cutting the gel.

[0073] The recovered 5 fragments were divided into 3 combinations (nCas12f+InteinN, InteinC+cCas12f-Linker, InteinC+cCas12f-RuvC), and Nimble Cloning multi-fragment cloning reaction was carried out with TRV viral vector pNC-TRV2-OE, and the reaction conditions were the same as above. 5 ul of the ligation product was transformed into E. coli competent cells, and after overnight culture, the single colonies obtained were identified by PCR and sequencing, and 3 TRV viral vectors containing AsCas12f gene fragments with correct sequences were obtained, named pTRV2-nCas12f-InteinN (SEQ ID NO. 22), pTRV2-InteinC-cCas12f-Linker (SEQ ID NO. 23) and pTRV2-InteinC-cCas12f-RuvC respectively. The schematic diagram of the gene editing element structure of the three vectors is shown in Figure 2 . The nucleic acid sequences of nCas12f-InteinN and InteinC-cCas12f-Linker are SEQ ID NO. 1 and SEQ ID NO. 2 respectively.

[0074] (3) Gene editing efficiency of TRV viral vector with AsCas12f gene expressed in segments

[0075] The plasmids of the six vectors constructed in (1) and (2) above were extracted, and Agrobacterium GV3101 was transformed, respectively, and single colonies of Agrobacterium were picked for PCR identification. The single colonies containing target vectors were inoculated in 5 ml of LB liquid medium, and cultured at 200 rpm and 28°C until OD600 was 1.0-1.5. The bacterial solution was centrifuged at 5000 rpm for 5 minutes, and the supernatant was removed. 5 ml of injection buffer (50 mM MES pH 5.6, 10 mM MgCl2, 100 uM acetosyringone) was added, and the solution was gently suspended. The solution was centrifuged at 5000 rpm for 5 minutes, and the supernatant was removed. The injection buffer was added again to OD600 of 0.3-0.6, and the Nicotiana tabacum leaves were injected with the four different combinations of TRV1 injection solution after being placed in the dark at room temperature for 1-2 hours, including combination 1: pTRV2-nCas12f+pTRV2-cCas12f-Linker; combination 2: pTRV2-nCas12f+pTRV2-cCas12f-RuvC; combination 3: pTRV2-nCas12f-InteinN+pTRV2-InteinC-cCas12f-Linker; and combination 4: pTRV2-nCas12f-InteinN+pTRV2-InteinC-cCas12f-RuvC. Seven days after injection, the DNA of the injected area of the leaves was extracted using TransDirect® Plant Tissue PCR Kit (Beijing Quanshijin), and the target sequence was amplified by PCR. The amplification primers were: upstream primer: ggagtgagtacggtgtgcgaggtcttcgttggg; and downstream primer: gagttggatgctggatggcctttgtcaatcttcgggtc. The PCR products were subjected to HI-TOM high-throughput sequencing, three repeats were tested, and the sequencing results were analyzed and aligned. The sequencing results showed that combination 1 (pTRV2-nCas12f+pTRV2-cCas12f-Linker) and combination 2 (pTRV2-nCas12f+pTRV2-cCas12f-RuvC) did not detect gene editing effect, while combination 3 (pTRV2-nCas12f-InteinN+pTRV2-InteinC-cCas12f-Linker) and combination 4 (pTRV2-nCas12f-InteinN+pTRV2-InteinC-cCas12f-RuvC) both detected gene editing of the target gene, and the gene editing efficiency of combination 3 was significantly higher than that of combination 4 Figure 3), indicating that AsCas12f gene segment expression cannot spontaneously form a complete and functional AsCas12f protein, and with the help of Intein protein ligation, AsCas12f gene segment expression can form a complete and functional AsCas12f protein, and the 2 fragments of AsCas12f gene containing Linker repeat sequences can improve the gene editing efficiency. The detected gene editing type is mainly 8-13 base pair deletion ( Figure 4 ), which is consistent with the characteristics of AsCas12f gene editing, further proving that AsCas12f gene segment expression forms a complete and functional AsCas12f protein.

[0076] Example 2 PVX viral vector construction of AsCas12f gene segment expression and its gene editing efficiency

[0077] (1) PVX viral vector construction

[0078] A pair of primers was designed to amplify the nCas12f-InteinN fragment used for PVX vector construction, the upstream primer was SEQ ID NO. 15, the downstream primer was SEQ ID NO. 16, and PCR amplification was performed with the above constructed pTRV2-nCas12l2f-InteinN plasmid as the template; a pair of primers was designed to amplify the InteinC-cCas12f-Linker and InteinC-cCas12f-RuvC fragments used for PVX vector construction, the upstream primer was SEQ ID NO. 17, the downstream primer was SEQ ID NO. 18, and PCR amplification was performed with the above constructed pTRV2-InteinC-cCas12f-Linker and pTRV2-InteinC-cCas12f-RuvC plasmids as the templates, respectively; according to the PVX vector sequence (Genbank: AY297843), a pair of primers was designed to amplify the PVX vector, the upstream primer was SEQ ID NO. 19, the downstream primer was SEQ ID NO. 20, and PCR amplification was performed with the PVX plasmid as the template. After electrophoresis, the target fragment was recovered by cutting the gel. ( Figure 5 ). The recovered target fragment and the vector were connected with NEBuilder enzyme solution, and the transformed Agrobacterium was selected for PCR identification. After sequencing verification of the correct sequence, three PVX viral vectors for AsCas12f gene segment expression were successfully constructed, named pPVX-nCas12f-InteinN (SEQ ID NO. 24), pPVX-InteinC-cCas12f-Linker (SEQ ID NO. 25) and pPVX-InteinC-cCas12f-RuvC.

[0079] (2) Gene editing efficiency

[0080] The above three Agrobacterium containing PVX vectors were injected into Nicotiana leaf pieces for gene editing efficiency detection, and the Agrobacterium injection method was the same as above. The three vectors were divided into two combinations, combination 1: pPVX-nCas12f-InteinN + pPVX-InteinC-cCas12f-Linker; combination 2: pPVX-nCas12f-InteinN + pPVX-InteinC-cCas12f-RuvC. The gene editing efficiency of the injection site was detected 7 days after injection, and the detection method was the same as above. The detection results show that the gene editing of the target gene is detected in combination 1 and combination 2, and the gene editing efficiency of combination 1 is significantly higher than that of combination 2 (P<0.05) Figure 6 ), indicating that the AsCas12f gene is formed by using the PVX vector to express the AsCas12f gene in segments, and the two fragments of the AsCas12f gene contain the Linker repeat sequence, which can improve the gene editing efficiency, and again indicating that the Linker repeat sequence plays an important role in the reassembly of the AsCas12f gene expressed in segments.

[0081] The above is only a preferred embodiment of the present application, and does not limit the present application in any form. Although the present application has been disclosed as above, it is not intended to limit the present application. Any person skilled in the art can make some changes or modifications to the above disclosed technical content without departing from the scope of the technical solution of the present application, and any brief introduction, modification, equivalent change and modification of the above embodiments made according to the technical essence of the present application are still within the scope of the technical solution of the present application.

Claims

1. A gene editing vector for segmental expression of AsCas12f gene, characterized in that, The gene editing vector is a plant virus vector, the gene editing vector utilizes plant virus to express gene editing elements nCas12f-InteinN expression frame and InteinC-cCas12f-Linker expression frame in segments, forms independently expressed gene editing vectors respectively containing nCas12f-InteinN expression frame and InteinC-cCas12f-Linker expression frame, the sequence of the nCas12f-InteinN expression frame is shown in SEQ ID NO. 1, the sequence of the InteinC-cCas12f-Linker expression frame is shown in SEQ ID NO. 2, wherein n in the sequence of SEQ ID NO. 2 is an editing site sequence of a target gene, the base number of n ranges from 15 to 25, the gene editing vector is obtained by the following steps: cloning the nCas12f-InteinN expression frame and the InteinC-cCas12f-Linker expression frame into a pNC-TRV2-OE vector or a PVX vector respectively.

2. The gene editing vector of claim 1, wherein, The gene editing vector is composed of the vectors shown in SEQ ID NO. 22 and SEQ ID NO. 23, or composed of the vectors shown in SEQ ID NO. 24 and SEQ ID NO.

25.

3. A method for constructing a plant virus-based gene editing vector, characterized by, The method is to clone gene editing elements AsCas12f and its gRNA in segments into a multiple cloning site of a plant virus vector, utilize plant virus to express gene editing elements AsCas12f and its gRNA in segments, form independently expressed gene editing vectors respectively containing nCas12f-InteinN expression frame and InteinC-cCas12f-Linker expression frame, the sequence of the nCas12f-InteinN expression frame is shown in SEQ ID NO. 1, the sequence of the InteinC-cCas12f-Linker expression frame is shown in SEQ ID NO. 2, wherein n in the sequence of SEQ ID NO. 2 is an editing site sequence of a target gene, the base number of n ranges from 15 to 25, the independently expressed gene editing vector is obtained by cloning the nCas12f-InteinN expression frame and the InteinC-cCas12f-Linker expression frame into a pNC-TRV2-OE vector or a PVX vector respectively.

4. A method of plant virus-mediated gene editing, characterized in that, The specific steps are: 1) utilize the gene editing vector of any one of claims 1-2 or the gene editing vector obtained by the method of claim 3 to transform Agrobacterium; 2) utilize the Agrobacterium containing the gene editing vector obtained in step 1) to infect a target plant, the target plant is tobacco.

5. A kit characterized in that, The kit comprises a pNC-TRV2-OE vector, an nCas12f-InteinN expression frame and an InteinC-cCas12f-Linker expression frame, and further comprises a reaction solution for constructing the vector, the sequence of the nCas12f-InteinN expression frame is shown as SEQ ID NO. 1, the sequence of the InteinC-cCas12f-Linker expression frame is shown as SEQ ID NO. 2, wherein n in the sequence of SEQ ID NO. 2 is an editing site sequence of a target gene, the base number of n ranges from 15 to 25, and the reaction solution is a Nimble Mix reaction solution.

6. A kit characterized in that, The kit comprises a PVX vector, an nCas12f-InteinN expression frame and an InteinC-cCas12f-Linker expression frame, and further comprises primers and a reaction solution for constructing the vector, the sequence of the nCas12f-InteinN expression frame is shown as SEQ ID NO. 1, the sequence of the InteinC-cCas12f-Linker expression frame is shown as SEQ ID NO. 2, wherein n in the sequence of SEQ ID NO. 2 is an editing site sequence of a target gene, the base number of n ranges from 15 to 25, and the reaction solution is a NEBuilder enzyme solution.

7. Application of the gene editing vector of any one of claims 1-2 in plant gene editing, wherein the plant is tobacco.

Images