Biosensor based on metal ion replacement and detection method

Abstract

The invention belongs to the technical field of biology, and discloses a biosensor based on metal ion replacement and a detection method. The sensor comprises a screen printing electrode (the surface of a working electrode of the screen printing electrode is sequentially modified with UiO-66-NH2, FcCOOH and PEI), a biological recognition assembly (comprising a dCas12a-crRNA compound), a metal ion labeling probe (comprising a plurality of QD-probes, the 5'end of each QD-probe is connected with a beta-PEA aptamer, and the 3 'end of each QD-probe is connected with an H sequence complementary with corresponding crRNA) and an auxiliary detection assembly (comprising SA-MBs and a probe). The invention also discloses a method for detecting various pathogens by using the sensor. The sensor is compact in structure and convenient to operate and has excellent specificity and sensitivity, molecular recognition and metal ion replacement driven electrochemical signal coding are combined, and a universal platform with great potential is provided for diagnosis of multiple infectious pathogens.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to biosensors and detection methods based on metal ion replacement. Background Technology

[0002] In clinical practice, mixed infections caused by multiple pathogens are common, especially in immunocompromised individuals, children, and the elderly. Diseases caused by different pathogens often present with highly similar clinical symptoms, making them difficult to distinguish. Therefore, developing convenient technologies that can accurately and simultaneously detect multiple pathogens is of great significance for improving the diagnostic efficiency of infectious diseases. Currently, the conventional method for multiplex pathogen detection is real-time quantitative polymerase chain reaction (RT-qPCR). RT-qPCR has high specificity and can achieve simultaneous detection of multiple pathogens; however, its sensitivity decreases at low viral loads, potentially leading to false negatives. Furthermore, multiplex RT-qPCR typically relies on structurally complex instruments, and the operation process is relatively cumbersome. Many advanced detection technologies, such as photoelectrochemical sensing, field-effect transistor-based sensing, and surface plasmon resonance, have been used to achieve simultaneous and high-precision analysis of multiple pathogens. However, these methods usually rely on multi-channel detection systems, making the overall operation process relatively complex and cumbersome. Therefore, there is an urgent need to develop novel detection strategies that can achieve high-precision multiplex pathogen detection under simple conditions. Summary of the Invention

[0003] The present invention aims to at least solve one of the technical problems existing in the prior art. To this end, the present invention proposes a metal ion replacement-based biosensor, which has a compact structure, is easy to operate, and has excellent specificity and sensitivity, and can simultaneously detect multiple pathogens.

[0004] This invention also proposes a method for detecting multiple pathogens using the aforementioned biosensor.

[0005] According to one aspect of the present invention, a biosensor based on metal ion replacement is provided, comprising a screen-printed electrode, a biometric component, a metal ion-labeled probe, and an auxiliary detection component; The screen-printed electrode includes a working electrode, the surface of which is sequentially modified with amino-functionalized UiO-66 (UiO-66-NH2), ferrocenecarboxylicacid (FcCOOH), and polyethyleneimine (PEI) to form a PEI / FcCOOH / UiO-66-NH2 modification layer; The biometric component includes a dCas12a-crRNA complex, wherein the crRNA is a specific sequence for different pathogens, and each pathogen corresponds to a different crRNA. The metal ion-labeled probes include a number of quantum dot probes (QD-probes), each QD-probe corresponding to a pathogen; each QD-probe has a β-phenylethylamine (β-PEA) aptamer attached to its 5' end and an H sequence complementary to the corresponding crRNA attached to its 3' end. The auxiliary detection component includes streptavidin-coated magnetic beads (SA-MBs) and a probe, wherein the probe is a complementary strand of the aptamer.

[0006] According to a preferred embodiment of the present invention, at least the following beneficial effects are achieved: RT-qPCR possesses high specificity, enabling simultaneous detection of multiple pathogens; however, its sensitivity decreases at low viral loads, potentially leading to false negatives. Furthermore, multiplex RT-qPCR typically relies on complex instruments and involves cumbersome procedures. Many advanced detection technologies, such as photoelectrochemical sensing, field-effect transistor-based sensing, and surface plasmon resonance, have been used for simultaneous and high-precision analysis of multiple pathogens. However, these methods usually depend on multi-channel detection systems, making the overall process relatively complex and cumbersome. Compared to current detection technologies, the metal ion replacement-based biosensor and its detection method constructed in this invention are compact, easy to operate, and possess excellent specificity and sensitivity. By combining molecular recognition with metal ion replacement-driven electrochemical signal encoding, it provides a highly promising universal platform for the diagnosis of multiple infectious pathogens, with broad application potential in early screening of infectious diseases and precision medicine.

[0007] Specifically, UiO-66-NH2, as an amino-functionalized metal-organic framework material, possesses abundant pore structure and a large specific surface area, which can increase the loading capacity of the electrode surface and provide sufficient sites for the subsequent immobilization of FcCOOH and biomolecules. The amino groups on its surface can chemically bind to the carboxyl groups of FcCOOH, achieving stable modification of FcCOOH on the electrode surface. As a metal-organic framework (MOF) material, its chemical stability and biocompatibility help protect the activity of biomolecules and maintain the detection performance of the sensor.

[0008] FcCOOH exhibits excellent redox activity, serving as an electron mediator to accelerate charge transfer, reduce the electron transport resistance of the electrode, and enhance the electrochemical response signal of the sensor. Furthermore, it forms stable covalent bonds through the reaction of its carboxyl group with the amino group of UiO-66-NH2.

[0009] PEI coating the working electrode surface can reduce non-specific adsorption, protect the active sites on the working electrode surface, and improve the specificity of detection; the amino groups abundant in its molecules are hydrophilic and conductive, which can further reduce electron transport resistance and enhance the electrochemical performance of the working electrode.

[0010] In some embodiments of the present invention, the substrate material of the working electrode is selected from at least one of reduced graphene oxide (rGO), carbon nanotubes, and graphene derivatives.

[0011] In some preferred embodiments of the present invention, the substrate material of the working electrode is rGO.

[0012] In some embodiments of the present invention, the working electrode is prepared as follows: UiO-66-NH2 solution, FcCOOH solution and PEI solution are sequentially added dropwise to the substrate surface of the working electrode to form a PEI / FcCOOH / UiO-66-NH2 modification layer, thereby obtaining the working electrode.

[0013] Specifically, the concentration of UiO-66-NH2 is 0.8~1.2 mg / mL.

[0014] Specifically, after adding the UiO-66-NH2 solution, the solution is dried at 4-6°C for 5-7 h.

[0015] Specifically, FcCOOH is dissolved in 2-(N-morpholino)ethanesulfonic acid (MES) buffer, and then mixed with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) and N-hydroxysuccinimide (NHS) to obtain the FcCOOH solution.

[0016] Specifically, the purpose of adding EDC and NHS here is to activate the carboxyl group of FcCOOH.

[0017] Specifically, after adding the FcCOOH solution, incubate for 1.5 to 2.5 hours.

[0018] Specifically, the concentration of the PEI solution is 0.8~1.2 mg / mL.

[0019] In some embodiments of the present invention, the dCas12a-crRNA complex is used to bind to the biotin-labeled recombinase polymerase amplification (RPA) product of the pathogen.

[0020] In some embodiments of the present invention, the H sequence of the QD-probes hybridizes with a non-target DNA sequence in the biotin-labeled RPA product of the pathogen to replace the original target DNA sequence.

[0021] In some embodiments of the present invention, the QD in the QD-probes is selected from any one of ZnS, PbS, CdS, CuS, Ag2S, Bi2S3, Sb2S3, In2S3, and SnS.

[0022] Specifically, the QDs in each QD-probe are different for each pathogen.

[0023] In some embodiments of the present invention, the aptamer can specifically bind to β-PEA modified on the QD surface.

[0024] In some embodiments of the present invention, the preparation method of the QD-probes includes the following steps: mixing carboxylated QD with MES buffer, then adding β-PEA solution, incubating, centrifuging, and resuspending the precipitate; adding the corresponding probe solution, incubating, centrifuging, and resuspending the precipitate to obtain the QD-probes.

[0025] Specifically, the concentration of the carboxylated QD is 0.4~0.6 mg / mL.

[0026] Specifically, the concentration of the MES buffer is 90-110 mM and the pH is 6.2-6.4; the MES buffer contains 18-22 mM of EDC and 8-12 mM of NHS.

[0027] Specifically, the carboxylated QD is mixed with MES buffer and incubated at room temperature for 50-70 min to activate the carboxyl group.

[0028] Specifically, the concentration of the β-PEA solution is 90~110 μM.

[0029] Specifically, after adding the β-PEA solution, incubate for 1.5 to 2.5 h; then centrifuge at 10,000 to 12,000 rpm for 8 to 12 min at 3 to 5 °C, discard the supernatant, and resuspend the precipitate with Tris-Tween-LiCl (TTL) buffer.

[0030] Specifically, the TTL buffer solution comprises 80-120 mM Tris-HCl (pH 7.3-7.5), 0.8-1.2 M LiCl, and 0.1% Tween-20.

[0031] Specifically, the concentration of the probe solution is 90~110 μM, and the solution is prepared with TTL buffer.

[0032] Specifically, after adding the corresponding probe solution, incubate at 36~38℃ for 25~35 min; then centrifuge at 10000~12000 rpm for 8~12 min, remove the supernatant, and resuspend the precipitate with TTL buffer.

[0033] Specifically, the obtained QD-probes are mixed in equal volumes to prepare the metal ion-labeled probe, which is then used for subsequent electrochemical detection.

[0034] In some embodiments of the present invention, the SA-MBs are used to separate the biotin-labeled RPA products of each pathogen from the complexes formed by the corresponding dCas12a-crRNA and the corresponding QD-probe.

[0035] In some embodiments of the present invention, the probe is used to bind to the β-PEA aptamer of the QD-probes to displace and release the QD, thereby detecting the metal ions in the QD after magnetic separation.

[0036] According to another aspect of the present invention, a method for detecting multiple pathogens using the above-described biosensor is proposed, wherein the detection is for non-disease diagnosis or treatment purposes, and includes the following steps: S1: The biotin-labeled RPA products of each pathogen are bound to the dCas12a-crRNA complex; S2: Add QD-probes, and hybridize the H sequence of the QD-probes with the non-target single-stranded DNA in the biotin-labeled RPA product of the pathogen to form a complex; S3: Separate the complex described in step S2 using SA-MBs, then add probes for incubation to displace and release each QD; S4: Detect the dissolution peak current of metal ions in each QD on the working electrode of the biosensor, thereby achieving simultaneous detection of each pathogen.

[0037] In some embodiments of the present invention, step S1 involves mixing the biotin-labeled RPA products of each pathogen with each crRNA at a concentration of 0.8-1.2 μM and dCas12a protein at a concentration of 0.8-1.2 μM, and incubating at 36-38°C for 25-35 min.

[0038] In some embodiments of the present invention, after adding the QD-probes in step S2, the incubation period is 25-35 minutes.

[0039] In some embodiments of the present invention, the concentration of the SA-MBs is 8~12 mg / mL.

[0040] In some embodiments of the present invention, after adding the SA-MBs in step S3, the incubation is carried out for 25 to 35 minutes; after adding 0.8 to 1.2 μM of the probe, the incubation is carried out at 36 to 38°C for 25 to 35 minutes to replace and release each QD.

[0041] In some embodiments of the present invention, step S3, after replacing and releasing each QD, further includes the steps of magnetic separation and centrifugation.

[0042] In some embodiments of the present invention, the method for detecting the dissolution peak current of metal ions in each QD in step S4 is as follows: the QD obtained in step S3 is mixed with 0.8~1.2 M nitric acid (HNO3) solution for 2~4 min, then added to 0.08~0.12 M acetate buffer electrolyte with pH 4.9~5.1, and then dropped onto the surface of the working electrode. Each metal ion is enriched at a voltage of -1.3~-1.5 V. After enrichment, a square-wave anodic stripping voltammetry (SWASV) scan is performed at a voltage of -1.2~+0.1 V to determine the dissolution peak current of each metal ion.

[0043] In some embodiments of the present invention, the scanning pulse amplitude is 20~30 mV, the scanning rate is 3~5 mV / s, and the frequency is 20~30 Hz. Attached Figure Description

[0044] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 This is a schematic diagram illustrating the principle of using a metal ion replacement-based biosensor to detect dengue virus (DENV) in a specific embodiment of the present invention. Figure 2 This is a graph showing the electrochemical impedance analysis results during the assembly process of the screen-printed electrode of the biosensor in Example 1 of the present invention; Figure 3 This is a graph showing the SWASV response of the multiplex detection method at different target DNA concentrations in Example 2 of the present invention, and the correlation analysis results of the dissolution peak current of different target DNAs with their concentration logarithms. A represents the SWASV response results of the multiplex detection method at different target DNA concentrations (a: 0; b: 100 aM; c: 1 fM; d: 10 fM; e: 100 fM; f: 1 pM and g: 10 pM); B, C, D, and E represent the correlation analysis results of the dissolution peak current of D1-NS5-amp, D2-E-amp, D3-prM-amp, and D4-prM-amp with their concentration logarithms, respectively. Figure 4 The diagram shows the SWASV response results in Example 3 of this invention under the following conditions: no amplification product, simultaneous presence of four amplification products, or presence of only one amplification product. A represents the SWASV response under no amplification product condition; B represents the SWASV response when all four amplification products are present; C represents the SWASV response when only D1-NS5-amp is present; D represents the SWASV response when only D2-E-amp is present; E represents the SWASV response when only D3-prM-amp is present; and F represents the SWASV response when only D4-prM-amp is present. Figure 5 The diagram shows the SWASV response analysis results of single base mutations in (A) D1-NS5, (B) D2-E, (C) D3-prM and (D) D4-prM in Example 3 of the present invention. Figure 6 The biosensor in Embodiment 4 of this invention is based on a solution containing 5 mM of [Fe(CN)6]. 3- / 4-The graph shows 10 consecutive cyclic voltammetry (CV) scans performed in 0.1 M KCl phosphate-buffered saline (PBS) (0.1 M, pH 7.4); where n=10. Figure 7 The graph shows the changes in peak current response when detecting (A) D1-NS5-amp, (B) D2-E-amp, (C) D3-prM-amp and (D) D4-prM-amp under different storage times in Embodiment 4 of the present invention. Figure 8 The peak current response results are shown in Example 5 of this invention when the same batch of biosensors were used to detect (A) D1-NS5-amp, (B) D2-E-amp, (C) D3-prM-amp and (D) D4-prM-amp. Detailed Implementation

[0045] The following will describe the concept and technical effects of the present invention clearly and completely with reference to the embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention. Unless otherwise specified, the experimental methods used in the embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0046] This invention develops an innovative metal ion displacement detection method for the simultaneous detection of multiple pathogens. Since multiple serotypes often coexist in endemic areas, and their early infection stages are difficult to distinguish clinically, the following uses each DENV serotype (DENV-1 to DENV-4) as representative detection targets. Specific fragments of NS5, E, prM, and prM from each DENV serotype (DENV-1, DENV-2, DENV-3, and DENV-4) were selected as detection targets and named D1-NS5, D2-E, D3-prM, and D4-prM, respectively. Figure 1As shown, the biosensor used in this method has a single working electrode, and its rGO substrate is sequentially modified with UiO-66-NH2, FcCOOH, and PEI. The constructed QD-probes are used to replace the target sequence. Each QD-probe has a β-PEA aptamer attached to its 5' end and an H sequence complementary to the crRNA attached to its 3' end. The aptamer specifically binds to the β-PEA modified on the QD surface. In the presence of DENV, its biotin-labeled RPA products (D1-NS5-amp, D2-E-amp, D3-prM-amp, and D4-prM-amp) bind to the corresponding dCas12a-crRNA complexes. Subsequently, non-target single-stranded DNA hybridizes with the H sequence in the QD-probes, replacing the original target sequence. The resulting complex is separated using SA-MBs. After incubation with probe 5 (the aptamer's complementary strand), the QD is replaced and released. After magnetic separation, the metal ions in the released QD are detected by SWASV. This method achieves simultaneous detection of various DENV serotypes by analyzing the dissolution peak currents of different metal ions. This multiplex detection strategy maintains high accuracy while offering ease of operation, demonstrating excellent performance in clinical sample analysis. This invention proposes a novel nucleic acid detection paradigm that combines molecular recognition with metal ion displacement-driven electrochemical signal encoding, providing a highly promising universal platform for the diagnosis of multiple infectious pathogens and possessing broad application prospects.

[0047] The following examples illustrate this in detail.

[0048] Example 1 This embodiment assembles a screen-printed electrode for a biosensor based on metal ion replacement. The specific process is as follows: The biosensor constructed in this embodiment uses a commercially available screen-printed electrode, with the working electrode substrate being vertically aligned rGO. Before assembly, the screen-printed electrode needs to be thoroughly cleaned with ultrapure water and ethanol to remove surface impurities. First, a UiO-66-NH2 suspension (1 mg / mL, 1.5 μL) was added dropwise to the surface of the vertically aligned rGO electrode and dried at 4 °C for 6 h to obtain the UiO-66-NH2 / rGO electrode. Subsequently, FcCOOH (9 mg) was dissolved in MES buffer (100 mM, pH 6.3, 6 mL), and EDC (38.35 mg) and NHS (5.75 mg) were added, and the mixture was stirred for 30 min to activate the carboxyl groups of FcCOOH. This mixture was then added dropwise to the electrode surface and incubated for 2 h. After incubation, the electrode surface was washed with PBS to obtain the FcCOOH / UiO-66-NH2 / rGO electrode. Subsequently, PEI solution (1 mg / mL, 2.5 μL) was added dropwise to the electrode surface to protect it. The final PEI / FcCOOH / UiO-66-NH2 / rGO electrode was stored at 4 °C for subsequent analysis.

[0049] The stepwise assembly process of the constructed biosensor was validated using electrochemical impedance spectroscopy (EIS). In the Nyquist plot, the diameter of the semicircle reflects the electron transfer resistance (Ro). et The size of ). For example Figure 2 As shown, the rGO electrode exhibits an almost linear response curve (curve a), indicating its excellent electrochemical conductivity. However, when UiO-66-NH2 is modified onto the surface of the rGO electrode, R... et The conductivity increased significantly (curve b), which is attributed to the low conductivity of the MOF itself. Subsequently, after introducing FcCOOH onto the UiO-66-NH2 / rGO electrode, R... et The conductivity decreased significantly (curve c) because FcCOOH has good redox activity, which can introduce charge transfer sites into the porous structure of UiO-66-NH2, thereby reducing the charge injection barrier and improving conductivity. Furthermore, the introduction of PEI further improved R... et The continued decrease in PEI (curve d) is likely due to the abundance of primary amine groups in PEI facilitating electron transport. These results demonstrate that the biosensor was successfully constructed.

[0050] Example 2 This embodiment tested the sensitivity of the biosensor assembled in Example 1.

[0051] The potential of the biosensor assembled in Example 1 to detect DENV was explored under the constructed experimental conditions. The detection principle and procedure are as follows: Figure 1 As shown. The specific detection method is as follows: The probes used below (Probe 1 to Probe 4 are four types of QD-Probes, and Probe 5 is the complementary strand of the aptamer): Probe 1, its nucleic acid sequence is shown in SEQ ID NO:1: ACGGTAGGGAGCATCAAACTTCAGAGTTTGAACGTTGAAGATGACCTAGTCCGATGACGTAAACCAAGGGCTTCAAACTC; Probe 2, its nucleic acid sequence is shown in SEQ ID NO:2: ACGGTAGGGAGCATCAAACTTCAGAGTTTGAACGTTGAAGATGACCTAGTCCGATGACGTAGATGGTGTTGCTGCAGATG; Probe 3, its nucleic acid sequence is shown in SEQ ID NO:3: ACGGTAGGGAGCATCAAACTTCAGAGTTTGAACGTTGAAGATGACCTAGTCCGATGACGTAGTGCCTATGTAATGGGCGA; Probe 4, its nucleic acid sequence is shown in SEQ ID NO:2: ACGGTAGGGAGCATCAAACTTCAGAGTTTGAACGTTGAAGATGACCTAGTCCGATGACGTAGTGCCTATGTAATGGGCGA; Probe 4, its nucleic acid sequence is shown in SEQ ID NO:2: ACGGTAGGGAGCATCAAACTTCAGAGTTTGAACGTTGAAGATGACCTAGTCCGATGACGTAGTGCCTATGTAATGGGCGA. ID No:4: ACGGTAGGGAGCATCAAACTTCAGAGTTTGAACGTTGAAGATGACCTAGTCCGATGACGTTTGCCCAATCATATAAGCCA; Probe 5, whose nucleic acid sequence is shown in SEQ ID NO:5: CTTCAACGTTCAAACTCTGAAGTTTGATGCTCCCTACCGT.

[0052] The crRNA sequence used (5'→3') is: crRNA D1-NS5 Its nucleic acid sequence is shown in SEQ ID NO:6: UAAUUUCUACUAAGUGUAGUGAGUUUGAAGCCCUUGGUUU; crRNA D2-E Its nucleic acid sequence is shown in SEQ ID NO:7: UAAUUUCUACUAAGUGUAGUCAUCUGCAGCAACACCAUCU; crRNA D3-prM Its nucleic acid sequence is shown in SEQ ID NO:8: UAAUUUCUACUAAGUGUAGUUCGCCCAUUACAUAGGCACU; crRNA D4-prMIts nucleic acid sequence is shown in SEQ ID NO:9: UAAUUUCUACUAAGUGUAGUUGGCUUAUAUGAUUGGGCAA.

[0053] The RPA primer sequence used (5'→3') is: Forward (D1-NS5): Biotin-AGAGTTTCGGAAAGGCAAAAGGAAGTCGCGCA (SEQ ID NO:10); Reverse (D1-NS5): TCTCTGCTGAACCAGTGATCTTCATTCATGA (SEQ ID NO:11); Forward (D2-E): Biotin-GGAGTGCTCTCCAAGAACGGGCCTCGACTTC (SEQ ID NO:12); Reverse (D2-E): TCTCTGCTGAACCAGTGATCTTCATTCATGA (SEQ ID NO:13); Forward (D3-prM): Biotin-AGACAAGTCGAGAAGGTAGAGACATGGGCCCTT (SEQ ID NO:14); Reverse (D3-prM): GGAAGTGCCTAGTAATGGGCGAGAAATAGGGC (SEQ ID NO:15); Forward (D4-prM): Biotin-AGGATTTATGGCTTATATGATTGGGCAAACA (SEQ ID NO:16); Reverse (D4-prM): CATCGCATTCCGTAGGATGGGGCGACCAGCA (SEQ ID NO:17); The gene fragment sequence (5'→3') used for DENV detection is: D1-NS5, whose nucleic acid sequence is as shown in SEQ ID NO: 18: GAGAGAAAAAAATTAGGAGAGTTCGGAAAGGCAAAAGGAAGTCGCGCAATATGGTACATGTGGTTGGGAGCGCGCTTTTTAGAGTTTGAAGCCCTTGGTTTCATGAATGAAGATCACTGGTTCAGCAGAGAGAATTCACTCAGTGGAGTGGAAGGAGAAGGACTCCACAAACTTGGATACATA; D2-E, whose nucleic acid sequence is as shown in SEQ ID NO:19: CATGCAGTCGGAAATGACACAGGAAAACATGGCAAGGAAATCAAAATAACACCACAGAGTTCCATCACAGAAGCAGAATTGACAGGTTATGGCACTGTCACAATGGAGTGCTCTCCAAGAACGGGCCTCGACTTCAATGAGATGGTGTTGCTGCAGATGGAAAATAAAGCTTGGCTGGTGCACAGGCAATGGTTCCTAGACCTGCCG; D3-prM, whose nucleic acid sequence is as shown in SEQ ID NO:20: GGACTGGACACACGCACCCAAACCTGGATGTCGGCTGAAGGAGCTTGGAGACAAGTCGAGAAGGTAGAGACATGGGCCCTTAGGCACCCAGGGTTCACCATACTAGCCCTATTTCTCGCCCATTACATAGGCACTTCCCTGACCCAGAAGGTGGTTATTTTCATATTATTAAT; D4-prM, whose nucleic acid sequence is as shown in SEQ ID NO:21: ACCCAGGATTCGCGCTCTTGGCAGGATTTATGGCTTATATGATTGGGCAAACAGGAATCCAGCGAACTGTCTTCTTTGTCCTAATGATGCTGGTCGCCCCATCCTACGGAATGCGATGCGTAGGAGTAGGAAACAGAGACTTTGTGGAAGGAGTCTCAGGTGGAGCATGGGTCGACCTGGTGCTAGAACATGGAGGATGCGTCACAACCATGGCCCAGGGAAAACCAACCTTGGATTTTGAACTGACTAAGACAACAGCCAAGGAAGTGGCTCTGT;

[0054] (1) Four different QD-probes (ZnS QD-probe 1, CdS QD-probe 2, PbS QD-probe 3, and CuS QD-probe 4) were designed to specifically bind to non-target single-stranded sequences in their respective dCas12a-crRNA-target DNA complexes. All four QD-probes were prepared using the same method. First, 100 μL of carboxylated QD suspension (0.5 mg / mL) was added to 900 μL of MES buffer (100 mM, pH 6.3) containing 20 mM EDC and 10 mM NHS, and incubated at room temperature for 60 min to activate the carboxyl groups. Subsequently, 20 μL of β-PEA solution (100 μM) was added to the QD suspension, and incubation continued for 2 h. After the reaction was complete, the sample was centrifuged at 12,000 rpm for 10 min at 4 °C, the supernatant was discarded, and the precipitate was resuspended in 50 μL of TTL buffer (formulation: 100 mM Tris-HCl, pH 7.4, 1 M LiCl, 0.1% Tween 20). Next, 10 μL of the corresponding probe solution (100 μM, prepared with TTL buffer) was added, and the sample was incubated at 37 °C for 30 min. The sample was centrifuged again (12,000 rpm, 10 min), the supernatant was discarded, and the precipitate was resuspended in 50 μL of TTL buffer. Finally, equal volumes of the four QD probe suspensions were mixed for subsequent electrochemical detection.

[0055] (2) Add 1 μM crRNA D1-NS5 crRNA D2-E crRNA D3-prM and crRNA D4-prM1 μL of 1 μM dCas12a protein, 4 μL of 1 μM dCas12a protein, 20 μL of 10× reaction buffer, and 2 μL of RPA product were added to 170 μL of DEPC water. This mixture was incubated at 37°C for 30 min to promote the formation of the dCas12a-crRNA-target DNA complex. After incubation, 2 μL of QD-probe suspension was added to the mixture, and incubation continued for another 30 min. Subsequently, 5 μL of 10 mg / mL SA-MBs were suspended in 30 μL of TTL buffer (formulation: 100 mM Tris-HCl, pH 7.4, 1 M LiCl, 0.1% Tween 20). This magnetic bead suspension was added to the reaction system, mixed, and incubated for 30 min. After magnetic separation, the magnetic beads were washed twice with Tris-Tween (TT) buffer (95 μL; 250 mM Tris-HCl, pH 7.4, 0.1% Tween 20), and then resuspended in 50 μL of TTL buffer. Next, 5 μL of 1 μM probe 5 solution was added, and the mixture was incubated at 37°C for 30 min to displace and release the QDs. After another magnetic separation, the resulting QD suspension was centrifuged (12000 rpm, 15 min), and the supernatant was discarded. The precipitate was resuspended in 500 μL of ultrapure water by sonication, followed by another centrifugation (12000 rpm, 10 min), and the supernatant was discarded. After repeating the washing step once more, the final QDs were thoroughly mixed with 10 μL of 1 M nitric acid (HNO3) solution. After mixing for 3 min, the HNO3 solution was added to the acetate buffer (0.1 M, 1 mL, pH 5) electrolyte and dropped onto the electrode surface to enrich Zn at −1.4 V. 2+ Cd 2+ Pb 2+ and Cu 2+ Ions were enriched for 120 s. After enrichment, a SWASV scan was performed within a voltage range of −1.2 V to +0.1 V, and the voltammetric curve was recorded. The pulse amplitude was set to 25 mV, the scan rate to 4 mV / s, and the frequency to 25 Hz.

[0056] Under optimized conditions, the performance of the developed electrochemical method in DENV detection was evaluated by measuring the peak current response corresponding to different concentrations of amplified products. Notably, the dissolution peak current showed an increasing trend with increasing amplified product concentration. Figure 3 The change in dissolution peak current (ΔI) showed a good linear correlation with the logarithm of the amplified product concentration in the concentration range of 100 aM to 10 pM. Figure 3 (B–E).

[0057] ΔI = I − I0 Where I represents the dissolution peak current in the presence of the target analyte, and I0 represents the dissolution peak current in the absence of the target analyte. The linear regression equations for each target are as follows: ΔI (D1-NS5-amp) = 183.25LgC (D1-NS5-amp) +3092.54 ΔI (D2-E-amp) = 397.81LgC (D2-E-amp) + 6730.75 ΔI (D3-prM-amp) = 475.19LgC (D3-prM-amp) +8042.22 ΔI (D4-prM-amp) = 265.36LgC (D4-prM-amp) + 4472.69 Furthermore, the detection limits for D1-NS5-amp, D2-E-amp, D3-prM-amp, and D4-prM-amp were calculated to be 15.08, 13.11, 12.80, and 15.87 aM, respectively, using the 3σ / k method. Compared with current advanced detection techniques, the proposed method exhibits extremely high sensitivity, fully demonstrating its superior analytical performance.

[0058] Example 3 This embodiment tested the specificity of the biosensor assembled in Example 1. The specific process is as follows: Based on the biosensor assembled in Example 1 and the detection method in Example 2, systematic tests were conducted under predetermined experimental conditions on the presence of D1-NS5-amp, D2-E-amp, D3-prM-amp, and D4-prM-amp individually and in combination. Based on the statistical characteristics of the blank signal (i.e., the mean of the blank signal plus three standard deviations), the detection thresholds for D1-NS5-amp, D2-E-amp, D3-prM-amp, and D4-prM-amp were determined to be 27.77, 43.95, 54.56, and 38.68 nA, respectively. Without the addition of amplification products, the dissolution peak current at each potential was lower than the corresponding detection threshold (…). Figure 4 (A). Conversely, when all four amplification products were present or present alone, the corresponding dissolution peak currents all increased significantly (A). Figure 4 (B–F). When only one amplification product is present, the dissolution peak currents corresponding to the other three amplification products are still lower than their respective detection thresholds (B–F). Figure 4 The C–F ratio indicates that this method has extremely high selectivity. Furthermore, the method's ability to distinguish single-base mutations was evaluated. The results show that single-base mutations can significantly reduce the peak current response (C–F). Figure 5The signal intensities of the A–D samples were all below the detection threshold. These results further validate the excellent specificity of the developed multiplex detection method, highlighting its potential for application in precise molecular recognition.

[0059] Example 4 This embodiment tested the stability of the biosensor assembled in Example 1. The specific process is as follows: The signal stability of the biosensor was studied based on the biosensor assembled in Example 1 and the detection method in Example 2. For example... Figure 6 As shown, after 10 consecutive scans, the obtained CV curves highly overlapped, and the peak potential and peak current showed no significant changes, clearly indicating that the sensor has excellent electrochemical stability. To further evaluate its long-term stability, the sensor was stored at 4°C and tested every 7 days. After 21 days of storage, the sensor retained 90.80%, 90.62%, 90.31%, and 90.82% of the initial values ​​for the detection signals of D1-NS5-amp, D2-E-amp, D3-prM-amp, and D4-prM-amp, respectively. Figure 7 The A–D values ​​show good storage stability.

[0060] Example 5 This embodiment tested the reproducibility of the biosensor assembled in Example 1. The specific process is as follows: Based on the biosensor assembled in Example 1 and the detection method in Example 2, the repeatability was examined by testing six independently assembled sensors (see Example 2). Figure 8 The relative standard deviations (RSDs) of the peak current signals of D1-NS5-amp, D2-E-amp, D3-prM-amp, and D4-prM-amp were 2.97%, 2.15%, 2.22%, and 2.08%, respectively, further confirming the excellent repeatability and reliability of this biosensor in multiplex detection.

[0061] The embodiments of the present invention have been described in detail above. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. A biosensor based on metal ion replacement, characterized in that, The biosensor includes a screen-printed electrode, a biometric component, a metal ion-labeled probe, and an auxiliary detection component; The screen-printed electrode includes a working electrode, the surface of which is sequentially modified with UiO-66-NH2, FcCOOH and PEI to form a PEI / FcCOOH / UiO-66-NH2 modification layer. The biometric component includes a dCas12a-crRNA complex, wherein the crRNA is a specific sequence for different pathogens, and each pathogen corresponds to a different crRNA. The metal ion-labeled probes include several QD-probes, each QD-probe corresponding to a pathogen; the 5' end of each QD-probe is connected to a β-PEA aptamer, and the 3' end is connected to an H sequence complementary to the corresponding crRNA; The auxiliary detection component includes SA-MBs and a probe, wherein the probe is a complementary strand of an aptamer.

2. The biosensor according to claim 1, characterized in that, The substrate material of the working electrode is selected from at least one of rGO, carbon nanotubes, and graphene derivatives; Preferably, the working electrode is prepared as follows: UiO-66-NH2 solution, FcCOOH solution and PEI solution are sequentially added dropwise to the substrate surface of the working electrode to form a PEI / FcCOOH / UiO-66-NH2 modification layer, thereby obtaining the working electrode.

3. The biosensor according to claim 1, characterized in that, The dCas12a-crRNA complex is used to bind to the biotin-labeled RPA product of the pathogen; Preferably, the H sequence of the QD-probes hybridizes with the non-target DNA sequence in the biotin-labeled RPA product of the pathogen to replace the original target DNA sequence.

4. The biosensor according to claim 1, characterized in that, The QD in the QD-probes is selected from any one of ZnS, PbS, CdS, CuS, Ag2S, Bi2S3, Sb2S3, In2S3, and SnS; Preferably, the QDs in each QD-probe corresponding to each pathogen are different; Preferably, the preparation method of the QD-probes includes the following steps: mixing carboxylated QD with MES buffer, then adding β-PEA solution, incubating, centrifuging, and resuspending the precipitate; adding the corresponding probe solution, incubating, centrifuging, and resuspending the precipitate to obtain the QD-probes; Preferably, the metal ion-labeled probe is prepared by mixing equal volumes of the obtained QD-probes and then using it for subsequent electrochemical detection.

5. The biosensor according to claim 1, characterized in that, The SA-MBs are used to separate the biotin-labeled RPA products of each pathogen from the complexes formed by the corresponding dCas12a-crRNA and the corresponding QD-probe.

6. The biosensor according to claim 1, characterized in that, The probe is used to bind to the β-PEA aptamer of the QD-probes to displace and release the QD, thereby detecting the metal ions in the QD after magnetic separation.

7. A method for detecting multiple pathogens using the biosensor according to any one of claims 1 to 6, characterized in that, The test is for non-disease diagnosis and treatment purposes, and includes the following steps: S1: The biotin-labeled RPA products of each pathogen are bound to the dCas12a-crRNA complex; S2: Add QD-probes, and hybridize the H sequence of the QD-probes with the non-target single-stranded DNA in the biotin-labeled RPA product of the pathogen to form a complex; S3: Separate the complex described in step S2 using SA-MBs, then add probes for incubation to displace and release each QD; S4: Detect the dissolution peak current of metal ions in each QD on the working electrode of the biosensor, thereby achieving simultaneous detection of each pathogen.

8. The method according to claim 7, characterized in that, In step S1, the biotin-labeled RPA products of each pathogen are mixed with each crRNA at a concentration of 0.8–1.2 μM and dCas12a protein at a concentration of 0.8–1.2 μM, and incubated at 36–38 °C for 25–35 min.

9. The method according to claim 7, characterized in that, After adding the SA-MBs in step S3, incubate for 25-35 min; after adding 0.8-1.2 μM of the probe, incubate at 36-38℃ for 25-35 min to replace and release each QD. Preferably, step S3, after replacing and releasing each QD, further includes magnetic separation and centrifugation.

10. The method according to claim 7, characterized in that, The method for detecting the dissolution peak current of metal ions in each QD in step S4 is as follows: The QD obtained in step S3 is mixed with 0.8~1.2 M HNO3 solution for 2~4 min, then added to 0.08~0.12 M acetate buffer electrolyte with pH 4.9~5.1, and then dropped onto the surface of the working electrode. Each metal ion is enriched at a voltage of -1.3~-1.5 V. After enrichment, a SWASV scan is performed at a voltage of -1.2~+0.1 V to determine the dissolution peak current of each metal ion. Preferably, the scanning pulse amplitude is 20~30 mV, the scanning rate is 3~5 mV / s, and the frequency is 20~30 Hz.

Images