Interference RNA for inhibiting JAK1 gene expression and application thereof

Abstract

The invention provides interfering RNA (Ribonucleic Acid) targeting Janus kinase 1 (JAK1), and the interfering RNA can reduce the expression of JAK1 and further inhibit the activation of a JAK / STAT (JavaScript Association Protein) signal channel, so that the purpose of treating related diseases caused by disorder of the JAK / STAT signal channel is achieved. The invention further provides a lipid nanoparticle drug containing the interfering RNA, and the lipid nanoparticle drug is used for treating related diseases of JAK / STAT signal channel disorder. The invention also provides an antibody-nucleic acid coupled drug, which contains interfering RNA and is used for treating related diseases of JAK / STAT signal pathway disorder.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and biomedicine, specifically to an interfering RNA, particularly siRNA, that inhibits JAK1 gene expression, and its applications. Background Technology

[0002] The JAK / STAT signaling pathway is involved in cellular responses to various cytokines and growth factors, and its earliest discovery originated from research on interferon (IFN). The JAK / STAT pathway mainly consists of three parts: receptors, Janus kinases (JAKs), and signal transduction and transcription activators (STATs). Many cytokine receptors lack intrinsic kinase activity and require intermediates, including tyrosine kinases, to help transmit downstream signals, such as JAKs. JAKs belong to the non-receptor protein tyrosine kinase family, including four members: JAK1, JAK2, JAK3, and TYK2. They possess seven JAK homology domains (JHs), among which the C-terminal JH1 domain is the kinase domain, playing a major catalytic role, while the N-terminal FERM (Band-4.1, ezrin, radixin, moesin) domain is mainly responsible for receptor binding. The classic JAK / STAT signaling activation process involves the following steps: the interaction between cytokines and the extracellular region of the receptor causes receptor dimerization. This dimerization promotes the phosphorylation of conserved tyrosine residues in the phosphorylation kinase domains of the two JAKs bound to the receptor. Subsequently, activated JAKs recruit and phosphorylate STATs. The phosphorylated STATs form dimers, which enter the nucleus and promote gene expression. Currently, more than 50 cytokines and growth factors have been identified that can activate the JAK / STAT signaling pathway, including hormones, interferons, interleukins, and colony-stimulating factors. The downstream events mediated by JAK / STAT vary, including hematopoiesis, immune adaptation, tissue repair, inflammation, apoptosis, and adipogenesis.

[0003] Dysregulation of the JAK / STAT signaling pathway is often associated with disease, such as JAK2. V617FMutations are common in myeloproliferative disorders, and JAK / STAT often mediates abnormally elevated cytokines, inducing gene transcription. Therefore, treatment regimens using JAK inhibitors (JAKi) have gradually become a focus. In 2011, the U.S. Food and Drug Administration (FDA) approved the JAK inhibitor ruxolitinib (Novartis) for the treatment of myelofibrosis. Subsequently, more JAK inhibitors were approved for marketing, including Pfizer's tofacitinib, Eli Lilly's baricitinib, and AbbVie's upadacitinib, with indications including rheumatoid arthritis, ulcerative colitis, atopic dermatitis, psoriasis, and psoriatic arthritis. Furthermore, studies have found that alopecia areata (AA) is related to the JAK / STAT signaling pathway, and JAK inhibitor treatment can regrow hair in patients with severe alopecia areata (Luzhou Xing, 2014; Brittany G Craiglow, 2014). In 2022, the FDA also approved baricitinib for the treatment of adult patients with severe alopecia areata.

[0004] Currently available JAK inhibitors are all small molecule drugs. First-generation inhibitors have low selectivity for members of the JAK family, and this general inhibition of JAKs can lead to various side effects. Second-generation inhibitors, while showing some selectivity for specific JAKs, require frequent dosing. Small interfering RNA (siRNA) is an RNA fragment approximately 20 nt in length. In vivo, siRNA can participate in the formation of the RISC (RNA-induced silencing complex), targeting specific mRNAs through base pairing and causing their degradation, thereby inhibiting protein expression. Compared to small molecule drugs, siRNA drugs can significantly reduce the frequency of dosing. For example, Leqvio (Novartis), used to treat primary hypercholesterolemia or mixed dyslipidemia in adults, can be administered as frequently as once every six months.

[0005] Therefore, designing siRNA drugs targeting JAK1 can solve the specificity problem and improve patient adherence. This application uses small interfering RNA to silence the expression levels of JAK1 family members for the treatment of JAK / STAT-related diseases, such as autoimmune diseases. Summary of the Invention

[0006] In a first aspect, the present invention provides an interfering RNA that targets Janus kinase 1 (JAK1).

[0007] The interfering RNA inhibits the expression of JAK1, specifically the expression of the JAK1 gene, mRNA, and / or protein.

[0008] The target site sequence of the interfering RNA comprises one or more nucleotide sequences shown in SEQ ID NO: 1-14. Preferably, the target site sequence of the interfering RNA is shown as any one nucleotide sequence in SEQ ID NO: 1-14.

[0009] The interfering RNA includes one or more of siRNA, dsRNA, shRNA, aiRNA, or miRNA.

[0010] In one specific embodiment of the present invention, the interfering RNA is siRNA.

[0011] The interfering RNA also includes suspending bases to increase its stability and activity.

[0012] Preferably, the interfering RNA contains 1-10 dangling bases. More preferably, it contains 2-4 dangling bases. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 dangling bases.

[0013] The dangling base is located at the 3' end of the sense and / or antisense strands of the interfering RNA.

[0014] The suspended base is a deoxynucleoside; preferably, the suspended base can be n identical or different nucleosides (e.g., deoxythymidine (dT), deoxycytidine (dC), deoxyuridine (dU), uridine (U), guanosine (G), etc.), where n is an integer from 1 to 10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10).

[0015] In one specific embodiment of the present invention, the ends of the sense strand and / or antisense strand of the interfering RNA are provided with two identical dangling bases.

[0016] In one specific embodiment of the present invention, the ends of the sense strand and / or antisense strand of the interfering RNA are provided with two different dangling bases.

[0017] In one specific embodiment of the present invention, the suspended base is dTdT, UU, or UG.

[0018] Preferably, the suspended base is dTdT.

[0019] In one specific embodiment of the present invention, the interfering RNA comprises a sense strand and / or an antisense strand.

[0020] Preferably, the justice chain and the antisense chain are complementary pairs.

[0021] Preferably, the positive strand comprises one or more nucleotide sequences shown in SEQ ID NO: 15-28. More preferably, the positive strand is shown as any one nucleotide sequence in SEQ ID NO: 15-28.

[0022] Preferably, the antisense strand comprises one or more nucleotide sequences shown in SEQ ID NO: 29-42. More preferably, the antisense strand is shown as any one nucleotide sequence in SEQ ID NO: 29-42.

[0023] In one specific embodiment of the present invention, the interfering RNA comprises the nucleic acid sequences shown in Table 1.

[0024] In one specific embodiment of the present invention, the interfering RNA may further include at least one modification. The modified interfering RNA has superior properties compared to the corresponding unmodified interfering RNA, such as higher stability and lower immunostimulatory activity.

[0025] The modifications include modifications made to the bases, sugar rings, and / or phosphate backbones.

[0026] Preferably, the modifications performed on the bases include, but are not limited to, 5-pyrimidine modification, 8-purine modification, pseudouracil modification, and / or 5-bromouracil substitution.

[0027] Preferably, the modifications performed on the sugar ring include, but are not limited to, 2'-hydroxyl modification, 2'-fluorine modification, 2'-deoxy modification, 2'-alkyl modification, 2'-O-methyl modification, 2'-O-methoxyethyl modification, 2'-O-allyl modification, 2'-C-allyl modification, and nucleotide modification; including but not limited to, 2'-OH being replaced by groups such as H, OZ, Z, halo, SH, SZ, NH2, NHZ, NZ2, or CN, wherein Z is an alkyl group.

[0028] The alkyl group represents a straight-chain or branched hydrocarbon chain radical that does not contain unsaturated bonds, and the hydrocarbon chain radical is connected to other parts of the molecule by a single bond. Typical alkyl groups contain 1 to 20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, neopentyl, tert-pentyl, n-hexyl, isohexyl, n-heptyl, isoheptyl, n-octyl, nonyl, decyl, undecyl, 1-methylundecyl, dodecyl, tridecyl, tetradecyl, pentadecyl, hexadecyl, heptadecanyl, octadecyl, nonadecanyl, and eicosyl, etc.

[0029] Preferably, the modifications performed on the phosphate backbone include, but are not limited to, thiophosphate modification and ligand modification.

[0030] Preferably, the modification further includes nucleotides having inosine, piracetamine, xanthine, 2'-methylribose, non-natural phosphodiester bonds (such as methylphosphonate, thiophosphonate) and / or peptides.

[0031] In one specific embodiment of the present invention, the modification may be methylation, fluorination, thiophosphorylation, pseudouracil, etc.

[0032] Preferably, the ligand modification includes, but is not limited to, cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine (GalNAc), N-acetylgalactosamine derivatives or analogs, N-acetylglucosamine derivatives or analogs, 6-phosphorylated mannose (M6P) derivatives or analogs, and any combination thereof.

[0033] Preferably, the structural formula of the N-acetylgalactosamine derivative or analogue is:

[0034]

[0035] In one specific embodiment, the structural formula of the interfering RNA is:

[0036]

[0037] Where X represents S or O.

[0038] In one specific embodiment of the present invention, the interfering RNA positive strand is as shown by any one of the nucleotide sequences in SEQ ID NO: 49-52;

[0039] The interfering RNA antisense strand is shown as any one of the nucleotide sequences in SEQ ID NO: 53-56.

[0040] The interfering RNA can be prepared using any existing method, such as chemical synthesis.

[0041] In a second aspect, the present invention provides a delivery system comprising the aforementioned interfering RNA.

[0042] Preferably, the delivery system further includes a carrier.

[0043] Preferably, the vector can be any vector suitable for delivering the interfering RNA of the present invention to target tissues or target cells, such as the vectors disclosed in the prior art (e.g., Chen Zhonghua, Zhu Desheng, Li Jun, Huang Zhanqin. "Research progress on non-viral siRNA vectors". Chinese Journal of Pharmacology. 2015, 31(7): 910-4; Wang Rui, Qu Bingnan, Yang Jing. "Research progress on nano-formulations carrying siRNA". China Pharmacy. 2017, 28(31): 4452-4455).

[0044] In one specific embodiment of the present invention, the vector is a viral vector. Preferably, the viral vector includes, but is not limited to, lentiviral vectors, retroviral vectors, adenovirus vectors, adeno-associated virus vectors, poxvirus vectors, herpesvirus vectors, etc.

[0045] In one specific embodiment of the present invention, the carrier is a non-viral carrier. Preferably, the non-viral carrier includes, but is not limited to, any one or a combination of two or more of liposomes, lipid nanoparticles (LNPs), polymers, peptides, antibodies, aptamers, and N-acetylgalactosamine (GalNAc). More preferably, the non-viral carrier includes lipid nanoparticles (LNPs). The weight ratio of the interfering RNA to the non-viral carrier can be any value from 1:1 to 50, preferably any value from 1:1 to 10 (e.g., 1:1, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, 1:50).

[0046] Preferably, the lipid nanoparticles / liposomes mentioned above include one or more of the following: cationic lipids, neutral lipids, polyethylene glycol lipids, steroidal lipids, and anionic lipids.

[0047] Further preferably, the cationic lipid comprises: octadecylamide (SA), lauryltrimethylammonium bromide, hexadecyltrimethylammonium bromide, myristyltrimethylammonium bromide, dimethyl di-octadecylammonium bromide (DDAB), ((4-hydroxybutyl)azadialkyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), 1,2-dioleoyloxy-3-(trimethylammonium)propane (DOTAP), 1,2-di-(9Z-octadecyl)propane, etc. 3β-[N-(N',N'-dimethylaminoethane)-carbamoyl]cholesterol (DC cholesterol), dimethyloctadecylammonium (DDA), 1,2-dimyristoyl-3-trimethylammonium propane (DMTAP), dipalmitoyl(C16:0)trimethylammonium propane (DPTAP), distearyltrimethylammonium propane (DSTAP), N-[1- [(2,3-diallyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), N,N-dioleoyl-N,N-dimethylammonium chloride (DODAC), 1,2-dioleoyl-sn-propanetrioxy-3-ethylphosphocholine (DOEPC), 1,2-dioleoyl-3-dimethylammonium propane (DODAP), 1,2-dilinoleyloxy-3-dimethylaminopropane (DLinDMA), 1,2-di-tetradecanoyl-3-dimethyl... Ammonium-propane, 1,2-di-hexadecyl-3-dimethylammonium-propane and 1,2-di-octadecyl-3-dimethylammonium-propane, 1,2-dioleoyl-c-(4'-trimethylammonium)-butyryl-sn-glycerol (DOTB), di-octadecylamide-alanylspermine, SAINT-2, polycationic lipid 2,3-dioleoyloxy-N-[2(spermine-carboxylamino)ethyl]-N,N-dimethyl-1-propanetrimonium trifluoroacetate (DOSPA)

[0048] (SM-102) (JK-102-CA)

[0049] One or a combination of two or more of (JK-0315-CA) and methyl 4-(N,N-dimethylamino)butyrate (Dlin-MC3-DMA).

[0050] Preferably, the cationic lipid is a steroid-cationic lipid compound.

[0051] The structure of the compound is as follows:

[0052] More preferably, the neutral lipids include: 1,2-distearyl-sn-glycerol-3-phosphate choline (DSPC), 1,2-dipalmitoyl-sn-glycerol-3-phosphate choline (DPPC), 1,2-dioleoyl-sn-glycerol-3-phosphate ethanolamine (DOPE), 1,2-dipalmitoyl-sn-glycerol-3-phosphate ethanolamine (DPPE), 1,2-dimyristoyl-sn-glycerol-3-phosphate ethanolamine (DMPE), and 2-dioleoyl-sn-glycerol-3-phosphate-(1'-rac-glycerol).

[0053] One or more of the following: (DOPG), oleoylphosphatidylcholine (POPC), 1-palmitoyl-2-oleoylphosphatidylethanolamine (POPE), and distearate phosphatidylethanolamine (DSPE).

[0054] More preferably, the polyethylene glycol lipids include: 2-[(polyethylene glycol)-2000]-N,N-tetracosylacetamide (ALC-0159), 1,2-dimyristoyl-sn-glycerol methoxy polyethylene glycol (PEG-DMG), 1,2-distearate-sn-glycerol-3-phosphate ethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG-disterol glycerol (PEG-DSG), PEG-dipalmitoyl, PEG-dioleyl, PEG-distearate, PEG-diacylglycerol amide (PEG-DAG), PEG-dipalmitoylphosphatidylethanolamine (PEG-DPPE), or PEG-1,2-dimyristoyloxypropyl-3-amine (PEG-c-DMA).

[0055] One or more of the following;

[0056] Where n is selected from integers between 20 and 300, such as 20, 30, 50, 80, 100, 150, 200, 250, 300, etc.

[0057] Preferably, the polyethylene glycol lipid is a polyethylene glycol lipid with a single molecular weight; more preferably, the polyethylene glycol lipid comprises:

[0058]

[0059] More preferably, the anionic liposomes include one or more of dioleoylphosphatidylglycerol, dioleoylphosphatidylethanolamine, etc.

[0060] More preferably, the steroidal lipids include one or more of the following: alfalfa sterol, β-sitosterol, brassosterol, ergocalciferol, campesterol, cholesterol, coccidosterol, dehydrocholesterol, sterol, dihydroergocalciferol, dihydrocholesterol, dihydroergosterol, stigmasterol, epicholesterol, ergosterol, fucosterol, hexahydrophotosterol, hydroxycholesterol, lanosterol, photosterol, phycosterol, sitosterol, stigmasterol, stigmasterol, cholic acid, glycocholic acid, taurocholic acid, deoxycholic acid, and lithocholic acid.

[0061] Preferably, the polymer can be a synthetic polymer (such as polyethyleneimine, cyclodextrin, etc.) or a natural polymer (such as chitosan, terminal collagen, etc.) or a mixture thereof.

[0062] Preferably, the above-mentioned polypeptide can be a cell-penetrating peptide (CPP) (such as protamine, Tat peptide, transportan peptide, penetratin peptide, oligoarginine peptide, etc.).

[0063] Preferably, the antibody can be a single-chain antibody (such as scFv-tp, scFv-9R, etc.).

[0064] The delivery system of this application can also encapsulate various beneficial ingredients and deliver them directly into cells to exert their effects, thus producing the desired results faster and better.

[0065] In a third aspect, the present invention provides a cell comprising the aforementioned interfering RNA or the aforementioned delivery system.

[0066] The expression level of JAK1 in the cells was suppressed.

[0067] The expression levels of the JAK1 gene, mRNA, and / or protein in the cells were suppressed.

[0068] The cells mentioned can be immortalized cells or tumor cells.

[0069] In a fourth aspect, the present invention provides a method for preparing cells, the method comprising introducing the above-described interfering RNA or the above-described delivery system into cells.

[0070] In a fifth aspect, the present invention provides a lipid nanoparticle comprising the interfering RNA described above.

[0071] Preferably, the lipid nanoparticles further comprise one or more of polyethylene glycol lipid compounds, cationic lipids, steroidal lipids, or neutral lipids.

[0072] The limitations of polyethylene glycol lipid compounds, cationic lipids, steroidal lipids and neutral lipids are the same as those in the second aspect of this application.

[0073] In one specific embodiment of the present invention, the lipid nanoparticles comprise the aforementioned interfering RNA, as well as polyethylene glycol lipid compounds, cationic lipids (excluding steroid-cationic lipid compounds), steroidal lipids, and neutral lipids.

[0074] Preferably, the molar ratio of polyethylene glycol lipid compound, cationic lipid, steroidal lipid and neutral lipid in the lipid nanoparticles is (0.5-5):(30-55):(30-55):(5-20). More preferably, the molar ratio of polyethylene glycol lipid compound, cationic lipid, steroidal lipid and neutral lipid is (1-5):(35-50):(40-50):(8-15).

[0075] In one specific embodiment of the present invention, the lipid nanoparticles comprise the aforementioned interfering RNA, a steroid-cationic lipid compound, a second lipid, and a polyethylene glycol lipid. The second lipid is selected from neutral lipids, zwitterionic lipids, or anionic lipids.

[0076] Preferably, the molar ratio of steroid-cationic lipid:second lipid:polyethylene glycol lipid in the lipid nanoparticles is 10-30:60-80:10-25, more preferably 20-30:60-70:10-20.

[0077] The lipid nanoparticles of this application can also encapsulate various beneficial components to the human body, delivering them directly into cells to exert their effects, thus producing the desired results faster and better.

[0078] The lipid nanoparticles can be prepared using conventional lipid nanoparticle preparation methods in the art, such as high-pressure homogenization, emulsification precipitation, and ultrasonic dispersion.

[0079] In a sixth aspect, the present invention provides a medicament or kit comprising the interfering RNA described above, the delivery system described above, the lipid nanoparticles described above, or the cells described above.

[0080] The drug also includes pharmaceutically acceptable excipients.

[0081] Preferably, the pharmaceutically acceptable excipients include, but are not limited to, carriers, diluents, binders, lubricants, wetting agents, etc.

[0082] Preferably, the administration methods of the drug include, but are not limited to, oral, enteral, subcutaneous, intramuscular, intravenous, nasal, transdermal, subconjunctival, intraocular, orbital, retroocular, retinal, choroidal, and intrathecal administration.

[0083] Preferably, the dosage forms of the drug include, but are not limited to, tablets, capsules, pills, injections, inhalers, lozenges, suppositories, emulsions, microemulsions, submicroemulsions, nanoparticles, gels, powders, suspensions, creams, gels, sprays, etc. The various dosage forms of the drug can be prepared according to conventional pharmaceutical manufacturing methods.

[0084] Preferably, the mass content of the interfering RNA, the delivery system, or the cells in the drug can be 1%-100%, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, 99.5, 100%.

[0085] In a seventh aspect, the present invention provides an antibody-nucleic acid conjugate drug comprising the interfering RNA described above, the delivery system described above, or the lipid nanoparticles described above.

[0086] The antibody-nucleic acid conjugate contains one or more interfering RNAs.

[0087] In the antibody-nucleic acid conjugate drug, the antibody and nucleic acid can be directly linked or linked through a linker group or linker peptide.

[0088] The general formula (I) of the antibody-nucleic acid conjugate drug is:

[0089]

[0090]

[0091] Where R is the interfering RNA mentioned above;

[0092] x1 is an integer from 1 to 144; preferably, x1 is an integer from 1 to 9; more preferably, x1 is an integer from 1 to 3.

[0093] x2 is an integer from 1 to 8; preferably, x2 is an integer from 1 to 2.

[0094] Ab represents antibodies;

[0095] L is the connection unit connecting Ab and R.

[0096] Preferably, the L portion has a general formula (II) structure:

[0097]

[0098] in,

[0099] In Formula II, x3 is selected from integers from 1 to 12; preferably 1 to 3.

[0100] In Formula II, x4 is selected from integers from 1 to 12; preferably 1 to 3.

[0101] P1 and P2 may be the same or different polyethylene glycol residues;

[0102] L1 is the connection unit connecting Ab and P1;

[0103] L2 is the connection unit connecting P2 and R;

[0104] A1 is the connection unit connecting P1 and P2;

[0105] Preferably, P1 and P2 are independently selected from linear, Y-shaped, multi-branched polyethylene glycol residues;

[0106] Preferably, P1 and P2 are single molecular weight polyethylene glycols with a molecular weight of 88-4400 Da; more preferably, the molecular weight of P1 and P2 is 176-1056 Da.

[0107] Preferably, P1 and P2 are non-single molecular weight polyethylene glycols with a molecular weight of 1000 Da-40 kDa;

[0108] More preferably, the molecular weights of P1 and P2 are 2000 Da to 10 kDa.

[0109] Preferably, L1 is a linking group, selected from straight-chain or branched C. 1-12 Alkylene, C 6-12 Alpha-aryl, C 3-12 Cycloalkylene, -S-, -O-, -SS-、 A combination of one or more groups;

[0110] The C of the straight chain or branched chain 1-12 Alkylene, C 6-12 aryl or C 3-12 Any H atom on a cycloalkylene group is replaced by -H, -F, -Cl, -Br, -I, -O-, -S-, -SO2, -NO2, or C. 1-12 Alkyl chain, C 3-12 cycloalkyl, C 6-12Aryl groups, substituted or unsubstituted heterocyclic groups, or substituted or unsubstituted heterocyclic alkyl groups Group substitution consisting of one or more groups in the group;

[0111] Preferably, L2 is a linking group, selected from straight-chain or branched C. 1-12 Alkylene, C 6-12 Alpha-aryl, C 3-12 Cycloalkylene, -S-, -O-, -SS-、 A combination of one or more groups;

[0112] The C of the straight chain or branched chain 1-12 Alkylene, C 6-12 aryl or C 3-12 Any H atom on a cycloalkylene group is replaced by -H, -F, -Cl, -Br, -I, -O-, -S-, -SO2, -NO2, or C. 1-12 Alkyl chain, C 3-12 cycloalkyl, C 6-12 Aryl groups, substituted or unsubstituted heterocyclic groups, or substituted or unsubstituted heterocyclic alkyl groups Group substitution consisting of one or more groups;

[0113] Preferably, L1 is an amide bond, a hydrazone bond, and a thiol-maleimide bond;

[0114] More preferably, L1 is an amide bond;

[0115] Preferably, L2 is a disulfide bond and a thiol-maleimide bond;

[0116] More preferably, the L2 is a disulfide bond.

[0117] Preferably, A1 is a linking group connecting P1 and P2, selected from straight-chain or branched C groups. 1-12 Alkylene, C 6-12 Alpha-aryl, C 3-12 Cycloalkylene, -S-, -O-, -SS-、 A combination of one or more groups;

[0118] The C of the straight chain or branched chain 1-12 Alkylene, C 6-12 aryl or C 3-12 Any H atom on a cycloalkylene group is replaced by -H, -F, -Cl, -Br, -I, -O-, -S-, -SO2, -NO2, or C. 1-12Alkyl chain, C 3-12 cycloalkyl, C 6-12 Aryl groups, substituted or unsubstituted heterocyclic groups, or substituted or unsubstituted heterocyclic alkyl groups A group substitution consisting of one or more groups.

[0119] More preferably, the antibody-nucleic acid conjugate has the general formula (IV):

[0120]

[0121] L1 is a linking group, selected from straight-chain or branched C-type carbonyl groups. 1-12 Alkylene, C 6-12 Alpha-aryl, C 3-12 Cycloalkylene, -S-, -O-, -SS-、 A combination of one or more groups;

[0122] Preferably, P1 consists of the same or different polyethylene glycol residues;

[0123] Preferably, when P1 is a single molecular weight polyethylene glycol with a molecular weight of 88-4400 Da, more preferably, the molecular weight of P1 is 176-1056 Da.

[0124] Preferably, P1 is a non-single molecular weight polyethylene glycol with a molecular weight of 1000 Da-40 kDa; more preferably, the molecular weight of P1 is 2000 Da-10 kDa.

[0125] The L2 is a linking group, selected from straight-chain or branched C groups. 1-12 Alkylene, C 6-12 Alpha-aryl, C 3-12 Cycloalkylene, -S-, -O-, -SS-、 A combination of one or more groups;

[0126] x1 is an integer from 1 to 144; preferably, x1 is an integer from 1 to 9; more preferably, x1 is an integer from 1 to 3.

[0127] x2 is an integer from 1 to 8; preferably, x2 is an integer from 1 to 2.

[0128] In one specific embodiment of the present invention, the antibody-nucleic acid conjugate drug has the following structure:

[0129]

[0130] The n1 is selected from an integer between 4 and 100, preferably between 4 and 24; n1 can be a constant or an average value.

[0131] In one specific embodiment of the present invention, the antibody-nucleic acid conjugate drug has the following structure:

[0132]

[0133] The n1 and n2 are independent integers selected from 4 to 100, preferably from 4 to 24. n1 and n2 can be constants or averages.

[0134] Preferably, the Ab is selected from monoclonal antibodies, polyclonal antibodies, antibody fragments, and antibody fusion fragments.

[0135] The antibody may be a single-domain antibody or a single-chain antibody.

[0136] More preferably, the Ab is a monoclonal antibody; more preferably, the monoclonal antibody is reactive to antigens or epitopes associated with cancer, malignant cells, infectious organisms, or autoimmune diseases.

[0137] In one specific embodiment of the present invention, the Ab is selected from: anti-HER2 antibody, anti-EGFR antibody, anti-PMSA antibody, anti-VEGFR antibody, anti-CD30 antibody, anti-CD22 antibody, anti-CD56 antibody, anti-CD29 antibody, anti-GPNMB antibody, anti-CD138 antibody, anti-CD74 antibody, anti-ENPP3 antibody, anti-Nectin-4 antibody, anti-EGFRⅧ antibody, anti-SLC44A4 antibody, anti-mesothelin antibody, anti-ET8R antibody, anti-CD37 antibody, anti-CEACAM5 antibody, anti-CD70 antibody, anti-MUC16 antibody, anti-CD79b antibody, anti-MUC16 antibody, anti-Muc1 antibody, anti-CD3 antibody, anti-CD28 antibody, anti-CD38 antibody, anti-CD19 antibody, anti-PD-L1 antibody, anti-4-1BB antibody, etc.

[0138] An eighth aspect of the present invention provides an application of the above-described interfering RNA, the above-described delivery system, the above-described cell, the above-described drug or kit, the above-described lipid nanoparticles, or the above-described antibody-nucleic acid conjugate drug, said application including:

[0139] A) Use in the preparation of medicaments for the treatment and / or prevention of diseases related to JAK / STAT signaling pathway dysregulation;

[0140] B) Application in inhibiting JAK1 expression;

[0141] C) Application in the treatment and / or prevention of diseases related to JAK / STAT signaling pathway dysregulation.

[0142] Preferably, the diseases related to JAK / STAT signaling pathway dysregulation (diseases related to increased JAK1 expression or excessive cell proliferation) include, but are not limited to, autoimmune diseases or tumors.

[0143] More preferably, the autoimmune diseases include, but are not limited to, rheumatoid arthritis, atopic dermatitis, vitiligo, psoriasis, psoriatic arthritis, or alopecia areata.

[0144] More preferably, the tumors include digestive tract tumors (oral cancer, tongue cancer, esophageal cancer, stomach cancer, liver cancer, pancreatic cancer, colorectal cancer, etc.), nervous system tumors (gliomas (e.g., neuroepithelial tumors, schwannomas, astrocytomas, neurofibromas (e.g., neurofibrosarcomas), ependymomas, medulloblastomas, meningiomas, brain metastases, etc.), respiratory tract tumors (nasopharyngeal carcinoma, laryngeal carcinoma, bronchial carcinoma, lung cancer, etc.), urinary system tumors (e.g., prostate cancer, renal cell carcinoma, bladder cancer, etc.), and reproductive system tumors (breast cancer, cervical cancer, etc.). Cancer, ovarian cancer, placental choriocarcinoma, etc.), hematologic and lymphatic system tumors (multiple myeloma, hematologic malignancies, mesothelioma, myeloma (including myeloproliferative neoplasms (MPN)), myelodysplastic syndromes, myeloproliferative disorders, lymphomas (such as non-Hodgkin lymphoma, Hodgkin lymphoma, cutaneous T-cell lymphoma), leukemias (such as chronic myeloid leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, etc.), thymic carcinoma, etc.), skin system tumors (such as skin cancer, epidermoid carcinoma, melanoma, etc.), as well as rhabdomyosarcoma, head and neck cancer, etc.

[0145] The aforementioned myelodysplastic syndromes (MDS) include, but are not limited to, refractory anemia, refractory anemia with sideroblasts, refractory anemia with excessive blast cells, refractory anemia with excessive blast cell transformation, refractory cytopenia with multilineage dysplasia, myelodysplastic syndrome with 5q syndrome, and treatment-related myelodysplastic syndromes.

[0146] The aforementioned myeloproliferative disorders (MPDs) include, but are not limited to, chronic myeloid leukemia (CML), polycythemia vera (PV), essential thrombocythemia (ET), primary or idiopathic myelofibrosis (PMF), chronic neutrophilic leukemia, chronic eosinophilic leukemia, chronic myelomonocytic leukemia, juvenile myelomonocytic leukemia, eosinophilia, and systemic mastocytosis.

[0147] In a ninth aspect, the present invention provides a method for inhibiting JAK1 expression, the method comprising adding the above-described interfering RNA, the above-described delivery system, the above-described cells, the above-described lipid nanoparticles, the above-described drug or kit, or the above-described antibody-nucleic acid conjugate drug.

[0148] Preferably, the method inhibits JAK1 expression in cells, wherein the cells are immortalized cells or tumor cells.

[0149] Preferably, the method includes delivering the interfering RNA described above into cells. The delivery is performed using the delivery system described above.

[0150] In a tenth aspect, the present invention provides a method for treating diseases related to JAK / STAT signaling pathway dysregulation, the method comprising administering to a subject a therapeutically effective amount of the aforementioned interfering RNA, the aforementioned delivery system, the aforementioned lipid nanoparticles, the aforementioned cells, the aforementioned drug or kit, or the aforementioned antibody-nucleic acid conjugate drug.

[0151] Preferably, the diseases associated with the JAK / STAT signaling pathway dysregulation include, but are not limited to, autoimmune diseases or tumors.

[0152] More preferably, the autoimmune diseases include, but are not limited to, rheumatoid arthritis, atopic dermatitis, vitiligo, psoriasis, psoriatic arthritis, or alopecia areata.

[0153] More preferably, the tumors include digestive tract tumors (oral cancer, tongue cancer, esophageal cancer, stomach cancer, liver cancer, pancreatic cancer, colorectal cancer, etc.), nervous system tumors (gliomas (e.g., neuroepithelial tumors, schwannomas, astrocytomas, neurofibromas (e.g., neurofibrosarcomas), ependymomas, medulloblastomas, meningiomas, brain metastases, etc.), respiratory tract tumors (nasopharyngeal carcinoma, laryngeal carcinoma, bronchial carcinoma, lung cancer, etc.), urinary system tumors (e.g., prostate cancer, renal cell carcinoma, bladder cancer, etc.), and reproductive system tumors (breast cancer, cervical cancer, etc.). Cancer, ovarian cancer, placental choriocarcinoma, etc.), hematologic and lymphatic system tumors (multiple myeloma, hematologic malignancies, mesothelioma, myeloma (including myeloproliferative neoplasms (MPN)), myelodysplastic syndromes, myeloproliferative disorders, lymphomas (such as non-Hodgkin lymphoma, Hodgkin lymphoma, cutaneous T-cell lymphoma), leukemias (such as chronic myeloid leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, etc.), thymic carcinoma, etc.), skin system tumors (such as skin cancer, epidermoid carcinoma, melanoma, etc.), as well as rhabdomyosarcoma, head and neck cancer, etc.

[0154] The aforementioned myelodysplastic syndromes (MDS) include, but are not limited to, refractory anemia, refractory anemia with sideroblasts, refractory anemia with excessive blast cells, refractory anemia with excessive blast cell transformation, refractory cytopenia with multilineage dysplasia, myelodysplastic syndrome with 5q syndrome, and treatment-related myelodysplastic syndromes.

[0155] The aforementioned myeloproliferative disorders (MPDs) include, but are not limited to, chronic myeloid leukemia (CML), polycythemia vera (PV), essential thrombocythemia (ET), primary or idiopathic myelofibrosis (PMF), chronic neutrophilic leukemia, chronic eosinophilic leukemia, chronic myelomonocytic leukemia, juvenile myelomonocytic leukemia, eosinophilia, and systemic mastocytosis.

[0156] Existing JAK inhibitors are all small molecule drugs that inhibit the kinase activity of JAKs, but they require frequent administration and have significant side effects. Compared with small molecule drugs, siRNA drugs have the advantages of high specificity and low administration frequency. The JAK1 siRNA sequence screened in this application has great development potential for the treatment of diseases related to JAK / STAT signaling pathway dysregulation (such as autoimmune diseases). Experiments have confirmed that siJAK1 can significantly inhibit the mRNA expression level of JAK1 in cells. Therefore, it is expected to be used for diseases related to increased JAK1 expression, such as autoimmune diseases, by inhibiting Janus kinase expression and regulating the JAK / STAT signaling pathway, thereby slowing disease progression and improving disease outcome.

[0157] The "interfering RNA" described in this invention includes single-stranded RNA (e.g., mature miRNA, ssRNA oligonucleotide, ssDNA oligonucleotide) or double-stranded RNA (e.g., siRNA, dsRNA, shRNA, aiRNA, or precursor miRNA). When the interfering RNA is in the same cell as the target gene or sequence, it can reduce or inhibit the expression of the target gene or sequence (e.g., by mediating degradation and / or inhibiting the translation of mRNA complementary to the interfering RNA sequence).

[0158] The siRNA is a small interfering RNA, and each strand of its molecule contains nucleotides of about 15 to about 60 in length (e.g., nucleotides of about 15-60, 15-50, 15-40, 15-30, 15-25, or 19-25 in length, or nucleotides of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 in length). In one specific embodiment, the siRNA may be chemically synthesized. The siRNA molecules of the present invention are capable of silencing the expression of target sequences in vitro and / or in vivo. In some embodiments, the siRNA may not contain modified nucleotides; in other embodiments, the siRNA contains at least one modified nucleotide, for example, the siRNA contains one, two, three, four, five, six, seven, eight, nine, ten, or more modified nucleotides in the double-stranded region. dsRNA or precursor RNA molecules include any precursor molecule processed in vivo by a nuclease to produce active siRNA. shRNA is a small hairpin RNA or short hairpin RNA, including short RNA sequences that produce tight hairpin turns. These hairpin turns can be used to silence gene expression via RNA interference. The shRNA hairpin structure can be cleaved into siRNA by cellular machinery. miRNA is a single-stranded RNA molecule approximately 21-23 nucleotides in length that regulates gene expression.

[0159] The "inhibition of target gene expression" mentioned in this invention refers to the ability of the interfering RNA (e.g., siRNA) of this invention to silence, reduce, or inhibit the expression of target genes (e.g., JAK gene).

[0160] The terms "comprising" or "including" as used in this invention are open-ended, encompassing the specified components or steps described, as well as other specified components or steps that do not substantially affect the meaning. When used to describe the sequence of a protein or nucleic acid, the protein or nucleic acid may consist of the stated sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still possess the same or similar activity as the original sequence.

[0161] The term "tumor" as used in this invention can refer to any undesirable cell proliferation (or any disease that manifests as undesirable cell proliferation), vegetation, or an increased tendency or risk of undesirable cell proliferation, vegetation, or tumor. It can be benign or malignant, and can be primary or secondary (metastatic). A vegetation can be any abnormal growth or proliferation of cells and can be located in any tissue. Examples of tissues include the adrenal glands, adrenal medulla, anus, appendix, bladder, blood, bone, bone marrow, brain, mammary glands, cecum, central nervous system (including or excluding the cerebrum), cerebellum, cervix, colon, duodenum, endometrium, epithelial cells (e.g., renal epithelial cells), gallbladder, esophagus, glial cells, heart, ileum, jejunum, kidneys, lacrimal glands, larynx, liver, lungs, lymph nodes, lymphoblasts, maxilla, mediastinum, mesentery, myometrium, nasopharynx, omentum, oral cavity, ovary, pancreas, parotid gland, peripheral nervous system, peritoneum, pleura, prostate, salivary glands, sigmoid colon, skin, small intestine, soft tissue, spleen, stomach, testes, thymus, thyroid gland, tongue, tonsils, trachea, uterus, vulva, and leukocytes. More preferably, the tumors include digestive tract tumors (oral cancer, tongue cancer, esophageal cancer, stomach cancer, liver cancer, pancreatic cancer, colorectal cancer, etc.), nervous system tumors (gliomas (e.g., neuroepithelial tumors, schwannomas, astrocytomas, neurofibromas (e.g., neurofibrosarcomas), ependymomas, medulloblastomas, meningiomas, brain metastases, etc.), respiratory tract tumors (nasopharyngeal carcinoma, laryngeal cancer, bronchial carcinoma, lung cancer, etc.), urinary system tumors (e.g., prostate cancer, renal cell carcinoma, bladder cancer, etc.), and other related tumors. Tumors of the reproductive system (breast cancer, cervical cancer, ovarian cancer, choriocarcinoma of the placenta, etc.), tumors of the hematopoietic and lymphatic systems (multiple myeloma, hematologic malignancies, mesothelioma, myeloma, myelodysplastic syndrome, lymphoma (e.g., non-Hodgkin's lymphoma, Hodgkin's lymphoma, cutaneous T-cell lymphoma), leukemia (e.g., chronic myeloid leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, etc.), thymic carcinoma, etc.), tumors of the skin system (e.g., skin cancer, epidermoid carcinoma, melanoma, etc.), as well as rhabdomyosarcoma, head and neck cancer, etc.

[0162] The "subject" described in this invention can be a human or a non-human mammal. The non-human mammal can be a wild animal, a zoo animal, an economically important animal, a pet, a laboratory animal, etc. Preferably, the non-human mammal includes, but is not limited to, pigs, cattle, sheep, horses, donkeys, foxes, raccoon dogs, minks, camels, dogs, cats, rabbits, mice (e.g., rats, mice, guinea pigs, hamsters, gerbils, chinchillas, squirrels), or monkeys, etc.

[0163] The term "treatment" as used in this invention refers to slowing down, interrupting, preventing, controlling, stopping, alleviating, reducing, or reversing a sign, symptom, disorder, condition, or progression or severity of a disease after it has begun to develop, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions, or disorders.

[0164] The term "prevention" as used in this invention refers to a method implemented to prevent or delay the occurrence of a disease, condition, or symptom in the body.

[0165] The term "effective amount" as used in this invention refers to the amount or dose of the product of this invention that provides the desired effect (e.g., treatment, prevention, or inhibition of JAK1 expression) after being administered to a subject or their cells or organs in one or more doses.

[0166] The term "lipid" as used in this invention refers to a group of organic compounds, including but not limited to esters of fatty acids, and is generally characterized by being poorly soluble in water but soluble in many organic solvents.

[0167] The "cationic lipid" mentioned in this invention refers to lipid molecules that can carry a positive charge.

[0168] The term "neutral lipid" as used in this invention refers to uncharged, non-phosphoglycerate lipid molecules.

[0169] The “polyethylene glycol lipid” mentioned in this invention refers to a molecule that includes a lipid portion and a polyethylene glycol portion.

[0170] The "lipid nanoparticles" described in this invention refer to particles having a size on the nanometer scale, which contain at least one lipid.

[0171] The "delivery system" described in this invention refers to a formulation or composition that regulates the spatial, temporal, and dosage distribution of bioactive ingredients within a living organism. Attached Figure Description

[0172] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:

[0173] Figure 1 Mass spectra of the sense (ss) and antisense (as) strands of siJAK1-474.

[0174] Figure 2 Mass spectra of the sense (ss) and antisense (as) strands of siJAK1-826.

[0175] Figure 3 Mass spectra of the sense (ss) and antisense (as) strands of siJAK1-1131.

[0176] Figure 4 Mass spectra of the sense (ss) and antisense (as) strands of the siJAK1-2200.

[0177] Figure 5 Mass spectra of the sense (ss) and antisense (as) strands of siJAK1-2714.

[0178] Figure 6 Mass spectra of the sense (ss) and antisense (as) strands of siJAK1-3283.

[0179] Figure 7 Mass spectra of the sense (ss) and antisense (as) strands of siJAK1-3630.

[0180] Figure 8 Mass spectra of the sense (ss) and antisense (as) strands of siJAK1-4096.

[0181] Figure 9 Mass spectra of the sense (ss) and antisense (as) strands of siJAK1-4359.

[0182] Figure 10 Mass spectra of the sense (ss) and antisense (as) strands of siJAK1-4389.

[0183] Figure 11 Mass spectra of the sense (ss) and antisense (as) strands of siJAK1-4410.

[0184] Figure 12 Mass spectra of the sense (ss) and antisense (as) strands of siJAK1-4627.

[0185] Figure 13 Mass spectra of the sense (ss) and antisense (as) strands of siJAK1-5026.

[0186] Figure 14 Mass spectra of the sense (ss) and antisense (as) strands of siJAK1-5034.

[0187] Figure 15 : Testing the inhibitory effect of siJAK1 on IFN-γ-induced pSTAT1 in human keratinocytes.

[0188] Figure 16 : To test the inhibitory effect of siJAK1 on IFN-γ-induced pSTAT1 in mouse fibroblasts.

[0189] Figure 17 : To test the inhibitory effect of the siJAK1 modified sequence on IFN-γ-induced pSTAT1 in mouse fibroblasts. Detailed Implementation

[0190] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0191] Example 1: siRNA design and synthesis

[0192] siRNA was designed based on the human JAK1 transcript NM_001321853.2. The target sequence and siRNA sequence are shown in Table 1.

[0193] Table 1. Target sequences and siRNA sequences of JAK1

[0194]

[0195]

[0196] The above siRNA sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd., while the irrelevant sequence (siNC, sense strand: 5'-UUC UCC GAA CGU GUC ACG UTT (SEQ ID NO: 43), antisense strand: 5'-ACG UGA CAC GUU CGGAGA ATT (SEQ ID NO: 44)) was designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The mass spectra of the siRNAs shown in Table 1 are as follows: Figure 1-14 As shown.

[0197] Example 2: Screening siRNA in in vitro cell experiments

[0198] 1. Cell transfection

[0199] The day before transfection, 293T cells were prepared at a rate of 1×10⁻⁶. 5 Cells were seeded per well in 24-well cell culture plates. The culture medium was 500 μL of DMEM containing 10% FBS and 1% Penicillin-Streptomycin, with 3 replicates per group. The plates were incubated at 37°C with 5% CO2 for 24 hours to allow cell attachment. On the day of transfection, the medium was replaced with 450 μL of antibiotic-free DMEM (containing 10% FBS). 25 μL of Opti-MEM medium was used to dilute siRNA, and the control group received the same concentration of siNC; another 25 μL of Opti-MEM medium was used to dilute Lipofectamine. TMRNAiMAX transfection reagent (Lip) was incubated at room temperature for 5 min. The two solutions were then mixed and incubated at room temperature for 5 min. 50 μL of the mixture was added to each well, resulting in a final transfection volume of 500 μL and a working concentration of 50 nM siRNA. After incubation at 37°C and 5% CO2 for 48 h, total RNA was extracted from the cells.

[0200] 2. RNA extraction

[0201] Using Eastep TM The Super Total RNA Extraction Kit extracts RNA; detailed steps are as follows:

[0202] 1) Add 300 μL of RNA lysis buffer and 300 μL of RNA dilution buffer to each well of a 24-well cell culture plate, mix well, transfer to a 1.5 mL centrifuge tube, centrifuge at 14000g for 10 min, and carefully aspirate the supernatant to a new 1.5 mL centrifuge tube.

[0203] 2) Add 0.5 times the volume of anhydrous ethanol, invert and mix 15-20 times, then transfer to a centrifuge column, centrifuge at 12000g for 1 min, and discard the filtrate.

[0204] 3) Add 600 μL of RNA washing buffer, centrifuge at 12000g for 1 min, and discard the filtrate.

[0205] 4) Add 50 μL of DNase I incubation solution and digest DNA at room temperature for 15 min.

[0206] 5) Add 600 μL of RNA washing buffer, centrifuge at 12000g for 1 min, and discard the filtrate; repeat once. Then centrifuge at 14000g for 2 min to remove residual RNA washing buffer, and place the centrifuge column into a collection tube.

[0207] 6) Add an appropriate amount of RNase-free H2O, let stand at room temperature for 15 minutes, centrifuge at 14000g for 1 minute, and use NanoDrop. TM The quality and concentration of RNA were determined. The RNA was incubated at 70°C for 5 minutes, followed immediately by an ice bath for 5 minutes, and then stored for later use.

[0208] 3. Detect gene expression levels

[0209] 1) Using the Lamborghini All-in-One First-Strand Synthesis MasterMix kit (catalog number F0202), RNA was reverse transcribed into a cDNA template. The reaction system was established according to Table 2. After thorough mixing, the liquid was collected to the bottom of the tube by centrifugation. The PCR program was run at 37℃ for 2 min, 55℃ for 15 min, and 85℃ for 5 min. The product is the cDNA template.

[0210] Table 2 Reverse transcription reaction system

[0211]

[0212]

[0213] 2) Using Lamborghini Taq The Green qPCR Premix (catalog number R0202) kit was used to detect gene expression levels. The qPCR system was prepared according to Table 3, thoroughly mixed, and centrifuged to collect the liquid at the bottom of the tube. The PCR program was then set up and run.

[0214] Step 1: 95℃ for 30 seconds;

[0215] Step 2: 95℃ for 10 seconds;

[0216] Step3: 60℃ 30s+Plate Read;

[0217] Step4; Go to Step2, 40times;

[0218] Step5: Melt Curve 65 to 95℃, increment 0.5℃, for 5s+Plate Read.

[0219] Table 3 qPCR reaction system

[0220]

[0221] Using GAPDH as an internal control, the relative expression level of the JAK1 gene was detected. The primer sequences used are as follows:

[0222] GAPDH-F: TCTGACTTCAACAGCGACAC (SEQ ID NO: 45);

[0223] GAPDH-R: GCCAAATTCGTTGTCATACC (SEQ ID NO: 46);

[0224] JAK1-F: AACCTCTTTGCCCTGTATGAC (SEQ ID NO: 47);

[0225] JAK1-R: CTGCTCATTGTCGTTGGTTC (SEQ ID NO: 48).

[0226] The results showed that in 293T cells 48 hours after transfection with siRNA, the siRNAs targeting JAK1 designed in Example 1 could inhibit gene expression compared with siNC (Table 4).

[0227] Table 4. The inhibitory effect of siJAK1 on genes in cells.

[0228]

[0229] Example 3: Inhibitory effect of siJAK1 transfection on IFN-γ-induced STAT1 phosphorylation in cells

[0230] One day before transfection, human keratinocytes (HaCaT cells) were divided into groups of 5 × 10⁻⁶ cells. 5 Cells / well were seeded into 6-well cell culture plates in 2 mL of MEM containing 15% FBS and 1% Penicillin-Streptomycin; mouse fibroblast L929 cells were seeded at a ratio of 1×10⁻⁶ cells / well. 5 One cell per well was seeded in a 6-well cell culture plate, and the culture medium was 2 mL of DMEM containing 10% FBS and 1% Penicillin-Streptomycin.

[0231] The grouping and treatment methods are shown in Table 5. On the day of transfection, groups 3-6 were transfected with siNC, siJAK1-474, siJAK1-826, and siJAK1-3283, respectively, with a working concentration of 50 nM for all siRNAs. Group 7 was treated with 5 μM baricitinib. After 24 h of treatment, all groups were replaced with fresh culture medium and cultured for another 24-48 h. Before collecting samples, 5 μM baricitinib was added to group 8 and incubated for 1 h; then 100 ng / mL IFN-γ was added to groups 2-8 and incubated for 30 min before cell collection. Total cellular protein was extracted, and the protein level of phosphorylated STAT1 was detected by Western blotting.

[0232] Table 5 Grouping and Processing Methods

[0233] G1 G2 G3 G4 G5 G6 G7 G8 IFN-γ 100ng / ml - + + + + + + + siNC 50nM - - + - - - - - siJAK1-474 50nM - - - + - - - - siJAK1-826 50nM - - - - + - - - siJAK-3283 50nM - - - - - + - - Baricitinib 5μM - - - - - - + - Baricitinib 5μM (1h) - - - - - - - +

[0234] The protein extraction and Western blotting methods are as follows:

[0235] 1) Add an appropriate amount of pre-chilled RIPA lysis buffer (add 1 mM PMSF, Lamborghini R1090, containing protease inhibitors and phosphatase inhibitors before use) to lyse cells for 3-5 min, centrifuge at 14000g at 4℃ for 5 min, and carefully aspirate the supernatant into a new 1.5 mL centrifuge tube. Determine protein concentration using the BCA method (Solepro PC0020), add loading buffer, and incubate in a 95℃ water bath for 10 min to denature the protein.

[0236] 2) Protein samples were separated by electrophoresis using a 4-12% 12-well gradient gel (Lambolid P41212) and matching electrophoresis buffer. The total protein amount in each lane was 20 μg. A protein marker lane (Lambolid P1018) was also set up.

[0237] 3) Transfer: Prepare a PVDF membrane (Millipore, 0.45 μm) the same size as the protein gel and two sheets of thick filter paper. Soak the PVDF membrane in an appropriate amount of methanol until the entire membrane becomes translucent. Then, soak the protein gel, PVDF membrane, and filter paper in transfer buffer for 15 min. In a Bio-Red semi-dry transfer apparatus, place the membrane in the order of filter paper-PVDF membrane-protein gel-filter paper, set a constant voltage of 20V, and transfer for 40 min to transfer the protein onto the PVDF membrane.

[0238] 4) Cut the PVDF membrane to the size of the protein and the marker, and immerse it in 5% skim milk prepared with TBST for blocking at room temperature for 1 hour. Then, incubate the PVDF membrane with pSTAT1 primary antibody (CST#9167) and GAPDH primary antibody (Lambolid G0100) overnight at 4°C. The next day, remove the membrane and wash it three times with TBST for 5 minutes each time. Then incubate with the corresponding secondary antibody for 1 hour. After washing again, add chemiluminescence buffer (Lambolid E1050, E1080) and react using a Bio-Red imaging system (ChemiDoc). TM The XRS+Imager takes a picture and analyzes it using the accompanying software.

[0239] The results showed that in HaCaT cells, siJAK1 significantly inhibited IFN-γ-induced STAT1 phosphorylation compared to groups 2 and 3. Baricitinib, a marketed small-molecule inhibitor, significantly inhibited STAT1 phosphorylation after 1 hour of treatment (group 8), but showed little inhibitory effect after 72 hours (group 7); while under the same treatment duration, siJAK1 still significantly inhibited STAT1 phosphorylation. Figure 15 In L929 cells, siJAK1 also inhibited IFN-γ-induced STAT1 phosphorylation; after a single 48-h treatment, the inhibitory effect of baricitinib was significantly weakened, while siJAK1 still inhibited STAT1 phosphorylation. Figure 16 The above results demonstrate that in in vitro cell experiments, siJAK1 not only inhibits the activation of the JAK / STAT signaling pathway, but also has a longer duration of action than baricitinib, laying the foundation for the development of long-acting JAKi drugs.

[0240] Example 4: Inhibitory effect of siJAK1 modified sequence on gene expression level and IFN-γ-induced STAT1 phosphorylation level

[0241] 1. Design the siJAK1 modification sequence

[0242] The siJAK1-826 and 3283 sequences were chemically modified, and the modified sequences are shown in Table 6 below. Here, m indicates that the right-side adjacent nucleotide has a 2'-OMe modification, f indicates that the right-side adjacent nucleotide has a 2'-F modification, Ψ indicates that the right-side adjacent nucleotide is pseudouracil, and s indicates that the phosphate backbone has a thiophosphate modification.

[0243] Table 6 siJAK1 Modification Sequences

[0244]

[0245] 2. qPCR test of the inhibitory effect of the siJAK1 modification sequence on gene expression.

[0246] Following the method described in Example 2, modified siJAK1 was transfected into human keratinocytes (HaCaT) at a working concentration of 50 nM. qPCR was used to detect JAK1 expression levels 48 h after transfection. Controls included siNC at the same concentration and unmodified siJAK1. The results showed that, compared to siNC, modified siJAK1 significantly inhibited the relative expression level of the gene (Table 7).

[0247] Table 7 shows the gene repression effect of the siJAK1 modification sequence.

[0248]

[0249]

[0250] 3. Western blot analysis to detect the inhibitory effect of siJAK1 modified sequence on IFN-γ-induced STAT1 phosphorylation.

[0251] Following the method described in Example 3, modified siJAK1 was transfected into mouse fibroblast L929 cells. Grouping and treatment methods are shown in Table 8. On the day of transfection, groups 3-9 were transfected with siNC, siJAK1-826, siJAK1-826-m4, siJAK1-3283, siJAK1-3283-m10, siJAK1-3283-m11, and siJAK1-3283-m12, respectively, with a working concentration of 50 nM for all siRNAs. After 24 hours, the culture medium was replaced for all groups, and the cells were cultured for another 24 hours. Before sample collection, 100 ng / mL IFN-γ was added to groups 2-9, and cells were incubated for 30 minutes before collection. Total cellular protein was extracted, and Western blotting was used to detect the protein level of phosphorylated STAT1.

[0252] Table 8 Grouping and Processing Methods

[0253] G1 G2 G3 G4 G5 G6 G7 G8 G9 IFN-γ 100ng / ml - + + + + + + + + siNC 50nM - - + - - - - - - siJAK1-826 50nM - - - + - - - - - siJAK1-826-m4 50nM - - - - + - - - - siJAK-3283 50nM - - - - - + - - - siJAK-3283-m10 50nM - - - - - - + - - siJAK-3283-m11 50nM - - - - - - - + - siJAK-3283-m12 50nM - - - - - - - - +

[0254] The results showed that, compared with the third group of siNC, all siJAK1 modified sequences could inhibit IFN-γ-induced STAT1 phosphorylation levels; among them, the modified sequences siJAK1-3283-m11 and siJAK1-3283-m12 showed better effects. Figure 17 ).

[0255] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details of the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0256] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable way without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

Claims

1. An interfering RNA targeting JAK1, characterized in that, The target site sequence of the interfering RNA contains one or more of the nucleotide sequences shown in SEQ ID NO: 1-14.

2. The interfering RNA according to claim 1, characterized in that, The interfering RNA includes one or more of siRNA, dsRNA, shRNA, aiRNA, or miRNA; Preferably, the interfering RNA is siRNA.

3. The interfering RNA according to claim 1 or 2, characterized in that, The interfering RNA further includes dangling bases; preferably, the interfering RNA contains 1-10 dangling bases.

4. The interfering RNA according to claim 3, characterized in that, The dangling base is located at the 3' end of the sense and / or antisense strands of the interfering RNA.

5. The interfering RNA according to claim 3 or 4, characterized in that, The suspended bases mentioned include, but are not limited to, dTdT, UU, or UG; Preferably, the suspended base is dTdT.

6. The interfering RNA according to any one of claims 1-5, characterized in that, The interfering RNA contains a sense strand and / or an antisense strand; Preferably, the positive strand comprises any one or more of the nucleotide sequences shown in SEQ ID NO: 15-28; Preferably, the antisense strand comprises any one or more of the nucleotide sequences shown in SEQ ID NO: 29-42.

7. The interfering RNA according to any one of claims 1-6, characterized in that, The interfering RNA further includes at least one modification; the modification includes modifications on the bases, sugar rings and / or phosphate backbone; Preferably, the modifications performed on the bases include, but are not limited to, 5-position pyrimidine modification, 8-position purine modification, pseudouracil modification, and / or 5-bromouracil substitution; Preferably, the modifications performed on the sugar ring include, but are not limited to, 2'-hydroxyl modification, 2'-fluorine modification, 2'-deoxy modification, 2'-alkyl modification, 2'-O-methyl modification, 2'-O-methoxyethyl modification, 2'-O-allyl modification, 2'-C-allyl modification, and locked nucleotide modification; Preferably, the modifications performed on the phosphate backbone include, but are not limited to, thiophosphate modification and ligand modification.

8. The interfering RNA according to claim 7, characterized in that, The modifications also include nucleotides having inosine, piracetam, xanthine, 2'-methylribose, non-natural phosphodiester bonds (such as methylphosphonates, thiophosphonates) and / or peptides.

9. The interfering RNA according to claim 7, characterized in that, The ligands are selected from cholesterol, biotin, vitamins, galactose derivatives or analogs, lactose derivatives or analogs, N-acetylgalactosamine (GalNAc), N-acetylgalactosamine derivatives or analogs, N-acetylglucosamine derivatives or analogs, 6-phosphorylated mannose (M6P) derivatives or analogs, or any combination of two or more thereof.

10. The interfering RNA according to claim 9, characterized in that: The structural formula of the N-acetylgalactosamine derivative or analog is:

11. A delivery system for interfering RNA according to any one of claims 1-10, characterized in that, The delivery system comprises the interfering RNA and vector as described in any one of claims 1-10.

12. The delivery system according to claim 11, characterized in that, The carrier may be a viral carrier or a non-viral carrier; Preferably, the viral vector includes one or a combination of two or more of the following: lentiviral vector, retroviral vector, adenovirus vector, adeno-associated virus vector, poxvirus vector, or herpesvirus vector. Preferably, the non-viral vector includes any one or a combination of two or more of the following: liposomes, lipid nanoparticles, polymers, peptides, antibodies, aptamers, and N-acetylgalactosamine (GalNAc).

13. The delivery system according to claim 12, characterized in that, The lipid nanoparticles / liposomes include one or more of the following: cationic lipids, neutral lipids, polyethylene glycol lipids, steroidal lipids, and anionic lipids.

14. The delivery system according to claim 13, characterized in that, The cationic lipids include: octadecylamide (SA), lauryltrimethylammonium bromide, hexadecyltrimethylammonium bromide, myristyltrimethylammonium bromide, dimethyl dioctadecylammonium bromide (DDAB), ((4-hydroxybutyl)azadialkyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), 1,2-dioleoyloxy-3-(trimethylammonium)propane (DOTAP), 1,2-di-(9Z-octadecenoyl)- 3-Trimethylammonium-propane and 1,2-di-hexadecyl-3-trimethylammonium-propane, 3β-[N-(N',N'-dimethylaminoethane)-carbamoyl]cholesterol (DC cholesterol), dimethyloctadecylammonium (DDA), 1,2-dimyristoyl-3-trimethylammonium propane (DMTAP), dipalmitoyl(C16:0)trimethylammonium propane (DPTAP), distearyltrimethylammonium propane (DSTAP), N-[1-(2, [3-Diallyloxy]propyl-N,N,N-trimethylammonium chloride (DOTMA), N,N-dioleoyl-N,N-dimethylammonium chloride (DODAC), 1,2-dioleoyl-sn-propanetrioxy-3-ethylphosphocholine (DOEPC), 1,2-dioleoyl-3-dimethylammonium propane (DODAP), 1,2-dilinoleyloxy-3-dimethylaminopropane (DLinDMA), 1,2-di-tetradecanoyl-3-dimethylammonium 1,2-Di-hexadecanoyl-3-dimethylammonium-propane and 1,2-di-octadecanoyl-3-dimethylammonium-propane, 1,2-dioleoyl-c-(4'-trimethylammonium)-butyryl-sn-glycerol (DOTB), di-octadecanoyl-alanylspermine, SAINT-2, polycationic lipid 2,3-dioleoyloxy-N-[2(spermine-carboxylamino)ethyl]-N,N-dimethyl-1-propanetrimonium trifluoroacetate (DOSPA) One or more of the following: methyl 4-(N,N-dimethylamino)butyrate (dilin-MC3-DMA).

15. The delivery system according to claim 13, characterized in that, The neutral lipids include one or more of the following: 1,2-distearyl-sn-glycerol-3-phosphate choline (DSPC), 1,2-dipalmitoyl-sn-glycerol-3-phosphate choline (DPPC), 1,2-dioleoyl-sn-glycerol-3-phosphate ethanolamine (DOPE), 1,2-dipalmitoyl-sn-glycerol-3-phosphate ethanolamine (DPPE), 1,2-dimyristoyl-sn-glycerol-3-phosphate ethanolamine (DMPE), 2-dioleoyl-sn-glycerol-3-phosphate-(1'-rac-glycerol) (DOPG), oleoylphosphatidylcholine (POPC), 1-palmitoyl-2-oleoylphosphatidylethanolamine (POPE), and distearylphosphatidylethanolamine (DSPE).

16. The delivery system according to claim 13, characterized in that, The polyethylene glycol lipids include: 2-[(polyethylene glycol)-2000]-N,N-tetracosylacetamide (ALC-0159), 1,2-dimyristoyl-sn-glycerol methoxy polyethylene glycol (PEG-DMG), 1,2-distearate-sn-glycerol-3-phosphate ethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG-disterol glycerol (PEG-DSG), PEG-dipalmitoyl, PEG-dioleoyl, PEG-distearate, PEG-diacylglycerol amide (PEG-DAG), PEG-dispalmitoylphosphatidylethanolamine (PEG-DPPE), or PEG-1,2-dimyristoyloxypropyl-3-amine (PEG-c-DMA). One or more of the following; Where n is selected from integers between 20 and 300.

17. The delivery system according to claim 13, characterized in that, The polyethylene glycol lipid is a polyethylene glycol lipid with a single molecular weight. Preferably, the polyethylene glycol lipid comprises:

18. The delivery system according to claim 13, characterized in that, The cationic lipid is a steroid-cationic lipid compound. The structure of the compound is as follows:

19. The delivery system according to claim 13, characterized in that, The anionic liposomes include one or more of the following: dioleoylphosphatidylglycerol, dioleoylphosphatidylethanolamine, etc.

20. The delivery system according to claim 13, characterized in that, The steroidal lipids include one or more of the following: alfalfa sterol, β-sitosterol, brassosterol, ergocalciferol, campesterol, cholesterol, coccidosterol, dehydrocholesterol, sterol, dihydroergocalciferol, dihydrocholesterol, dihydroergosterol, stigmasterol, epicholesterol, ergosterol, fucosterol, hexahydrophotosterol, hydroxycholesterol, lanosterol, photosterol, phycosterol, sitosterol, stigmasterol, stigmasterol, cholic acid, glycocholic acid, taurocholic acid, deoxycholic acid, and lithocholic acid.

21. A cell, characterized in that, The cell contains the interfering RNA as described in any one of claims 1-10 or the delivery system as described in any one of claims 11-20.

22. A method for preparing cells, characterized in that, The preparation method includes introducing the interfering RNA according to any one of claims 1-10 or the delivery system according to any one of claims 11-20 into cells.

23. A drug or reagent kit, characterized in that, The drug or kit comprises the interfering RNA of any one of claims 1-10, the delivery system of any one of claims 11-20, or the cell of claim 21.

24. An antibody-nucleic acid conjugate drug, characterized in that, The antibody-nucleic acid conjugate contains the interfering RNA as described in any one of claims 1-10 or the delivery system as described in any one of claims 11-20.

25. The antibody-nucleic acid conjugate drug according to claim 24, characterized in that, The general formula (I) of the antibody-nucleic acid conjugate drug is: Wherein, R is the interfering RNA according to any one of claims 1-10; x1 is an integer from 1 to 144; preferably, x1 is an integer from 1 to 9; more preferably, x1 is an integer from 1 to 3. x2 is an integer from 1 to 8; preferably, x2 is an integer from 1 to 2. Ab represents antibodies; L is the connection unit connecting Ab and R.

26. The antibody-nucleic acid conjugate drug according to claim 25, characterized in that, The L portion has a general formula (II) structure: in, In Formula II, x3 is selected from integers from 1 to 12; preferably 1 to 3. In Formula II, x4 is selected from integers from 1 to 12; preferably 1 to 3. P1 and P2 may be the same or different polyethylene glycol residues; L1 is the connection unit connecting Ab and P1; L2 is the connection unit connecting P2 and R; A1 is the connection unit connecting P1 and P2; Preferably, P1 and P2 are independently selected from linear, Y-shaped, multi-branched polyethylene glycol residues; Preferably, P1 and P2 are single molecular weight polyethylene glycols with a molecular weight of 88-4400 Da; more preferably, the molecular weight of P1 and P2 is 176-1056 Da. Preferably, P1 and P2 are non-single molecular weight polyethylene glycols with a molecular weight of 1000 Da-40 kDa; More preferably, the molecular weights of P1 and P2 are 2000 Da to 10 kDa.

27. The antibody-nucleic acid conjugate drug according to claim 26, characterized in that, L1 is a linking group, selected from straight-chain or branched C. 1-12 Alkylene, C 6-12 Alpha-aryl, C 3-12 Cycloalkylene, -S-, -O-, -SS-、 A combination of one or more groups; The C of the straight chain or branched chain 1-12 Alkylene, C 6-12 aryl or C 3-12 Any H atom on a cycloalkylene group is replaced by -H, -F, -Cl, -Br, -I, -O-, -S-, -SO2, -NO2, C. 1-12 Alkyl chain, C 3-12 cycloalkyl, C 6-12 Aryl groups, substituted or unsubstituted heterocyclic groups, or substituted or unsubstituted heterocyclic alkyl groups Group substitution consisting of one or more groups in the group; The L2 is a linking group, selected from straight-chain or branched C groups. 1-12 Alkylene, C 6-12 Alpha-aryl, C 3-12 Cycloalkylene, -S-, -O-, -SS-、 A combination of one or more groups; The C of the straight chain or branched chain 1-12 Alkylene, C 6-12 aryl or C 3-12 Any H atom on a cycloalkylene group is replaced by -H, -F, -Cl, -Br, -I, -O-, -S-, -SO2, -NO2, or C. 1-12 Alkyl, C 3-12 cycloalkyl, C 6-12 Aryl groups, substituted or unsubstituted heterocyclic groups, or substituted or unsubstituted heterocyclic alkyl groups Group substitution consisting of one or more groups; Preferably, L1 is an amide bond, a hydrazone bond, and a thiol-maleimide bond; More preferably, L1 is an amide bond; Preferably, L2 is a disulfide bond and a thiol-maleimide bond; More preferably, the L2 is a disulfide bond.

28. The antibody-nucleic acid conjugate according to claim 26 or 27, characterized in that, A1 is a linking group connecting P1 and P2, selected from straight-chain or branched C groups. 1-12 Alkylene, C 6-12 Alpha-aryl, C 3-12 Cycloalkylene, -S-, -O-, -SS-、 A combination of one or more groups; The C of the straight chain or branched chain 1-12 Alkylene, C 6-12 aryl or C 3-12 Any H atom on a cycloalkylene group is replaced by -H, -F, -Cl, -Br, -I, -O-, -S-, -SO2, -NO2, or C. 1-12 Alkyl chain, C 3-12 cycloalkyl, C 6-12 Aryl groups, substituted or unsubstituted heterocyclic groups, or substituted or unsubstituted heterocyclic alkyl groups A group substitution consisting of one or more groups.

29. The antibody-nucleic acid conjugate according to any one of claims 25-28, characterized in that, The general formula (IV) for the antibody-nucleic acid conjugate is as follows: L1 is a linking group, selected from straight-chain or branched C. 1-12 Alkylene, C 6-12 Alpha-aryl, C 3-12 Cycloalkylene, -S-, -O-, -SS-、 A combination of one or more groups; Preferably, P1 consists of the same or different polyethylene glycol residues; Preferably, when P1 is a single molecular weight polyethylene glycol with a molecular weight of 88-4400 Da, more preferably, the molecular weight of P1 is 176-1056 Da. Preferably, P1 is a non-single molecular weight polyethylene glycol with a molecular weight of 1000 Da-40 kDa; more preferably, the molecular weight of P1 is 2000 Da-10 kDa. The L2 is a linking group, selected from straight-chain or branched C groups. 1-12 Alkylene, C 6-12 Alpha-aryl, C 3-12 Cycloalkylene, -S-, -O-, -SS-、 A combination of one or more groups; x1 is an integer from 1 to 144; preferably, x1 is an integer from 1 to 9; more preferably, x1 is an integer from 1 to 3. x2 is an integer from 1 to 8; preferably, x2 is an integer from 1 to 2.

30. The antibody-nucleic acid conjugate according to any one of claims 25-29, characterized in that, It has the following structure: The n1 is selected from an integer between 4 and 100, preferably between 4 and 24; n1 can be a constant or an average value.

31. The antibody-nucleic acid conjugate according to any one of claims 25-30, characterized in that, The Ab is selected from monoclonal antibodies, polyclonal antibodies, antibody fragments, and antibody fusion fragments; preferably, the Ab is a monoclonal antibody. More preferably, the Ab is selected from: anti-HER2 antibody, anti-EGFR antibody, anti-PMSA antibody, anti-VEGFR antibody, anti-CD30 antibody, anti-CD22 antibody, anti-CD56 antibody, anti-CD29 antibody, anti-GPNMB antibody, anti-CD138 antibody, anti-CD74 antibody, anti-ENPP3 antibody, anti-Nectin-4 antibody, anti-EGFRⅧ antibody, anti-SLC44A4 antibody, anti-mesothelin antibody, anti-ET8R antibody, anti-CD37 antibody, anti-CEACAM5 antibody, anti-CD70 antibody, anti-MUC16 antibody, anti-CD79b antibody, anti-MUC16 antibody, anti-Muc1 antibody, anti-CD3 antibody, anti-CD28 antibody, anti-CD38 antibody, anti-CD19 antibody, anti-PD-L1 antibody, anti-4-1BB antibody, etc.

32. The antibody-nucleic acid conjugate according to any one of claims 25-31, characterized in that, It has the following structure: The n1 and n2 are independent integers selected from 4 to 100, preferably 4 to 24; n1 and n2 can be constants or averages.

33. The application of any interfering RNA according to claims 1-10, any delivery system according to claims 11-20, the cell according to claim 21, the drug or kit according to claim 23, or the antibody-nucleic acid conjugate drug according to any claim 24-32, characterized in that, The applications include: A) Use in the preparation of medicaments for the treatment and / or prevention of diseases related to JAK / STAT signaling pathway dysregulation; B) Application in inhibiting JAK1 expression; C) Application in the treatment and / or prevention of diseases related to JAK / STAT signaling pathway dysregulation; Preferably, diseases associated with JAK / STAT signaling pathway dysregulation include autoimmune diseases or tumors.

34. A method for inhibiting JAK1 expression, characterized in that, The method includes adding the interfering RNA of any one of claims 1-10, the delivery system of any one of claims 11-20, the cell of claim 21, the drug or kit of claim 23, or the antibody-nucleic acid conjugate of any one of claims 24-32.

35. A method for treating diseases related to dysregulation of the JAK / STAT signaling pathway, characterized in that, The method includes administering to a subject a therapeutically effective amount of the interfering RNA of any one of claims 1-10, the delivery system of any one of claims 11-20, the cell of claim 21, the drug or kit of claim 23, or the antibody-nucleic acid conjugate of any one of claims 24-32.

36. The method according to claim 35, characterized in that, The diseases associated with the aforementioned JAK / STAT signaling pathway dysregulation include autoimmune diseases or tumors.

Images