Preparation method of tetanus full-length toxoid molecule inactivated by genetic engineering technology and application of tetanus full-length toxoid molecule as vaccine antigen

Abstract

The invention discloses a preparation method of tetanus full-length toxoid molecules inactivated by a genetic engineering technology and application of the tetanus full-length toxoid molecules as vaccine antigens, and belongs to the field of biological pharmacy. The technical problem to be solved by the invention is how to obtain a novel tetanus full-molecular vaccine with enhanced immune effect and improved protective efficacy. The preparation method of the tetanus full-length toxoid molecule disclosed by the invention comprises the following steps: introducing an expression vector of a coding gene containing ddmTT protein into a microorganism to express and purify the coding gene, so as to obtain the tetanus full-length toxoid molecule, the ddmTT protein is the ddmTT protein as shown in SEQ ID No. 6 (sequence identifier number 6). The tetanus full-length toxoid molecule (ddmTT) prepared by the invention has the advantages of no toxicity, high safety, low production cost, strong immunogenicity, high protective efficacy and quick response, and can be used as a novel vaccine for preventing tetanus toxin poisoning, a novel immunogen and a novel carrier molecule of a coupling conjugate vaccine.

Description

Technical Field

[0001] This invention belongs to the field of biopharmaceuticals, specifically relating to a method for preparing a full-length tetanus toxoid molecule inactivated by genetic engineering and its application as a vaccine antigen. Background Technology

[0002] Tetanus toxin (TeNT) is a neurotoxin produced by Clostridium tetani. Tetanus is a life-threatening disease characterized by muscle spasms, caused by a neurotoxin produced by Clostridium tetani. Tetanus typically occurs when Clostridium tetani enters the body through skin or mucous membrane wounds, multiplies in an anaerobic environment, and produces large amounts of toxin. This toxin prevents the release of neurotransmitters from inhibitory synapses in infected individuals, leading to hyperreflexia and skeletal muscle spasms, resulting in poisoning. After onset, the body exhibits tonic-clonic seizures, and death can occur due to asphyxiation or respiratory failure. Tetanus is highly toxic; the estimated lethal dose for humans is less than 2.5 ng / kg, and the mortality rate without treatment is as high as 40%.

[0003] Tetanus toxin is initially produced as a single 150 kDa protein, which is nicked by an endogenous protease into an active toxic form with a heavy chain (HC, 100 kDa) and a light chain (LC, 50 kDa). Therefore, tetanus toxin is a long peptide chain consisting of a light chain (L chain, 50 kDa) and a heavy chain (H chain, 100 kDa) linked together by non-covalent disulfide bonds. The C-terminal domain of the heavy chain is responsible for binding to nerve cells, followed by endocytosis to form vesicles and enter the cell. The N-terminal domain of the heavy chain primarily helps the light chain cross the vesicle membrane into the nerve cell. The light chain molecule is a zinc-dependent protease that links to the heavy chain via interchain disulfide bonds until the light chain reaches the cytoplasm. The disulfide bonds are then reduced, and the light chain is released into the neuronal cytoplasm, cleaving the neuronal soluble N-ethylmaleimide-sensitive attachment receptor (SNARE) protein, leading to the blockade of inhibitory neurotransmitter release and subsequent abnormal elevation of muscle enzymes, thereby exerting its toxic effect.

[0004] Tetanus is a preventable disease through vaccination. Because pathogenic tetanus bacteria are widespread in soil, unvaccinated individuals or those with weakened resistance to tetanus toxin can be reinfected in different environments or under different circumstances. Tetanus is one of the very few diseases that cannot be eradicated; therefore, continued vaccination or the development of more effective vaccines is necessary to control tetanus. Vaccination effectively prevents tetanus poisoning. Active immunization primarily involves administering a formaldehyde-inactivated tetanus toxoid vaccine, which induces the body to produce corresponding antibodies. For emergency patients or those infected with tetanus bacteria after injury, antibody production from tetanus toxoid vaccination takes time and is relatively slow to take effect. In these cases, passive immunization is needed to fill the gap, or newer, more effective vaccines that can rapidly generate an immune response and provide protection may be required.

[0005] Chemically inactivated TeNT using formaldehyde is known as tetanus toxoid (TT). TT theoretically can cover all neutralizing antibodies against all TeNT epitopes, but studies have shown that it cannot completely produce neutralizing antibodies against all TeNT epitopes. This indicates that formaldehyde inactivation technology causes major conformational changes in TT, resulting in lower immunogenicity than recombinant TeNT vaccines and a lack of certain specific neutralizing epitopes. One study showed that when formaldehyde inactivation conditions are too harsh, the protective effect of TT in vivo is minimal, and its immunogenicity is significantly reduced. Furthermore, variations in formaldehyde inactivation conditions between batches of tetanus toxoid can lead to batch-to-batch differences. Currently, the production process for tetanus toxoid in China often involves detoxification followed by purification. The drawback is that culture medium components in the toxin are easily cross-linked with toxin molecules via formaldehyde during detoxification, making purification difficult, time-consuming, and lengthy. Acellular DPT combined vaccine, a second-generation DPT vaccine, uses a co-purification process, making it difficult to precisely quantify the effective antigen components, posing challenges to production and quality control.

[0006] In recent years, recombinant protein vaccines have become an effective and widely used type of vaccine. Tetanus recombinant protein vaccines eliminate the risks associated with culturing and purifying high-risk tetanus toxin or inactivating tetanus toxin with formaldehyde. Previous studies have shown that the recombinant antigen THc in the tetanus toxin receptor-binding domain has good protective efficacy and is a potential candidate vaccine, with some vaccines already in clinical trials. However, research results indicate that the recombinant TL-HN fragment (the L and HN domains of TeNT) has even better protective efficacy and possesses more important neutralizing epitopes, playing a crucial role in TeNT immunoprotection. Therefore, the development of novel recombinant protein vaccines containing all tetanus antigen neutralizing epitopes for the prevention of tetanus poisoning is of great significance and promising application prospects.

[0007] Therefore, it is necessary to develop a novel vaccine containing all tetanus antigen-neutralizing epitopes in order to enhance the immune response and rapid immune reaction, thereby strengthening its immune protection. Summary of the Invention

[0008] The technical problem to be solved by the present invention is to provide a novel vaccine to prevent tetanus poisoning, which enhances the immune effect, improves the protective efficacy, and can also induce a rapid and efficient immune response to generate rapid protection against tetanus toxin.

[0009] To solve the above-mentioned technical problems, the present invention first provides a method for preparing a full-length tetanus toxoid molecule, the method comprising: introducing an expression vector containing a gene encoding a ddmTT protein into microorganisms to express and purify the gene encoding the gene, thereby obtaining a full-length tetanus toxoid molecule; The ddmTT protein is the ddmTT protein shown in SEQ ID No. 6.

[0010] In the above method, the sequence of the encoding gene may be SEQ ID No. 5.

[0011] In the above method, the microorganism can be Escherichia coli.

[0012] Furthermore, the Escherichia coli may be Escherichia coli BL21 (DE3), BL21 Star (DE3), Transetta (DE3), Rosetta (DE3), shuffle T7-B, or Origami 2 (DE3), etc.

[0013] In the above method, the expression vector can be resistant to common strains that can be screened, such as ampicillin or kanamycin resistance.

[0014] Furthermore, the expression vector may be a pTIG-Trx vector or a pET-28a(+)-NdeⅠ vector.

[0015] In one embodiment of the present invention, the expression vector containing the gene encoding the ddmTT protein is pTIG-ddmTT, where pTIG-ddmTT is a vector of pTIG-Trx. EcoR I and Xho The recombinant expression vector obtained by replacing the small DNA fragment between the recognition sequences with the DNA fragment shown in SEQ ID No. 5 is pTIG-ddmTT, which can express the ddmTT protein shown in SEQ ID No. 6.

[0016] In one embodiment of the present invention, the expression vector containing the gene encoding the ddmTT protein is pTrx-ET28-ddmTT, where pTrx-ET28-ddmTT is a vector of pET-28a(+)-NdeⅠ plasmid. Nde I and Xho I. The recombinant expression vector obtained by replacing the small DNA fragment between the recognition sequences with the DNA fragments shown in Trx gene sequence (SEQ ID No. 7) and SEQ ID No. 5. pTrx-ET28-ddmTT can express the ddmTT protein shown in SEQ ID No. 6.

[0017] In the above method, the purification can be carried out by ion exchange chromatography, and / or by superimposed thiavidin chromatography or hydrophobic chromatography.

[0018] Specifically, the purification can be carried out first by ion exchange chromatography, and then by superimposed thiavidin chromatography or hydrophobic chromatography.

[0019] The superimposed thiavidin chromatography or hydrophobic chromatography method is used to further purify or enrich the target protein ddmTT, thereby improving product quality and R&D technology.

[0020] Specifically, the ion exchange chromatography method can be anion exchange chromatography and / or cation exchange chromatography.

[0021] The ion exchange chromatography method can be performed once or multiple times in an environment with pH 5-8.

[0022] The ion exchange chromatography method can employ separate anion exchange, cation exchange, or separate anion and cation exchange.

[0023] In one embodiment of the present invention, the ion exchange chromatography steps are as follows: (1) Anion exchange at pH 8.0: After introducing the expression vector containing the gene encoding the ddmTT protein into microorganisms for gene expression, the bacterial cells were resuspended in buffer (20 mM Tris-HCl, 20 mM NaCl, pH 8.0). The lysed bacterial protein supernatant was passed through an anion exchange column (Q HP or Q BB) at an appropriate flow rate, and linear gradient elution was performed using elution buffer (20 mM Tris-HCl, 1 M NaCl, pH 8.0) (adjusting the NaCl concentration). The elution volume was controlled to be at least 50 times the column volume, and 1-2 column volumes were collected into an EP tube. The elution conditions for the target protein were approximately 10-20% salt (1 M NaCl). All crude products containing the target protein were mixed and used as the sample for the second purification step. (2) Anion exchange at pH 7.0: The crude product obtained in the first step was adjusted to pH 7.0 using buffer (20 mM PB, 20 mM NaCl, pH 6.0). Then, the pH-adjusted crude protein product was diluted with buffer (20 mM PB, 20 mM NaCl, pH 7.0) to increase the final volume to 6-8 times the original volume. The processed sample was passed through an anion exchange column at an appropriate flow rate. Impurities were eluted with buffer (20 mM PB, 20 mM NaCl, pH 7.0) and eluted with solution (20 mM PB, 1 M NaCl, pH 7.0). The NaCl concentration was adjusted for linear elution, and the elution volume was controlled at 25 CV-50 CV. Every 0.5-1 column volume was collected into an EP tube. All crude products containing the target protein were mixed together as the sample for the third purification step. (3) Anion exchange at pH 6.0 The crude product obtained in step two was adjusted to pH 6.0 using a buffer solution (20 mM citrate, 20 mM NaCl, pH 5.0). Then, the pH-adjusted crude protein product was diluted with a buffer solution (20 mM PB, 20 mM NaCl, pH 6.0), increasing the final volume to 6-8 times the original volume. The treated sample was passed through an anion exchange column at an appropriate flow rate. Impurities were eluted using a buffer solution (20 mM PB, 20 mM NaCl, pH 6.0). Linear elution was performed using an elution buffer (20 mM PB, 1 M NaCl, pH 6.0), adjusting the NaCl concentration. The elution volume was controlled at 20 CV, and the NaCl concentration at the elution endpoint was 200 mM. Samples were collected in increments of 0.5 CV. All products containing the target protein were mixed and used as the sample for purification in step four. (4) Cation exchange at pH 5.0 The product obtained in step 3 is adjusted to pH 5.0 using a buffer solution (20 mM citrate, 20 mM NaCl, pH 4.5). Then, the pH-adjusted protein product is diluted with another buffer solution (20 mM citrate, 20 mM NaCl, pH 5.0), increasing the final volume to 6-8 times the original volume. The treated sample is then passed through a cation exchange column (SPHP or SP BB) at an appropriate flow rate. Impurities are eluted using a buffer solution (20 mM citrate, 20 mM NaCl, pH 5.0). A NaCl concentration gradient is adjusted for elution, and the products from each gradient are collected. The target protein is obtained by eluting in approximately 200-500 mM NaCl gradient elution solution.

[0024] The second and third steps of anion exchange can retain one step, and under these conditions, the target protein can also be effectively purified.

[0025] In another embodiment of the present invention, the ion exchange chromatography steps are as follows: (1) Cation exchange at pH 5.0 After introducing the expression vector containing the gene encoding the ddmTT protein into microorganisms for gene expression, the bacterial cells were resuspended in buffer (20 mM PB, 20 mM NaCl, 1 M CO(NH2)2, pH 6.0). The lysed protein supernatant was eluted with buffer (20 mM citrate, 20 mM NaCl, 1 M CO(NH2)2, pH 5.0) at an appropriate flow rate through a cation exchange column (SP HP or SP BB) to remove contaminating proteins. Gradient elution was performed using (20 mM citrate, 1 M NaCl, 1 M CO(NH2)2, pH 5.0) (adjusting the NaCl concentration), and the elution products were collected. The target protein was obtained under elution conditions of 20-50% salt concentration. All crude products containing the target protein were mixed as the sample for the second purification step. (2) Anion exchange at pH 7.5 The crude product obtained in the first step is adjusted to pH 7.5 using a buffer solution (20 mM Tris-HCl, 20 mM NaCl, pH 8.0). Then, the pH-adjusted crude protein is diluted with a buffer solution (20 mM PB, 20 mM NaCl, pH 7.5), increasing the final volume to 6-8 times the original volume. The treated sample is then passed through an anion exchange column (QHP or QBB) at an appropriate flow rate. Impurities are eluted using a buffer solution (20 mM PB, 20 mM NaCl, pH 7.5), and then eluted with a NaCl concentration gradient solution (20 mM PB, 1 M NaCl, pH 7.5) at a salt concentration of 20-50% to obtain the target protein. The finally purified protein is desalted or exchanged in PBS or PB buffer (pH 7.4) and stored at -20°C or -80°C for later use.

[0026] The second step, anion exchange, can be performed using a pH 7 or pH 6.5 buffer (20 mM PB, 20 mM NaCl). After preparation, the purification process can be carried out effectively under these conditions.

[0027] The target protein obtained by anion and cation chromatography in the above two technical strategies is further purified by thioavidin chromatography (Belkin) or hydrophobic chromatography (such as butyl) to further purify or enrich the target protein ddmTT. The ddmTT products obtained are then further replaced with buffers such as PBS by membrane filtration or molecular sieve (75PG or S200) and stored as stock solutions for later use.

[0028] The tetanus toxoid molecule obtained by the method for preparing the full-length tetanus toxoid molecule, or a composition of the heavy and light chains of the tetanus toxoid molecule, is also within the scope of protection of this invention.

[0029] The use of the full-length tetanus toxoid molecule or the composition as a tetanus vaccine is also within the scope of protection of this invention.

[0030] The following applications of the method for preparing the full-length tetanus toxoid molecule also fall within the scope of protection of this invention: X1) Preparation of tetanus vaccine; X2) Prepare tetanus bacillus antibodies or tetanus toxin antibodies; X3) Prepare tetanus antiserum or tetanus toxin antiserum; X4) was used as a carrier protein to prepare conjugate vaccines; X5) Prepare tetanus toxin.

[0031] The following applications of the full-length tetanus toxoid molecule or the composition are also within the scope of protection of this invention: X1) Preparation of tetanus vaccine; X2) Prepare tetanus bacillus antibodies or tetanus toxin antibodies; X3) Prepare tetanus antiserum or tetanus toxin antiserum; X4) was used as a carrier protein to prepare conjugate vaccines; X5) Prepare tetanus toxin.

[0032] Unlike the method of preparing TT by formaldehyde inactivation, this invention uses genetic engineering to design a bidomain mutant molecule at key sites of the enzyme active domain and receptor binding domain of the tetanus toxin molecule. A tag-free recombinant plasmid expression vector was constructed, and the recombinant bidomain mutant protein molecule (named dddmTT) was purified, thus preparing a recombinant, non-toxic, full-length tetanus toxin molecule. Purification studies were then conducted using conventional chromatography, yielding the expected target protein. This recombinant bidomain mutant tetanus toxin molecule belongs to the genetically detoxified tetanus toxoid (gdTT), unlike the chemically inactivated tetanus toxoid (ciTT) by formaldehyde. Therefore, this invention also names it ddmTT (double domain mutant detoxified tetanus toxiod). Animal experiments have shown that this recombinant genetically engineered tetanus toxoid (ddmTT) protein molecule is not only non-toxic but also possesses good immunoprotective efficacy. Compared to TT and recombinant subunit vaccines inactivated by formaldehyde, the recombinant antigen ddmTT prepared in this invention has high safety, good immunogenicity, low production cost, and rapid onset of action. It can quickly generate a strong antibody response and protective effect, and can be used as a novel vaccine, novel immunogen, and novel carrier molecule for the prevention of tetanus toxin poisoning.

[0033] This invention focuses on tetanus toxoid, further advancing the pharmaceutical application of this genetically engineered toxoid antigen vaccine. The invention developed expression vectors, engineered bacterial strains, and purification methods; established a small-scale vaccine molecule processing technology; verified the vaccine's efficacy and its feasibility, effectiveness, and high efficiency as a novel vaccine; and established a research and development technical scheme for the full-length tetanus toxoid molecular antigen as a novel vaccine. This genetically engineered tetanus toxoid vaccine can replace traditional inactivated toxoid vaccines. This vaccine molecule does not require formaldehyde to inactivate the biological toxoid and can be directly used as a recombinant protein antigen vaccine for highly effective immunization against tetanus toxoid poisoning.

[0034] The genetically engineered tetanus toxoid vaccine of this invention has a single, stable, non-toxic, and impurity-free composition, making it suitable for large-scale preparation. It can rapidly generate a strong immune response and protective effect, resulting in better clinical application outcomes. It is a highly effective tetanus toxoid vaccine and also a highly effective immunogen. It can replace traditional toxoids in the preparation of tetanus antitoxin or be used as a carrier protein in the preparation of conjugate vaccines, and has broad application prospects.

[0035] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0036] Figure 1 SDS-PAGE electrophoresis diagram of the recombinant bifunctional mutant ddmTT protein molecule expressed by two resistance expression vectors in different strains. (a): Expression effect of BL21(DE3) engineered bacteria transformed with pTIG-ddmTT at different IPTG concentrations; (b): Expression effect of BL21(DE3) engineered bacteria transformed with pTrx-ET28-ddmTT at different IPTG concentrations; (c): Expression effect of BL21(DE3) engineered bacteria transformed with pTIG-ddmTT at different lactose concentrations; (d): Expression effect of BL21(DE3) engineered bacteria transformed with pTrx-ET28-ddmTT at different lactose concentrations; (e): Expression effect of Rosetta(DE3) (2,3), BL21 Star(DE3) (4,5), and Origamai 2(DE3) (6,7) engineered bacteria transformed with pTIG-ddmTT (2,4,6) and pTrx-ET28-ddmTT (3,5,7). Sample 1 is a negative control, and M is a protein size molecular marker. The red box and arrow indicate ddmTT protein (size 150). (kDa): (f): The results of inducing the expression of the target protein after the seed batch of the recombinant expression engineered strain stored at -80 degrees Celsius was revised, which proved that the seed batch of the engineered strain could effectively induce high expression of the recombinant protein; (g): The results of the induction expression of the recombinant engineered strain seed batch after long-term low-temperature storage as a seed batch, which proved the effectiveness and stability of the engineered strain in expressing the target protein.

[0037] Figure 2Identification of the recombinant bidomain mutant ddmTT protein. (a): SDS-PAGE electrophoresis identification of the purified recombinant tetanus toxin (rTeNT), the recombinant monodomain light chain mutant mTL-HN-THc (sdmTeNT1), and the recombinant monodomain receptor-binding domain mutant TL-HN-mTHc (sdmTeNT2). Lane 1: Protein molecular weight marker; Lane 2: rTeNT protein molecule; Lane 3: mTL-HN-THc protein molecule; Lane 4: TL-HN-mTHc protein molecule. Arrows indicate protein molecular positions (150 kDa). (b): SDS-PAGE identification results of ddmTT protein (pTrx-ET28-ddmTT transformed engineered bacteria) prepared by two methods. Lane 1: Reduction electrophoresis of ddmTT protein prepared by method 1; Lane 2: Protein molecular weight marker; Lane 3: Reduction electrophoresis of ddmTT protein prepared by method 2; Lane 4: Protein molecular weight marker; Lane 5: Non-reduction electrophoresis of ddmTT protein prepared by method 1; Lane 6: Non-reduction electrophoresis of ddmTT protein prepared by method 2. (c): SDS-PAGE identification results of ddmTT nicked with trypsin. Recombinant tetanus molecules and trypsin were mixed at a mass ratio of 100:1 and incubated at 37°C for 50 minutes. After incubation, trypsin inhibitor (final concentration 10 μg / mL) was added to terminate the reaction. The reaction products were identified by reduction electrophoresis and non-reduction electrophoresis. Lane 1: Reduction electrophoresis of ddmTT without trypsin incubation; Lane 2: Reduction electrophoresis of ddmTT with trypsin incubation (under reducing conditions, trypsin-deficient ddmTT produces a 100 kDa heavy chain H and a 50 kDa light chain L); Lane 3: Protein molecular weight marker; Lane 4: Non-reduction electrophoresis of ddmTT without trypsin incubation; Lane 5: Non-reduction electrophoresis of ddmTT with trypsin incubation (under non-reduction conditions, trypsin-deficient ddmTT produces a 100 kDa heavy chain H and a 50 kDa light chain L, which form a 150 kDa double-chain molecule via disulfide bonds). (d): SDS-PAGE identification results of ddmTT protein (pTIG-ddmTT) prepared by the two methods; Lane 1: Protein molecular weight marker; Lane 2: Reduction electrophoresis of ddmTT protein prepared by method 1; Lane 3: Reduction electrophoresis of ddmTT protein prepared by method 2; Lane 4: Protein molecular weight marker. (e): Western blot identification results of ddmTT, primary antibody is anti-TL-HN hyperimmune serum; Lane 1: Marker; Lane 2: Purified product of method 1; Lane 3: Purified product of method 2.(f): Western blot identification results of ddmTT, primary antibody is anti-THc hyperimmune serum; Lane 1: Protein Marker; Purified product of Method 1; Lane 2: Purified product of Method 2; Arrows in the figure indicate the target protein of ddmTT (150 kDa).

[0038] Figure 3 Electrophoresis results of in vitro enzyme activity assays of ddmTT and rTeNT proteins. Different concentrations of single- and double-stranded ddmTT and rTeNT molecules were reacted with 14 μM Trx-rVAMP2 (30-92AA) and 10 μM Trx-hVAMP1 (34-87AA) proteins in PBS, respectively, to a final reaction volume of 50 μL. (a): cleavage of substrate by single-stranded ddmTT molecules; (b): cleavage of substrate by double-stranded ddmTT molecules; (c): cleavage of substrate by single-stranded rTeNT molecules; all green arrows in the figure represent Trx-rVAMP2 (30-92AA), and red arrows represent Trx-hVAMP1 (34-87AA). Lanes 1-4 represent 0, 1000, 2000, and 4000 nM ddmTeNT or rTeNT + 14 μM Trx-rVAMP2 (30-92AA), respectively; lanes 5-8 represent 0, 666.5, 1333, and 2666 nM ddmTT or rTeNT + 10 μM Trx-hVAMP1 (34-87AA), respectively. (d): Results of rTeNT double-stranded molecules cleaving the substrate Trx-rVAMP2 (30-92AA); lanes 1-6 represent 0, 7.81, 31.25, 125, 500, and 2000 nM rTeNT + 14 μM Trx-rVAMP2 (30-92AA), respectively. (e): Results of rTeNT double-stranded molecules cleaving the substrate Trx-hVAMP1 (34-87AA). Lanes 1-6 are 0, 20.83, 83.31, 333.25, 1333, and 2666 nM rTeNT+ 10 μM Trx-hVAMP1 (34-87AA), respectively. All black arrows in the figure represent the substrate, and green arrows represent the cleavage products.

[0039] Figure 4Schematic diagram of the .ddmTT molecular structure and mutation sites. Note: The mutation sites belong to the Helih sequence of the light chain enzyme active site and the SXWY sequence of the ganglioside binding site of the heavy chain receptor binding region THc in the TL-HN functional structural region of the tetanus toxin L chain. H233A, E234A, and H237A are enzyme active sites with mutations in the L chain; R1226L, W1289L, and Y1290F are ganglioside binding sites with mutations in the receptor binding region. Specific sequence information: In the enzyme active site, H(CAC)233 is mutated to A(GCA), E(GAA)234 is mutated to A(GCA), and H(CAC)237 is mutated to A(GCA). At the ganglioside binding site, R(CGT)1226 is mutated to L(CTG), W(TGG)1289 is mutated to L(CTG), and Y(TAC)1290 is mutated to F(TTC).

[0040] Figure 5 SDS-PAGE identification of adsorption completeness experiment. (a) Electrophoretic identification results of ddmTT proteins under various treatments after 1 hour of reaction with aluminum adjuvant at room temperature; (b) Electrophoretic identification results of ddmTT proteins under various treatments after 3 hours of reaction with aluminum adjuvant at room temperature; (c) Electrophoretic identification results of ddmTT proteins under various treatments after 6 hours of reaction with aluminum adjuvant at room temperature. Lane 1: Protein molecular weight marker; Lane 2: 40 μg / mL ddmTT protein sample; Lane 3: 40 μg / mL ddmTT vaccine sample supernatant after centrifugation; Lane 4: 40 μg / mL ddmTT vaccine sample supernatant after centrifugation precipitation and desorption; Lane 5: 100 μg / mL ddmTT protein sample; Lane 6: 100 μg / mL ddmTT vaccine sample supernatant after centrifugation; Lane 7: 100 μg / mL ddmTT vaccine sample supernatant after centrifugation precipitation and desorption.

[0041] Figure 6 Figure 1 shows the antibody titer results of a comparative experiment on the immunization efficacy of ddmTT antigen vaccines prepared by different purification methods. (a): Antibody titer of ddmTT antigen prepared by method 1 at each immunization dose; (b): Antibody titer of ddmTT antigen prepared by method 2 at each immunization dose.

[0042] Figure 7Antibody titers at various time points in the rapid protective efficacy study following booster immunization of .ddmTT (mTeNT) and TT vaccines. (a): Anti-TL-HN antibody titers detected at various time points before booster immunization, coated with TL-HN antigen; (b): Anti-THc antibody titers detected at various time points before booster immunization, coated with THc antigen; (c): Anti-TL-HN antibody titers detected at various time points after booster immunization, coated with TL-HN antigen; (d): Anti-THc antibody titers detected at various time points after booster immunization, coated with THc antigen.

[0043] Figure 8 Figure 1 shows the serum IgG antibody levels after a single immunization with each antigen vaccine group using ELISA. (a) Serum IgG antibody level against TL-HN after a single 1 μg immunization with TL-HN-coated serum; (b) Serum IgG antibody level against TL-HN after a single 1 μg immunization with THc-coated serum; (c) Serum IgG antibody level against TL-HN after a single 10 μg immunization with TL-HN-coated serum; (d) Serum IgG antibody level against THc after a single 10 μg immunization with THc-coated serum. Detailed Implementation

[0044] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are commercially available.

[0045] All data in the following examples were analyzed using GraphPad Prism 5.0 and SPSS software. Experimental results are expressed as mean ± standard error (mean ± SD). Differences between paired experiments were analyzed using t-tests and chi-square tests, or one-way ANOVA to determine statistical significance. ns: no statistically significant difference; *: P < 0.05; **: P < 0.01; ***: P < 0.001; ****: P < 0.0001.

[0046] Unless otherwise specified, the methods used in the following examples are conventional methods. For specific steps, please refer to: *Molecular Cloning: A Laboratory Manual* (Sambrook, J., Russell, David W., *Molecular Cloning: A Laboratory Manual*, 3rd edition). rd (edition, 2001, NY, Cold Spring Harbor) and the Pharmacopoeia of the People's Republic of China (edited by the National Pharmacopoeia Commission, Volume III, 2020, China Medical Science and Technology Press).

[0047] Example 1: Construction of a full-length tetanus toxoid expression vector and its expression and identification in engineered Escherichia coli. I. Design and Synthesis of Tetanus Toxin Protective Functional Domain Antigens (TL-HN, THc) Genes Based on the full-length gene sequence and amino acid residue sequence of tetanus toxin (reference strains were Clostridium tetani CMCC64008 and strain 64001, with a full-length tetanus toxin of 1315 amino acids) as the amino acid sequence source for the full-length tetanus toxoid molecule in this embodiment, the TL-HN and THc gene sequences were synthesized, and sites related to toxicity without affecting the antigenic epitope were mutated. For example, the ganglioside binding site of THc in the receptor binding region was mutated and named mTHc; the enzyme active site of the light chain in TL-HN was mutated and named mTL-HN (Table 1).

[0048] Genes encoding the tetanus toxin functional domains THc and TL-HN, along with their mutants, were artificially synthesized based on codon degeneracy optimization. These genes were then directly cloned into pMV and other cloning vectors for later use (detailed antigen and sequence information are shown in Table 1; gene sequences were directly synthesized by BGI Genomics). To facilitate subsequent operations, an antigen was introduced at the 5′ end of the mTL-HN gene during the cloning of these artificially synthesized genes. EcoR The I and 3′ ends introduced BamH The I restriction enzyme recognition site is introduced at the 5′ end of the mTHc gene. BamH The I and 3′ ends introduced Xho I. Restriction site for enzyme cleavage. The above gene design uses codons commonly used in E. coli and ensures that the encoded amino acid residue sequence remains unchanged.

[0049] The synthesized DNA molecule sequence containing the mTL-HN gene is shown in SEQ ID No. 1, and the synthesized DNA molecule sequence containing the mTHc gene is shown in SEQ ID No. 3.

[0050] Table 1. Information on the antigenic molecules containing protective functional domains in the full-length tetanus toxin molecule.

[0051] Note: When synthesizing the mTHc gene, a TAG stop codon was introduced at the 3' end of the mTHc gene to terminate its translation and remove any tag.

[0052] II. Construction and Identification of Recombinant Prokaryotic Expression Vectors 2.1 Construction of pTIG-ddmTT expression vector First, to facilitate the cloning of multiple target genes into the prokaryotic expression vector pTIG-Trx, this invention first... BamHI (GGATTC, encoding the GS small linker peptide) was cloned into pTIG-Trx EcoR I and Xho Between I, the entire expression vector has three cloning restriction sites ( EcoR I, BamH I and Xho I), which facilitates the cloning of two genes or DNA fragments, this expression vector is named pTIG-Trx-M.

[0053] use" EcoR I and BamH I” The plasmid containing the target gene sequence mTL-HN obtained in step one above was digested with two enzymes respectively, and the corresponding target gene fragments were recovered using a DNA recovery kit. These fragments were then ligated with the prokaryotic expression vector pTIG-Trx-M, which had been digested with the same enzymes. The ligation product was transformed into E. coli. E. coli Fast-T1 competent cells (Full Gold) were used to screen for positive clones, plasmids were extracted, and sequencing was performed to obtain the recombinant prokaryotic expression vector pTIG-Trx-mTL-HN with correct sequence and insertion position. Then, the expression vector was... BamH I and Xho I” The mTHc plasmids containing the target gene sequence obtained above were double-digested with enzymes, and the corresponding target gene fragments were recovered using a DNA recovery kit. They were then ligated with the recombinant prokaryotic expression vector pTIG-Trx-mTL-HN containing the mTL-HN gene sequence obtained above after double digestion with the same enzymes. The ligation product was transformed into E. coli Fast-T1 competent cells, and positive clones were screened. The recombinant prokaryotic expression vector containing the full-length toxin molecule gene sequence containing mTL-HN and mTHc with correct sequence and insertion position was named pTIG-Trx-mTL-HN-mTHc (or simply pTIG-ddmTT). The expression product was an untagged ddmTT bifunctional mutant protein molecule (Table 2).

[0054] pTIG-ddmTT is a vector for pTIG-Trx. EcoR I and Xho The recombinant expression vector pTIG-ddmTT, obtained by replacing the small DNA fragment between the recognition sequences with the DNA fragment shown in SEQ ID No. 5 (denoted as the ddmTT gene), can express the ddmTT protein shown in SEQ ID No. 6.

[0055] Among them, the pTIG-Trx vector is a vector of the pET-22b(+) vector. Nde I and EcoRThe recombinant vector obtained by replacing the small DNA fragment between the recognition sequences with the DNA fragment shown in positions 1-342 of SEQ ID No. 7 contains the DNA fragment shown in SEQ ID No. 7. Specifically, positions 1-348 of SEQ ID No. 7 are... Trx The gene sequence. Further through... Xho I and Sac I Two restriction enzyme sites were used to replace the his tag of the expression vector pTIG-Trx with a Twin Strep tag (TS tag for short, gene sequence TGGAGCCACCCCCAGTTCGAGAAGGGCGGCGGCAGCGGCGGCGGCAGCGGCGGCAGCGGCGGCAGCGCCTGGAGCCACCCCCAG TTCGAGAAG, encoding amino acid WSHPQFEK-(GGGS)2-GGSAWSHPQFEK). The resulting expression vectors were named pTIG-Trx-TS, and the target protein can be purified by the Strep-tag tag.

[0056] Building upon the above research, three control recombinant tetanus toxin expression vectors (Table 2) were constructed using relevant resources and vectors: pTIG-Trx-TL-HN-THc (abbreviated as pTIG-rTeNT-TS), pTIG-Trx-mTL-HN-THc-TS (pTIG-sdmTeNT1), and pTIG-Trx-TL-HN-mTHc-TS (pTIG-sdmTeNT2). The expression products were recombinant tetanus toxin (rTeNT), a recombinant single-domain light chain mutant mTL-HN-THc, and a recombinant single-domain receptor-binding region mutant TL-HN-mTHc, respectively. The recombinant proteins expressed by these three vectors carried a streptoxin TS tag, facilitating purification using a streptoxin TS chromatography column. After sequence determination, the correct expression vectors were obtained for use in the subsequent expression and purification studies.

[0057] pTIG-rTeNT-TS is a vector of pTIG-Trx. EcoR I and Xho The recombinant expression vector pTIG-rTeNT-TS, obtained by replacing the small DNA fragments between the I recognition sequences with the rTeNT gene fragment, can express the fusion protein of rTeNT and TS tags.

[0058] pTIG-Trx-mTL-HN-THc-TS is a vector for pTIG-Trx. EcoR I and XhoThe recombinant expression vector pTIG-Trx-mTL-HN-THc-TS, obtained by replacing the small DNA fragment between the I recognition sequences with the mTL-HN-THc gene fragment, can express the fusion protein of mTL-HN-THc and the TS tag.

[0059] pTIG-Trx-TL-HN-mTHc-TS is a vector for pTIG-Trx. EcoR I and Xho The recombinant expression vector pTIG-Trx-TL-HN-mTHc-TS, obtained by replacing the small DNA fragment between the I recognition sequences with the TL-HN-mTHc gene fragment, can express the fusion protein of TL-HN-mTHc and the TS tag.

[0060] 2.2 Construction of pTRX-ET28-ddmTT expression vector Given that the pTIG-Trx vector is an expression vector carrying AMP resistance, in order to verify the universality of the expression vector and for future research on the fermentation process of engineered strains, this example also prepared a kanamycin resistance expression vector. Using pET28a as the kanamycin resistance vector, the pTRX-ET28-ddmTT expression vector was constructed. The vector construction process is as follows: (1) Using pET-28a(+) plasmid as a template, primers were designed to... Nco I. Mutation of the enzyme cleavage site Nde I. Restriction site: The CTTTAAGAAGGAGATATACCATGGGCAGCAGCCATCATCAT sequence in the pET-28a(+) plasmid was modified to CTTTAAGAAGGAGATATACATATGGCAGCAGCCATCATCAT, resulting in the pET-28a(+)-NdeⅠ plasmid. The obtained plasmid was sequenced, and the vector with correct sequencing was named pET-28a(+)-NdeⅠ and stored for later use.

[0061] (2) Use of restriction endonucleases Nde I and Xho I. The pTIG-ddmTT expression vector (Amp resistant) was double-digested, identified by nucleic acid electrophoresis, and the DNA fragments (containing...) were recovered from the gel. Trx (Gene and ddmTT gene), while using endonuclease Nde I and Xho I. The pET-28a(+)-NdeⅠ plasmid was digested with enzymes, and the 5262 bp vector fragment was recovered. The two fragments were ligated using T4 DNA ligase, and the ligation product was transformed into Fast-T1 competent cells. Positive clones were screened by plate selection and sequenced. The vector with correct sequencing results is the kanamycin resistance expression vector pTrx-ET28-ddmTT.

[0062] 2.3 Identification of expression vector whole plasmid by sequencing The two expression vectors (pTIG-ddmTT and pTrx-ET28-ddmTT) were identified by whole plasmid sequencing. The sequencing results were compared with the theoretical sequences using DNAMAN. The results showed that the two plasmid sequences were completely consistent with the theoretical sequences, and all elements of the expression vectors, as well as the resistance and target genes, were correct and effective.

[0063] Table 2. Information on recombinant tetanus toxoid (ddmTT) protein molecules and three recombinant tetanus toxoid molecules.

[0064] Note: The TeNT mutant (ddmTT) molecule is composed of two functional domains: the mTL-HN domain and the receptor-binding domain mTHc, linked by a GS linker peptide (gene sequence GGATCC, amino acid sequence GS). The mutation sites are located at the light chain enzyme active site and the receptor-binding ganglioside binding site. Detailed information is as follows: the core toxicity sites of the L chain are H(CAC)233 mutated to A(GCA), E(GAA)234 mutated to A(GCA), and H(CAC)237 mutated to A(GCA); the core toxicity sites of the Hc chain are R(CGT)1226 mutated to L(CTG), W(TGG)1289 mutated to L(CTG), and Y(TAC)1290 mutated to F(TTC). See the structural diagram below. Figure 4 The gene sequence is shown in SEQ ID No. 5, and the amino acid sequence is shown in SEQ ID No. 6. The three control recombinant tetanus toxin molecules are recombinant tetanus toxin (rTeNT), the recombinant single-domain light chain mutant mTL-HN-THc (sdmTeNT1), and the recombinant single-domain receptor-binding region mutant TL-HN-mTHc (sdmTeNT2). Except for the six mutation sites in ddmTT, the sequence of rTeNT is identical to that of ddmTT; the sequences at the six mutation sites are unmutated. The light chain of mTL-HN-THc is identical to that of ddmTT, and the other sequences are identical to those of rTeNT. The receptor-binding region of TL-HN-mTHc is identical to that of ddmTT, and the other sequences are identical to those of rTeNT.

[0065] III. Expression and Identification of Unlabeled dddmTT Bifunctional Mutant Protein in Escherichia coli The recombinant prokaryotic expression vectors (pTIG-ddmTT and pTrx-ET28-ddmTT) constructed in step two, as well as the empty pTIG-Trx vector, were introduced into Escherichia coli BL21(DE3) (full gold) competent cells to obtain recombinant bacteria BL21 / pTIG-ddmTT, BL21 / pTrx-ET28-ddmTT, and BL21 / pTIG-Trx.

[0066] Each recombinant strain was cultured in small quantities on LB medium with corresponding antibiotics at 37°C and 250 rpm until the logarithmic growth phase (OD200). 600 IPTG (isopropyl galactothioglycoside) was added at a concentration of approximately 0.6-1.0 mM to achieve final concentrations of 0.1 mM, 0.2 mM, 0.4 mM, and 0.8 mM, respectively. Expression was induced for at least 12 hours at 18 ℃ and 220 r / min. After culture, the bacterial cells were collected by centrifugation, resuspended in different buffers, and sonicated. The supernatant was then used for 12% SDS-PAGE analysis. The results showed that the recombinant bacteria BL21 / pTIG-ddmTT and BL21 / pTrx-ET28-ddmTT effectively expressed the target protein (approximately 150 kDa) and co-expressed the lysing molecule Trx (approximately 13 kDa) under various conditions, with the sizes as expected. This protein band was absent in the empty vector control group or the uninduced recombinant bacterial group. Figure 1 (a, b). Other strains transformed with the above expression vectors, such as BL21 star (DE3), Transetta (DE3), Rosetta (DE3), shuffle T7-B, and Origami 2 (DE3), were also able to express the ddmTT target protein. Figure 1 (e). By optimizing the induction conditions, adding 1-3% (w / v) glucose to the culture medium and inducing with 0.2-0.4 mM IPTG can further enhance the expression level of the target protein. Additionally, lactose, when used as an inducer, can also express the target protein under different lactose concentrations. Figure 1 (c, d). Both the recombinant prokaryotic expression vectors and recombinant engineered strains obtained from the above transformations can be preserved as seed batches for future use. Figure 1 f, g).

[0067] IV. Expression, purification, and identification of recombinant tetanus toxin and its mutants The three recombinant prokaryotic expression vectors (pTIG-rTeNT-TS, pTIG-sdmTeNT1, and pTIG-sdmTeNT2) constructed in step two were transformed into *E. coli* BL21(DE3) competent cells. Positive recombinants were screened, with recombinant bacteria transformed with the empty pTIG-Trx vector serving as a negative control. The positive recombinant bacteria were then inoculated at a 1:100 ratio into 500 mL of LB broth containing 100 mg / mL ampicillin and cultured at 37°C and 250 rpm until the logarithmic growth phase (OD200) was reached. 600 When the concentration of the chemical inducer IPTG was approximately 0.6-1.0, it was added to a final concentration of 0.2 mmol / L, and the cells were cultured overnight at 18 ℃ with shaking at 220 r / min. After culture, the cells were collected by centrifugation, resuspended in 20 mM Tris-HCl buffer (pH 8.0), and the cells were sonicated to disrupt the cell structure. The supernatant was collected by centrifugation and analyzed by 12% SDS-PAGE. The results showed that the recombinant protein and the co-expressed lysinogen Trx (approximately 13 kDa) were expressed and existed in a soluble form. However, no band of the target protein was found in the uninduced strain and the induced empty vector control, indicating that the expressed protein was the target protein, namely the recombinant protein molecules (approximately 150 kDa).

[0068] The C-terminus of each of the above recombinant toxin protein molecules contains a streptoxin TS tag. Therefore, the soluble expression products were purified using a streptoxin affinity chromatography column (Pharmacia) according to the manufacturer's instructions to obtain the eluted purified protein. The purified protein was then analyzed by 12% SDS-PAGE, and the results showed that the purified target protein was obtained. Figure 2 (a) The expected sizes were correct, representing recombinant tetanus toxin (rTeNT), recombinant single-domain light chain mutant mTL-HN-THc (sdmTeNT1), and recombinant single-domain receptor-binding domain mutant TL-HN-mTHc (sdmTeNT2), respectively. Detailed information is shown in Table 2. The obtained target proteins were stored at -20 ℃ or -80 ℃ for later use.

[0069] Example 2: Study on purification method of tag-free recombinant genetically engineered tetanus toxoid (ddmTT) protein molecules Recombinant engineered bacteria: BL21 / pTIG-ddmTT and BL21 / pTrx-ET28-ddmTT, etc., from Example 1.

[0070] After culturing the recombinant bacteria, they were inoculated at a ratio of 1:100 into 500 mL of LB liquid medium containing 100 mg / mL ampicillin or kanamycin, and cultured in large quantities at 37 ℃ and 250 rpm until the logarithmic growth phase (OD200) was reached. 600When the concentration of the culture medium is approximately 0.6-1.0, add the chemical inducer IPTG to a final concentration of 0.2-0.4 mmol / L, and incubate at 30 ℃ with shaking at 220 r / min for 4-5 hours, or at 18 ℃ with shaking at 220 r / min overnight. After incubation, collect the bacterial cells by centrifugation for later use, or resuspend them in different buffers (20 mM sodium phosphate buffer, pH 8.0; 20 mM Tris-HCl, 20 mM NaCl, pH 8.0), sonicate to disrupt the bacteria, and collect the supernatant by centrifugation for purification studies of the target protein.

[0071] The ddmTT protein has a molecular weight of approximately 150 kDa and a theoretical isoelectric point of approximately 5.6. This example uses several different purification protocols to purify the tag-free ddmTT protein. After extensive experimentation, two relatively stable and effective purification methods were ultimately developed. The anion and cation chromatography columns and packing materials used in the purification methods, including QHP, QBB, HiPrep SPFF, SPHP, and SPBB, were all from Cytiva. The purification equipment was an AKTA GO protein purifier (Cytiva).

[0072] I. Anion-Cation Chromatography Purification Combination Scheme The first method consists of four steps, involving three anion exchanges and one cation exchange to purify the target protein. The design theory is to first bind the negatively charged ddmTT protein in a high pH buffer using anion exchange chromatography material, then gradually lower the pH to remove impurities, and finally bind the positively charged ddmTT protein in a low pH buffer using cation exchange chromatography material.

[0073] (1) Anion exchange at pH 8.0: The induced bacterial cells were resuspended in buffer (20 mM Tris-HCl, 20 mM NaCl, pH 8.0). The lysed protein supernatant was passed through an anion exchange column (Q HP or Q BB) at an appropriate flow rate. A linear gradient elution was performed using elution buffer (20 mM Tris-HCl, 1 M NaCl, pH 8.0) (adjusting the NaCl concentration), ensuring the elution volume was at least 50 times the column volume. Every 1-2 column volumes were collected into an EP tube. All obtained protein samples were identified by SDS-PAGE. Electrophoresis was performed on all samples, and a large amount of the target protein was obtained under elution conditions of 10-20% salt concentration. All crude products containing the target protein were mixed and used as the sample for the second purification step.

[0074] (2) Anion exchange at pH 7.0: The crude product obtained in the first step was adjusted to pH 7.0 using buffer (20 mM PB, 20 mM NaCl, pH 6.0). Then, the pH-adjusted crude protein product was diluted with buffer (20 mM PB, 20 mM NaCl, pH 7.0), increasing the final volume to 6-8 times the original volume. The processed sample was passed through an anion exchange column (QHP or QBB) at an appropriate flow rate. Impurities were eluted with PB solution (20 mM PB, 20 mM NaCl, pH 7.0) as buffer, and linear elution was performed using solution (20 mM PB, 1 M NaCl, pH 7.0), adjusting the NaCl concentration as needed. The elution volume was controlled at 25 CV-50 CV, and each 0.5-1 column volume was collected into an EP tube. All obtained protein samples were identified by SDS-PAGE, and the electrophoresis images of all samples were used for identification. The results showed that a large amount of the target protein was obtained under elution conditions of 10-15% salt concentration. All crude products containing the target protein were mixed and used as samples for the third purification step.

[0075] (3) Anion exchange at pH 6.0 The crude product obtained in step two was adjusted to pH 6.0 using buffer (20 mM citrate, 20 mM NaCl, pH 5.0). Then, the pH-adjusted crude protein product was diluted with buffer (20 mM PB, 20 mM NaCl, pH 6.0), increasing the final volume to 6-8 times the original volume. The treated sample was passed through an anion exchange column (QHP) at an appropriate flow rate. Impurities were eluted using PB solution (20 mM PB, 20 mM NaCl, pH 6.0) as the buffer. Linear elution was performed using elution buffer (20 mM PB, 1 M NaCl, pH 6.0), adjusting the NaCl concentration, with a controlled elution volume of 20 CV. The final NaCl concentration was 200 mM. Samples were collected in increments of 0.5 CV. All obtained protein samples were identified by SDS-PAGE, and the electrophoresis images of all samples were used for identification. The target protein was obtained under elution conditions of 15-25% salt concentration. All products containing the target protein were mixed and used as the sample for the fourth step of purification.

[0076] After multiple experiments, it was found that in this technical solution, only one of the second and third steps of anion exchange is retained. Under this condition, the target protein can be effectively purified and enriched while removing impurities.

[0077] (4) Cation exchange at pH 5.0 The product obtained in step 3 was adjusted to pH 5.0 using a buffer solution (20 mM citrate, 20 mM NaCl, pH 4.5). The pH-adjusted protein product was then diluted with another buffer solution (20 mM citrate, 20 mM NaCl, pH 5.0), increasing the final volume to 6-8 times the original volume. The treated sample was passed through a cation exchange column (SP HP or SP BB) at an appropriate flow rate. Impurities were eluted using a buffer solution (20 mM citrate, 20 mM NaCl, pH 5.0). A NaCl concentration gradient was adjusted for elution, and the products from each gradient were collected. The target protein was eluted in approximately 200-500 mM NaCl gradient elution buffer. The resulting ddmTT protein was then analyzed by SDS-PAGE.

[0078] II. Cation-Anion Chromatography Purification Combination Scheme The second method involves two main purification steps: a cation exchange step and an anion exchange step to purify the target protein. The design theory is to first bind the positively charged ddmTT protein using cation exchange chromatography in a low-pH buffer, and then bind the negatively charged ddmTT protein using anion exchange chromatography in a slightly higher pH buffer. Finally, the target protein can be further purified or enriched.

[0079] (1) Cation exchange at pH 5.0 After induction, the bacterial cells were resuspended in buffer (20 mM PB, 20 mM NaCl, 1 M CO(NH2)2, pH 6.0). The lysed protein supernatant was adjusted to pH 5.0 with buffer (20 mM citrate, 20 mM NaCl, 1 M CO(NH2)2, pH 4.5) and loaded onto a cation exchange column (SP HP or SP BB) equilibrated with buffer (20 mM citrate, 20 mM NaCl, 1 M CO(NH2)2, pH 5.0) at an appropriate flow rate. Impurities were eluted with 20 mM citrate solution (20 mM NaCl, 1 M CO(NH2)2, pH 5.0). Gradient elution was performed using (20 mM citrate, 1 M NaCl, 1 M CO(NH2)2, pH 5.0) (NaCl concentration adjusted). The eluted products were collected for SDS-PAGE analysis. The target protein was obtained under elution conditions of 20-50% salt concentration. All crude products containing the target protein were mixed and used as the sample for the second purification step. Urea (CO(NH2)2) plays a crucial role in this ion exchange step; without CO(NH2)2, the protein binds poorly to the purification column. Adding CO(NH2)2 may slightly denature the protein, exposing more positive charges and improving the binding effect with the purification column. Therefore, adding a low concentration of urea significantly enhances the binding ability of the cation exchange column to the target protein.

[0080] (2) Anion exchange at pH 7.5 The crude product obtained in the first step was adjusted to pH 7.5 using a buffer solution (20 mM Tris-HCl, 20 mM NaCl, pH 8.0). Then, the pH-adjusted crude protein was diluted with a buffer solution (20 mM PB, 20 mM NaCl, pH 7.5), increasing the final volume to 6-8 times the original volume. This also reduced the concentrations of urea and salt, which is beneficial for the structural conformational recovery of the target protein. The treated sample was then passed through an anion exchange column (Q HP or Q BB) at an appropriate flow rate. Impurities were eluted using a buffer solution (20 mM PB, 20 mM NaCl, pH 7.5), and a NaCl concentration gradient was adjusted using a solution (20 mM PB, 1 M NaCl, pH 7.5). The eluted products were collected for SDS-PAGE identification. The target protein was obtained under elution conditions of 20-50% salt concentration. The finally obtained purified protein is desalted or exchanged with PBS or PB buffer (pH 7.4) and then stored at -20℃ or -80℃ for later use. After multiple experiments, this technique has been shown that the second step of anion exchange can be performed using pH 7 or pH 6.5 buffer (20 mM PB, 20 mM NaCl). Under these conditions, the target protein can be effectively purified and impurities removed.

[0081] The target protein obtained by anion and cation chromatography in the above two technical strategies is further purified by thiavidin chromatography (Belkino) or hydrophobic chromatography (such as butyl, Cytiva) to further refine and enrich the target protein ddmTT. The ddmTT products obtained above ( Figure 2 (b and d), and finally further replaced with buffer solutions such as PBS through membrane filtration or molecular sieve (75PG or S200, Cytiva) as stock solutions for later use. Under laboratory small-sample shake flask culture conditions of non-high-density engineered bacteria, the target protein ddmTT prepared by two effective and stable purification methods showed a single band on both reducing and non-reducing electrophoresis, with a purity of over 95%. Figure 2 In sections b and d), the average yields of the purified protein using the two methods were 2.25 mg / L and 4.13 mg / L, respectively, meeting the requirements for quality, formulation, and efficacy studies of the target protein in the laboratory stage. These methods also provide a basic framework and technical support for future pilot-scale production. After extensive experimental verification, two relatively stable and effective purification techniques were ultimately established. If large-scale production of ddmTT protein is required in the future, both methods can serve as the basis for the design and application of pilot-scale production purification processes.

[0082] In summary, the recombinant expression plasmid was efficiently expressed and biosynthesized into tetanus toxoid molecules in Escherichia coli using genetic engineering techniques. High-purity and stable recombinant tetanus toxoid protein molecules were purified using various chromatography columns, providing a foundation for further investigation into the characteristics of this tetanus toxoid protein and its immunoprotective efficacy as a full-length tetanus molecular protein vaccine.

[0083] Example 3: Study on the molecular biological characteristics and structural identification of ddmTT toxin-like protein I. Identification of ddmTT protein molecules Western blot identification and N / C-terminal sequence analysis were performed on the ddmTT protein obtained in Example 2. The results showed that the ddmTT molecule specifically binds to anti-TL-HN hyperimmune serum (the murine hyperimmune serum antibody prepared in this experiment, or the equine anti-tetanus toxin standard, purchased from the National Institutes for Food and Drug Control) and anti-THc hyperimmune serum (the murine hyperimmune serum antibody prepared in this experiment, or the equine anti-tetanus toxin standard, purchased from the National Institutes for Food and Drug Control). Figure 2 (e,f) indicates that ddmTT retains the antigenicity of the original TeNT molecule.

[0084] ddmTT molecules were incubated with trypsin at 37°C for 50 minutes and identified using both reducing and non-reducing electrophoresis. The results are as follows: Figure 2 The ddmTT molecule was successfully activated into a 150 kDa double-stranded form. Under reducing electrophoresis, two protein bands (50 kDa light chain and 100 kDa heavy chain) were clearly visible. The resulting light chain band and the full-length molecule were then sent to Biotech for N / C-terminal sequence analysis. The results showed that the amino acid sequence of the ddmTT protein molecule was consistent with the theoretical sequence. The N-terminal sequence of the full-length protein molecule was PITINNFR, and the C-terminal sequence was TLTCDWYFVPTDEGWTND. The N-terminal sequence of the light chain protein molecule was PITINNFR, and the C-terminal sequence was PPTNIR. The trypsin-delimited sites of the ddmTT protein were also correct, located in the Loop region CKKIIPPTNI. RE The notch between REs in NLYNRTASLTDLGGELC also indicates that the L-HN critical region structure and conformation are correct, preserving the characteristics and features of the natural toxin molecule.

[0085] II. In vitro enzyme activity detection and toxicity determination of ddmTT protein To detect the enzymatic activity of ddmTT protein, different concentrations of single- and double-stranded ddmTT protein were first reacted with 14 μM Trx-rVAMP2 (30-92AA) and 10 μM Trx-hVAMP1 (34-87AA) protein in PBS, with a final reaction volume of 50 μL. After incubation at 37 ℃ for 30 min, the protein molecules in the reaction system were identified by SDS-PAGE electrophoresis. The results showed that ddmTT molecules do not cleave rVAMP2 (30-92AA) and hVAMP1 (34-87AA) proteins in vitro, indicating that ddmTT molecules have almost no in vitro enzymatic activity compared to TeNT molecules. Figure 3 ).

[0086] Among them, Trx-rVAMP2(30-92AA): a fusion protein of Trx and the murine vesicle-associated membrane protein VAMP2 with 30-92AA [rVAMP2(30-92AA)], a recombinant protein prepared by prokaryotic expression, with a molecular weight of approximately 23 kDa, serving as a substrate protein for tetanus toxin; Trx-hVAMP1 (34-87AA): a fusion protein of Trx and the human vesicle-associated membrane protein VAMP1 with 34-87AA [hVAMP1 (34-87AA)], a recombinant protein prepared by prokaryotic expression, with a molecular weight of approximately 21 kDa, serving as a substrate protein for tetanus toxin. For the preparation methods of Trx-rVAMP2 (30-92AA) and Trx-hVAMP1 (34-87AA), please refer to Li Z, Li B, Lu J, Liu X, Tan X, Wang R, Du P, Yu S, Xu Q, Pang X, Yu YZ, Yang ZX. Biological and Immunological Characterization of a Functional L-HNDerivative of Botulinum Neurotoxin Serotype F. Toxins 2023, 15, 200.

[0087] To determine the toxicity of ddmTT protein, the purified ddmTT protein was diluted and injected intraperitoneally into KM mice (18-20 g, female, SPF grade, purchased from Spiefolk (Beijing) Biotechnology Co., Ltd.). At the test dose, all mice survived even at high doses of 320 μg per single-chain molecule or 320 μg per trypsin-activated double-chain molecule. The median mortality dose (LD50) of recombinant tetanus toxin single-chain and double-chain molecules in animals was also within acceptable limits. 50The doses are 5 ng and 0.625 ng (Table 3). This recombinant tetanus toxin (rTeNT) can also be used as a toxin reference. Figure 1 (a) is used to evaluate the molecular toxicity and immunogenicity of vaccines. Meanwhile, two recombinant single-domain mutant molecules, mTL-HN-THc(sdmTeNT1) and TL-HN-mTHc(sdmTeNT2), were also used. Figure 1 a) Single-chain molecules are non-toxic, and the toxicity of trypsin-activated double-chain molecules is also significantly reduced (Table 3). For example, the toxicity of double-chain mTL-HN-THc decreased by 12,000-fold, and that of double-chain TL-HN-mTHc decreased by 307,000-fold. This result also shows that both domain mutants are effective in reducing toxicity, effectively reducing the toxicity of single- and double-chain toxin molecules (Table 3). It also demonstrates that the bifunctional domain mutant ddmTT molecule is a safer vaccine molecule, verifying the effectiveness of the mutation site changes and achieving the design goal of this invention.

[0088] Therefore, the above results indicate that the ddmTT vaccine is safe and non-toxic in mice, with toxicity reduced by at least 64,000 times compared to the original single-stranded recombinant tetanus toxin, at least 512,000 times compared to the original double-stranded recombinant tetanus toxin, and at least 5 million times less toxic than the natural tetanus toxin produced by Clostridium tetani.

[0089] The above results indicate that the mutant ddmTT protein, modified by genetic engineering technology, has a correct molecular structure sequence and exhibits no in vitro or in vivo neurotoxicity. This demonstrates the verification of the bifunctional domain mutant molecular effect and the design and preparation of novel toxoid molecules, achieving ideal innovative design results and meeting the requirements for novel toxoid vaccine technology and application. Figure 4 This belongs to the genetically modified inactivated tetanus toxoid (gdTT), which is different from the formaldehyde chemically inactivated tetanus toxoid (ciTT) and is a completely new vaccine molecule.

[0090] Table 3. Results of Determination of the Toxicity Properties of Recombinant Tetanus Molecular Toxicity

[0091] Note: Trypsin nicking produces a 100 kDa heavy chain (H) and a 50 kDa light chain (L), which form an activated double-chain active molecule via disulfide bonds. Untreated recombinant tetanus molecules are single-chain molecules. Each recombinant tetanus molecule was diluted with PBS to different doses and injected intraperitoneally into KM mice. Four mice were injected per group, with each dose administered to one group of mice. Mice were observed for 7 consecutive days, and mouse survival was recorded. LD50 was calculated using SPSS software. 50 The value was used as the result of the mouse toxicity assay.

[0092] Example 4: Detection of antibody levels and evaluation of protective efficacy in mice immunized with genetically engineered inactivated tetanus toxoid (ddmTT) vaccine Given that the THc and TL-HN functional domains of tetanus toxin are both highly effective protective antigens, this invention constructs and biosynthesizes a non-toxic toxoid full-length molecular antigen protein containing these two important protective antigen functional domains (mTHc and mTL-HN) as a highly effective novel vaccine. The goal is to improve the protective efficacy of biotoxin vaccines, enhance the clinical application potential of novel vaccines, reduce the number of immunizations, and improve their effectiveness and safety.

[0093] I. Formulation Study of Tetanus Toxoid (ddmTT) Vaccine Preparation Experimental studies have revealed that the actual isoelectric point range of the ddmTT protein is 5-6, consistent with the theoretical isoelectric point of approximately 5.6. Aluminum adjuvants (including aluminum hydroxide and aluminum phosphate adjuvants) are currently the only approved adjuvants in China, and aluminum hydroxide adjuvant is more widely used due to its good efficacy and safety. Therefore, this invention preferentially selects it as an adjuvant for vaccine formulation. Previous laboratory-stage immunopharmacological evaluations have also shown that aluminum hydroxide adjuvant can bind to the ddmTT protein antigen in PBS (pH 7.4) buffer, producing a strong immune response and protective effect, preliminarily verifying its effectiveness as an adjuvant for the ddmTT protein. The isoelectric point of aluminum hydroxide adjuvant is pI=11.4. At pH 7.4, it exists in cationic form, making it a good adsorbent for anionic antigens. When the vaccine antigen is an acidic protein (such as ddmTT), it carries a negative charge at pH 7.4 and can be bound very well by aluminum hydroxide. Meanwhile, PBS buffer (pH 7.4) is the most commonly used buffer in the pharmaceutical field. Its pH value of 7.4 and osmotic pressure are isotonic, belonging to physiological osmotic pressure, and it has good compatibility with the human body, making it a suitable buffer system. Therefore, the proposed formulation is a PBS buffer system with pH 7.4, aluminum hydroxide as the adjuvant (aluminum content 0.4-1 mg / mL), and ddmTT protein concentration of 40-100 µg / mL, dispensed into vials, 0.5 mL / vial, white, homogeneous suspension.

[0094] The antigen ddmTT was prepared as a vaccine formulation using aluminum adjuvant. The vaccine buffer solution was PBS (pH 7.4). An appropriate amount of ddmTT antigen was dissolved in the PBS system, and 10% aluminum hydroxide adjuvant stock solution (aluminum content 1 mg / mL) was added. To detect the aluminum hydroxide adjuvant (Alhydrogel...),... TM2.0% (Brenntag Biosector / Croda Denmark product, aluminum content 10 mg / mL) was used to adsorb ddmTT antigen. Two vaccine formulations with immunization doses of 40 μg / mL and 100 μg / mL were prepared, with an aluminum content of 1 mg / mL. The samples were continuously incubated at room temperature for 6 hours. The protein content in the precipitate and supernatant was detected by centrifugation at different time points. The adsorption rate was measured at 1 hour, 3 hours, and 6 hours. All protein samples were identified by SDS-PAGE electrophoresis. The results are shown in Table 4. Figure 5 As shown in the figure, the results indicate that at antigen concentrations of 40 μg / mL and 100 μg / mL, the ddmTT antigen was completely adsorbed by aluminum hydroxide adjuvant within 3 hours, demonstrating the good adsorption effect of aluminum hydroxide adjuvant on the ddmTeNT antigen.

[0095] Furthermore, this embodiment further investigated the maximum adsorption efficiency of aluminum under this formulation condition. With the aluminum content unchanged, the amount of antigen protein was increased to 200 or 300 μg / mL. The results showed that a good adsorption effect could be produced in 3-12 hours. In particular, the antigen protein could be almost completely adsorbed (at least 96.9%) after 3 hours. The maximum adsorption amount of this antigen protein can be calculated to be at least 290.7 μg / mg aluminum, which can fully meet the formulation requirements. The formulation was dispensed 3 hours after preparation.

[0096] Table 4. Statistical Table of Adsorption Rate of ddmTT Antigen with Aluminum Hydroxide Adjuvant

[0097] Note: The adsorption rate in the table is the average result of three experiments.

[0098] II. Tetanus toxoid (ddmTT) vaccine immunization regimen and detection methods Mice were immunized with vaccine formulations containing different doses of ddmTT to test their immunogenicity and protective efficacy. Simultaneously, a control group was prepared using formaldehyde-inactivated tetanus toxoid vaccine (TT), THc, and a combination of TL-HN+THc (TL-HN and THc antigens mixed at a 1:1 molar ratio). Specifically, Balb / c mice (6-8 weeks old, female, SPF grade, purchased from Spiford (Beijing) Biotechnology Co., Ltd.) were randomly divided into groups of 5-10 mice each. The immunization doses were 4000 ng / mouse (corresponding to a 40 μg / mL antigen formulation), 1000, 250, 62.5, and 15.6 ng / mouse, respectively, in 100 μL / mouse volumes. The negative control group was immunized with PBS without recombinant protein and aluminum adjuvant (Alhydrogel 2.0%, aluminum content 10 mg / mL, Brenntag) at a final concentration of 1 mg / mL. A mixture of Biosector and CrodaDenmark was administered, with booster immunizations every 2-3 weeks (using the same amounts of antigen protein and aluminum adjuvant). Blood was collected from mice after one or two immunizations, followed by challenge with tetanus toxin (TeNT) to evaluate the protective effect of the antigen (observed for one week, results statistically analyzed). Serum antibody levels were detected using ELISA, and neutralizing titers were determined using a classic in vivo neutralization assay, as follows: Serum antibody levels were measured using an ELISA method (enzyme-linked immunosorbent assay plate coated with each recombinant protein antigen at a concentration of 2 μg / mL, using isolated immunized mouse serum as the primary antibody, and HRP-labeled goat anti-mouse IgG (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.) as the secondary antibody). The specific method is as follows: The antigen was diluted to 2 μg / mL and added to 100 μL / well of a 96-well ELISA plate, and incubated overnight at 4 °C. The next day, 200 μL of 2% BSA blocking buffer was added to each well, and the plate was incubated at 37 °C for 2 hours, followed by washing 6 times with PBST (PBS containing 0.1% Tween-20). Mouse serum samples were serially diluted 1:100 to 2-fold with 2% BSA. 100 μL of the diluted sample was added to each well and incubated at 37 °C for 1.5 hours. After washing 6 times with PBST, 100 μL of a 1:5000 dilution of goat anti-mouse IgG / horseradish enzyme-labeled secondary antibody was added to each well, and the plate was incubated at 37 °C for 0.5 hours, followed by 6 washes with PBST. The reaction was terminated with 50 μL of 2 M sulfuric acid per well, and the absorbance was read at 492 nm using an ELISA reader. The OD of the immunized group mice was measured using aluminum adjuvant diluted in PBS as a negative control (i.e., N). 492A positive result was defined as a P-value (i.e., P) of 0.3 or higher and a P / N ratio ≥ 2.1. Antibody levels in each group are expressed as mean ± standard deviation. This method was used to determine antibody levels in each vaccine group in the following analyses.

[0099] The in vivo neutralizing activity and titer of serum antibodies in vaccine-immunized mice were determined using a classic in vivo neutralization assay. Serum antibody titers were reported as International Units per milliliter (IU / mL), with one IU defined as 10⁻⁶ neutralizing units. 4 LD 50 Neutralizing antibodies against biotoxins. The following protocol was designed to determine the neutralizing titer of antitetracheotoxin in mouse serum.

[0100] (1) Dilution of the toxin and the test sample. Dilute the tetanus toxin to 100 LD. 50 / mL. Mouse serum was then diluted to a factor equivalent to the corresponding tetanus toxin concentration according to the expected potency; for example, if the expected serum concentration was 2 IU / mL, it was diluted 200-fold to 0.1 IU / mL. Simultaneously, the antitetanus toxin standard (a neutralizing antibody binding to tetanus toxin) was diluted to the appropriate concentration. Tetanus toxin and antitetanus toxin standards were purchased from the China National Institutes for Food and Drug Control.

[0101] (2) In vitro binding of tetanus toxin with the test sample. 1 ml of diluted tetanus toxin was mixed with different volumes of diluted serum or anti-tetanus toxin standard, with 5 gradients set for each group. The final volume was brought up to 2.5 mL with diluent. The tetanus toxin and antibody were mixed thoroughly and incubated at 37°C for 15 min to allow for a complete reaction between the tetanus toxin and antibody.

[0102] (3) Animal administration and observation. 15-18 g SPF-grade female KM mice were randomly divided into groups of four. Tetanus toxin conjugated with serum or an antitetanus toxin standard was injected intraperitoneally into the mice at a dose of 500 μL / mouse, with four mice administered each dilution of each sample. Animal morbidity and mortality were observed daily for seven consecutive days. The neutralizing titer of serum was calculated by comparing the 50% mortality endpoint of the antitetanus toxin standard group with the 50% protective endpoint of the experimental group.

[0103] III. Evaluation of the Immunogenic Effect of Tetanus Toxoid (ddmTT) Vaccine The immunogenicity and protective efficacy of the recombinant tetanus toxoid ddmTT vaccine molecule were studied through animal immunoprotection experiments, with formaldehyde-inactivated tetanus toxoid TT as a control. The results showed that ddmTT prepared by both methods (ddmTT-1 and ddmTT-2), like formaldehyde-inactivated tetanus toxoid (TT, formulated as a vaccine with aluminum adjuvant at the same antigen dose) and the TL-HN+THc combination group, produced high levels of specific antibody titers against the two important functional domains of TL-HN and THc. Figure 6 Overall, both ddmTT-1 and ddmTT-2 vaccine groups showed dose-dependent efficacy, with the high-antigen group producing stronger antibody titers. At the same dose and antigen, the antibody titer against TL-HN was higher than that against THc, reflecting the presence of more antigenic epitopes on the TL-HN molecule. At the same antigen dose, the ddmTT-1 vaccine produced a slightly higher antibody titer against TL-HN than the ddmTT-2 vaccine, while the antibody titers against THc were comparable between the two methods. Neutralizing antibody titers were also determined in the serum of mice after secondary immunization (Tables 5-6). The results showed that both ddmTT-1 and ddmTT-2 vaccines produced high titers of serum neutralizing antibodies in a dose-dependent manner. Neutralizing antibodies were produced at a dose of 62.5 ng / mouse, while no significant neutralizing antibodies were detected in the 15.6 ng / mouse dose group, indicating lower protective efficacy.

[0104] To evaluate the protective efficacy of low-dose ddmTT, this invention conducted protective experiments on the ddmTT toxoid molecular antigen vaccine after one or two immunizations at different doses, with TT toxoid vaccine and TL-HN+THc combination groups serving as control groups. The results are shown in Tables 5-6. For the ddmTT-1 protein vaccine obtained by Method 1, at a dose of 62.5 ng, the survival rate in all groups was 80%; after a single immunization with a dose of 15.6 ng, a challenge of 100 LD was achieved. 50 and 1000 LD 50 Survival rates were 40% and 20%, respectively, with a 1000 LD attack following secondary immunization. 50 The survival rate was 20%. For the ddmTT-2 protein vaccine obtained through method 2, at a dose of 62.5 ng, the survival rate after one immunization challenge was 40%, and after a second immunization challenge of 1000 LD... 50 The survival rate was 80%; a dose of 15.6 ng, followed by a challenge dose of 100 LD after a single immunization. 50 The survival rate is only 10%, and the virus has a 1000 LD attack rate. 50Neither dose provided protection. The molecular protective efficacy of the ddmTT-1 and ddmTT-2 vaccines was comparable, and there was no difference in neutralizing antibody levels between the same dose groups. Compared with the TT toxoid vaccine, the TL-HN+THc combination group, and the THC group (Table 7), the protective efficacy was ED. 50 The comparative results showed that the recombinant tetanus toxoid ddmTT vaccine produced the strongest immunoprotective efficacy, followed by the TL-HN+THc combination group, while the TT toxoid vaccine had the weakest protective efficacy. Comparisons at a single immunization dose or low dose further demonstrate the strong protective efficacy of the ddmTT toxoid molecular antigen vaccine. Furthermore, the domestically produced aluminum hydroxide adjuvant (Jiangsu Ruike Biotechnology Co., Ltd., Taizhou) also strongly adsorbed the ddmTT toxoid molecule protein and produced a strong, complete protective effect as a vaccine, further proving that this ddmTT toxoid molecule is an effective candidate vaccine molecule, suitable for different aluminum adjuvants, and exhibits good adaptability and high efficiency.

[0105] In summary, the ddmTT toxoid molecular antigen vaccine, combined with the TL-HN+THc combination containing various functional domains and the traditional toxoid vaccine TT, exhibits strong immunoprotective effects, superior to THc antigen alone, and produces stronger and more effective immune efficacy.

[0106] Table 5. Immunoprotective efficacy of ddmTT-1 protein vaccine using Method 1

[0107] Note: The ratio in the table represents the number of survivors / total number. Mice were challenged with the virus 10 times after a single immunization. 2 LD 50 and 10 3 LD 50 Mice challenged with the virus 10 after secondary immunization 3 LD 50 .

[0108] Table 6. Immunoprotective efficacy of ddmTT-2 protein vaccine from Method 2

[0109] Note: The ratio in the table represents the number of survivors / total number. Mice were challenged with the virus 10 times after a single immunization. 2 LD 50 and 10 3 LD 50 Mice challenged with the virus 10 after secondary immunization 3 LD 50 .

[0110] Table 7. Protective efficacy of various types of tetanus vaccines (ED) 50 Value Summary Table

[0111] Note: For each vaccine dose group, the first or second immunization should be administered three weeks after the initial or second immunization. 2 Or 10 3 LD 50 Tetanus toxin was administered, and patients were observed for one week. The number of survivors was recorded, and the median effective dose (ED) for each group was calculated using probability analysis (SPSS 17.0-Probit). 50 This value is used to quantitatively evaluate the efficacy of a vaccine. ED 50 Smaller values ​​indicate higher protective efficacy. Immunization and evaluation methods for TT toxoids, TL-HN, THc, and combined groups are the same as for ddmTT-1 and ddmTT-2. TT represents formaldehyde-inactivated tetanus toxoid (purchased from the National Institutes for Food and Drug Control); the preparation methods for the TL-HN and THc subunit vaccine antigens are detailed in the patent application (title: Non-toxic toxoid molecular antigen vaccine based on the construction of protective antigen functional domains and its preparation method and application, application number: 202310204201.2) and articles (Liu XY, Wei DK, Li ZY, Lu JS, Xie XM, Yu YZ, Pang XB. Immunogenicity and immunoprotection of the functional TL-HN fragment derived from tetanus toxin. Vaccine, 2023, 41: 6834–6841 or Liu FJ, Shi DY, LiZY, Lu JS, Wang R, Pang XB, Yang ZX, Yu YZ. Evaluation of a recombinant tetanus toxin subunit vaccine. Toxicon, 2020, 187: 75–81).

[0112] Example 5: Study on the rapid protective efficacy of tetanus toxoid (ddmTT) vaccine after booster immunization This study investigated the long-term antibody response effects 6 months after immunization with tetanus toxoid (ddmTT) and TT toxoid vaccines, as well as the protective efficacy and antibody levels after booster cross-immunization. The experimental protocol was as follows: Mice were divided into two groups of 80 each, and each group received two immunizations with either ddmTT or TT (purchased from the China National Institutes for Food and Drug Control) toxoid vaccines. Each mouse received 1 μg of ddmTT vaccine in 100 μL of each immunization, with a 2-week interval between immunizations. Blood samples were collected at 1, 2, 3, and 6 months after the second immunization to measure humoral immunity levels. Six months later, each vaccine immunization group received booster immunizations with either ddmTT or TT vaccines, with an antigen dose of 1 μg per mouse and an injection volume of 100 μL per mouse, forming four booster groups: ddmTT immunization followed by a ddmTT booster, ddmTT immunization followed by a TT booster, TT immunization followed by a ddmTT booster, and TT immunization followed by a TT booster. Mice serum was collected 4, 7 and 10 days after booster immunization to determine humoral immunity levels and neutralizing antibody titers, and challenged with the virus after each blood collection.

[0113] The results are shown in Table 8. At all challenge doses, except for the group receiving a booster TT immunization after two TT immunizations, all other groups of mice were completely protected. Neutralizing antibody titers were measured in serum samples collected at all time points, and the results are shown in Tables 9-10. Before the booster immunization, the mice maintained high levels of neutralizing antibodies in their serum, even six months after immunization, further demonstrating that the ddmTT vaccine can maintain a long-term protective effect. After the booster immunization, the neutralizing antibody titers in the ddmTT vaccine-boosted group reached 36.59 IU / mL and 80.00 IU / mL on day 7, an increase of more than 30 times compared to before the booster immunization. These results also indicate that booster immunization can rapidly (at day 4) increase antibody levels and produce protective efficacy.

[0114] Serum antibody titers at each time point were detected using ELISA. Figure 7 At various time points prior to booster immunization, the antibody levels against TL-HN and THC produced by the ddmTT vaccine were higher than those produced by the TT vaccine. After booster immunization, the group immunized with the ddmTT vaccine produced a large number of antibodies in a very short time, far exceeding those immunized with the TT booster. Even in the group previously immunized with the TT vaccine, the booster dose of the novel ddmTT vaccine showed a significant advantage compared to the TT booster.

[0115] Given that a single booster immunization with tetanus toxoid (ddmTT) produces very high antibody titers and neutralizing antibodies, the full-length tetanus toxoid molecule of this invention can be used as a highly effective genetically engineered toxoid vaccine antigen to replace formaldehyde-inactivated traditional toxoid vaccine antigens in the preparation of tetanus toxoid vaccines or as an immunogen to prepare tetanus antitoxins for tetanus prevention and treatment. Furthermore, given its ability to induce a strong immune response, lack of toxic side effects, and homogeneous molecular structure, it can also replace traditional ciTT, similar to recombinant CRM197 (a mutant molecule of diphtheria toxoid DT, which is non-toxic), as a carrier protein in the preparation of conjugate vaccines.

[0116] Table 8. Results of immunoprotective experiments evaluating the rapid protective efficacy after booster immunization

[0117] Note: The ratio in the table represents the number of survivors / the total number.

[0118] Table 9. Serum neutralizing titers in mice at various time points before booster immunization

[0119] Table 10. Serum neutralizing titers in mice at different time points after booster immunization

[0120] Example 6: Study on the rapid protective efficacy of a single tetanus toxoid (ddmTT) vaccine immunization To evaluate the rapid protective effect of a single ddmTT vaccine immunization, this study first immunized mice with recombinant antigen ddmTT, toxoid TT, recombinant protein THC, and combined antigen TL-HN+THc, respectively. Each antigen was administered at 1 μg (1 μg / mouse, corresponding to a 4-fold dilution of the 40 μg / mL antigen formulation) and 10 μg (10 μg / mouse, corresponding to a 100 μg / mL antigen formulation), with an injection volume of 100 μL / mouse. Blood samples were collected and mice were challenged with the virus at 4, 7, and 10 days post-immunization, and mouse survival was recorded. The results are shown in Tables 11-12. A single 1 μg dose of ddmTT vaccine immunization provided complete protection for 10 mice at day 10. 2 LD 50 Tetanus toxin attack, a single immunization with a dose of 10μg antigen, provides complete protection at 10 days. 2 LD 50 Toxin attack, 10 3 LD 50 Survival rate after toxin challenge can reach 80%. For both TT and THC antigen vaccines, only a 10μg dose is administered, followed by challenge 10 days later. 2 LD50 The toxins had survival rates of 40% and 60%, while survival rates after challenge were below 20% at other times. For the TL-HN+THc combination group, challenge with 10 μg doses was performed 10 days after immunization. 2 LD 50 The toxin showed a 90% survival rate, and with an immunization dose increased to 10 μg, 100% protection was achieved after 7 days. In comparison, the ddmTT vaccine and the TL-HN+THc combination group produced an immune response more rapidly and provided effective protection compared to the toxoid TT and THc subunit vaccines. These results also indicate that both the ddmTT and TL-HN+THc combination vaccines possess all the protective antigenic epitopes of tetanus toxin and can produce the same immunoprotective efficacy.

[0121] Serum samples collected at each time point were analyzed for antibody levels using ELISA. The results are as follows: Figure 8 The antibody levels produced by ddmTT at all time points were higher than those of toxoid TT and it had a rapid onset of action. At a dose of 1 μg, the antibody level against THc produced by ddmTT was basically equivalent to that of THc immunization alone, and the antibody levels against both TL-HN and THc antigens produced by ddmTT were comparable to those of the combined TL-HN+THc group. This fully demonstrates that the ddmTT vaccine has extremely high immunogenicity and contains all the effective antigenic epitopes and neutralizing epitopes of the toxin molecule.

[0122] The incubation period for tetanus is generally 7 to 10 days. Therefore, the ddmTT vaccine provides rapid protection for unvaccinated individuals after a single immunization, producing strong protection within 7-10 days. It protects those potentially infected with tetanus bacteria. Simultaneously, the TL-HN+THc combined vaccine also rapidly induces an immune response after a single immunization, providing complete protection for 10 days at a 10 μg dose. 3 LD 50 This indicates that the TL-HN+THc mixed vaccine also possesses all the protective antigenic epitopes of tetanus toxin, demonstrating the same protective efficacy as the full-length toxoid molecule. However, when administered with traditional TT toxoid vaccines, the induced antibodies are weaker, resulting in little or no protection. Antibody production and protective effects require a certain amount of time, and the onset of action is relatively slow.

[0123] Table 11. Protective efficacy of each immunization group after a single 1 μg dose of ddmTT antigen immunization

[0124] Note: The ratio in the table represents the number of survivors / total number. ****P<0.0001, compared with the TT group or THC group for 10 days. 2 LD 50 Compared to TeNT.

[0125] Table 12. Protective efficacy of each immunization group after a single 10 μg dose of ddmTT antigen.

[0126] Note: The ratio in the table represents the number of survivors / total number. *P=0.010836<0.05, compared to the TT group after 10 days of competition. 2 LD 50 Compared to TeNT; ***p=0.000714<0.001, compared to the TT group after 10 days of competition. 3 LD 50 Compared to TeNT; # P=0.023014<0.05, compared with the THC group after 10 days of competition. 3 LD 50 Compared to TeNT.

[0127] Example 7: Protective effect of two rapid immunizations with 1 μg dose of ddmTT vaccine antigen in different immunization groups In addition, to evaluate the rapid protective effect of the ddmTT vaccine, this embodiment further explored the rapid protective test after immunization of mice with recombinant antigen ddmTT and toxoid TT. Each antigen was administered at a low dose of 1 μg, with an injection volume of 100 μL per mouse. A booster immunization was performed on day 3 after the initial immunization, followed by a protective test to evaluate the protective effect. Blood samples were collected and mice were challenged with the virus at three time points: day 1 (4 days after the initial immunization), day 4 (7 days after the initial immunization), and day 7 (10 days after the initial immunization), and the survival status of the mice was recorded. The results are shown in Table 13. Two rapid low-dose immunizations with the ddmTT vaccine produced partial protection (10LD) on day 4. 50 Tetanus toxin attack, complete protection 10 days later. 2 LD 50 The toxin attack. No protective effect was observed with the TT antigen vaccine, indirectly reflecting that antibody production induced by TT toxoid vaccine takes time and has a relatively slow onset of action. A summary and analysis of the results from a single immunization of 1 or 10 μg / animal suggests that TT has weak immunogenicity, requiring higher doses of antigen and more immunizations to induce a strong antibody response. Therefore, the results of this example further demonstrate the efficacy and rapid protective effect of the ddmTT vaccine. When applied to immunization, this result shows that for unimmunized populations, two consecutive immunizations at a 3-day interval can rapidly produce a strong protective effect 4-7 days after the initial immunization, which is more beneficial in protecting potential individuals contaminated with tetanus bacteria.

[0128] Table 13. Protective efficacy of each immunization group after two rapid immunizations with a 1 μg dose of ddmTT vaccine antigen.

[0129] Note: The ratios in the table represent the number of survivors / total number. ****P<0.0001, compared with the TT group at 7 days and 10 days. 2 LD 50 Compared to TeNT.

[0130] In summary, the above experimental results demonstrate that the ddmTT toxoid molecular antigen vaccine can produce strong and complete protection with low doses and fewer immunizations. More importantly, this novel recombinant non-toxic tetanus toxoid vaccine can rapidly generate high levels of neutralizing antibodies after a single booster immunization, producing strong protection within 4 days, or effective protection within 7-10 days after a single immunization. Therefore, this rapid protective effect has significant medical and clinical implications, and it is expected to be more effective in preventing tetanus.

[0131] This invention establishes and perfects the prokaryotic expression vector and engineered strain expression system of genetically engineered inactivated full-length tetanus toxoid protein (ddmTT), as well as two tag-free ddmTT purification and preparation techniques. It determines the antigenic molecular characteristics and high-efficiency immunoprotective efficacy of the ddmTT vaccine, demonstrating its ability to rapidly and effectively generate high-level antibody responses and protective effects. The invention systematically verifies that it is a novel tetanus vaccine that can replace traditional inactivated toxoid vaccines (TT) and is superior to recombinant subunit vaccines. This provides solid theoretical data and technical support for the application of novel genetically engineered recombinant tetanus toxoid vaccines and lays the foundation for the development of other novel attenuated protein vectors.

[0132] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A method for preparing a full-length tetanus toxoid molecule, including: An expression vector containing the gene encoding the ddmTT protein was introduced into microorganisms to express and purify the gene, thereby obtaining a full-length tetanus toxoid molecule. The ddmTT protein is the ddmTT protein shown in SEQ ID No.

6.

2. The method according to claim 1, characterized in that: The sequence of the encoding gene is SEQ ID No.

5.

3. The method according to claim 1 or 2, characterized in that: The microorganism in question is Escherichia coli; Furthermore, the Escherichia coli is Escherichia coli BL21 (DE3), BL21 Star (DE3), Transetta (DE3), Rosetta (DE3), shuffle T7-B, or Origami 2 (DE3).

4. The method according to any one of claims 1-3, characterized in that: The expression vector is resistant to ampicillin or kanamycin; Furthermore, the expression vector is either the pTIG-Trx vector or the pET-28a(+)-NdeⅠ vector.

5. The method according to any one of claims 1-4, characterized in that: The purification was performed using ion exchange chromatography and / or superimposed thiaphilic avidin chromatography or hydrophobic chromatography.

6. The method according to claim 5, characterized in that: The ion exchange chromatography method is anion exchange chromatography and / or cation exchange chromatography.

7. A tetanus toxoid molecule obtained by the method of any one of claims 1-6, or a composition of the heavy and light chains of the tetanus toxoid molecule.

8. The use of the full-length tetanus toxoid molecule of claim 7 or the composition thereof as a tetanus vaccine.

9. Any of the following applications of the method according to any one of claims 1-6: X1) Preparation of tetanus vaccine; X2) Prepare tetanus bacillus antibodies or tetanus toxin antibodies; X3) Prepare tetanus antiserum or tetanus toxin antiserum; X4) was used as a carrier protein to prepare conjugate vaccines; X5) Prepare tetanus toxin.

10. Any of the following applications of the full-length tetanus toxoid molecule of claim 7 or the composition: X1) Preparation of tetanus vaccine; X2) Prepare tetanus bacillus antibodies or tetanus toxin antibodies; X3) Prepare tetanus antiserum or tetanus toxin antiserum; X4) was used as a carrier protein to prepare conjugate vaccines; X5) Prepare tetanus toxin.

Images