Rslncl gene for regulating synthesis of radish anthocyanin and application thereof
By cloning and utilizing the RsLNC2361 gene to regulate anthocyanin synthesis in radish, the problem of insufficient regulation of anthocyanin content in existing technologies has been solved, thereby accelerating the radish breeding process and elucidating the molecular regulatory mechanism.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- GUIZHOU UNIV
- Filing Date
- 2025-08-29
- Publication Date
- 2026-06-26
Smart Images
Figure CN121065239B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to an RsLNC2361 gene that regulates anthocyanin synthesis in radish and its applications. Background Technology
[0002] Radish (Raphanus sativus) belongs to the genus Raphanus in the family Brassicaceae and is an annual or biennial crop. It is not only an important traditional vegetable in my country but also widely cultivated globally. Radishes possess abundant germplasm resources and have a long history of cultivation. Through long-term natural selection and artificial breeding, various types and varieties with different skin and flesh colors have emerged. Among them, radish varieties rich in anthocyanins are highly favored by consumers due to their vibrant colors and high nutritional value (Liu Tongjin et al., 2022). Anthocyanins are a class of water-soluble flavonoids commonly found in plants, and there are many types. Currently, more than 600 types of anthocyanins are known (Grotewold, 2006), most of which are derived from six common anthocyanins: pelargonidin, cyanidin, delphinidin, peonidin, petunidin, and malvidin.
[0003] Long non-coding RNAs (lncRNAs) are non-coding RNAs longer than 200 nt. These RNA molecules have unique secondary structures but lack protein-coding functions (Liu et al., 2023). Studies have shown that lncRNAs can influence plant growth and development by regulating specific gene expression and participating in auxin synthesis. In Arabidopsis thaliana, when seeds are maturing and about to end their dormancy period, the antisense lncRNA asDOG1 is transcribed near the promoter of the germination delay gene DOG1. It significantly inhibits DOG1 gene expression through cis-regulation, thereby accelerating seed germination (Fedak et al., 2016). In tomato research, knocking out lncRNA 1459, which is associated with fruit ripening, significantly downregulated the expression levels of genes related to ethylene and carotenoid synthesis, leading to inhibited ethylene production and lycopene synthesis, ultimately adversely affecting the ripening process of tomato fruits (Li et al., 2018). Silencing the cold stress-related lncRNA XH123 in upland cotton significantly enhanced the plant's sensitivity to low-temperature stress, manifesting as chloroplast structural damage and elevated reactive oxygen species levels (Cao et al., 2021). Tan et al. demonstrated that overexpression of LINC15957 significantly increased anthocyanin accumulation and the expression levels of anthocyanin biosynthesis-related genes in radish leaves, while silencing LINC15957 significantly reduced anthocyanin accumulation and anthocyanin biosynthesis gene expression levels in the fleshy roots (Tan et al., 2023). Furthermore, numerous studies have shown that many lncRNAs can serve as targets for miRNAs, playing crucial regulatory roles (Cagirici et al., 2017). For example, LNC1 and LNC2 were identified as target molecules of miR156a and miR828a, respectively: the former reduces the expression level of the SPL9 gene, while the latter induces the expression of the MYB114 gene, ultimately leading to different regulatory effects on anthocyanin content, such as increasing or decreasing it (Zhang et al., 2018). In wheat research, it was found that miR9678 can target and bind to lncRNA WSGAR, and generate phase RNA through cleavage, thereby playing a regulatory role in delaying seed germination (Guo et al., 2018). Through WGCNA analysis, the construction of a miRNA-lncRNA-mRNA expression regulatory network and gene function verification confirmed that lncRNAs MLNC3.2 and MLNC4.6 are potential target genes of miRNA156a, which can promote the expression of these two genes and the accumulation of anthocyanins by preventing the degradation of SPL2-like and SPL33 by miR156a under photoinduced conditions (Yang, 2020). Summary of the Invention
[0004] The purpose of this invention is to provide an RsLNC2361 gene that regulates anthocyanin synthesis in radishes and its applications, thereby addressing the problems existing in the prior art. The cloned gene RsLNC2361 is a long non-coding RNA. Studies have shown that overexpression of this gene can significantly increase anthocyanin content in plants, while loss of its function leads to a decrease in anthocyanin content. This achievement not only helps accelerate radish breeding and the targeted cultivation of new radish varieties with high anthocyanin content, but also provides important theoretical basis for elucidating the molecular regulatory mechanism of anthocyanin synthesis in radishes.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides the application of the RsLNC2361 gene in any of the following:
[0007] (1) Application in regulating the synthesis of anthocyanins in radish;
[0008] (2) Application in radish breeding;
[0009] The nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:1.
[0010] This invention also provides the use of recombinant vectors containing the RsLNC2361 gene in any of the following:
[0011] (1) Application in regulating the synthesis of anthocyanins in radish;
[0012] (2) Application in radish breeding;
[0013] The recombinant vector is constructed by ligating the RsLNC2361 gene and an expression vector, and the nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:1.
[0014] The present invention also provides the use of the host bacteria of the recombinant vector in any of the following:
[0015] (1) Application in regulating the synthesis of anthocyanins in radish;
[0016] (2) Application in radish breeding.
[0017] Preferably, the RsLNC2361 gene positively regulates the synthesis of radish anthocyanins.
[0018] The present invention also provides a method for regulating anthocyanin synthesis in radish, comprising the step of introducing the RsLNC2361 gene into radish to regulate anthocyanin synthesis in radish; wherein the nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:1.
[0019] Preferably, the RsLNC2361 gene positively regulates the synthesis of radish anthocyanins.
[0020] The present invention also provides a breeding method for increasing the anthocyanin content of radish, comprising the step of overexpressing the RsLNC2361 gene in radish to increase the anthocyanin content of radish; wherein the nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:1.
[0021] The present invention also provides a breeding method for reducing the anthocyanin content of radish, including the step of silencing the RsLNC2361 gene in radish to reduce the anthocyanin content of radish; wherein the nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:1.
[0022] The present invention also provides a method for cultivating transgenic radishes with high anthocyanin content, comprising the step of overexpressing the RsLNC2361 gene in radishes to obtain transgenic radishes with high anthocyanin content; wherein the nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:1.
[0023] The present invention discloses the following technical effects:
[0024] The gene RsLNC2361 cloned in this invention is a long non-coding RNA. Studies have shown that overexpression of this gene can significantly increase the anthocyanin content in plants, while loss of its function leads to a decrease in anthocyanin content. The research results of this invention not only help accelerate the radish breeding process and cultivate new radish varieties with high anthocyanin content, but also provide important theoretical basis for elucidating the molecular regulatory mechanism of anthocyanin synthesis in radishes. Attached Figure Description
[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0026] Figure 1Phenotypic analysis of radish leaves for control group and transient overexpression of RsLNC2361 gene; pFGC1008: empty vector control group; OE-LNCR2361-1: treatment group 1; OE-LNCR2361-2: treatment group 2;
[0027] Figure 2 The expression levels of anthocyanin synthesis-related genes in leaves with transient overexpression of the RsLNC2361 gene were determined.
[0028] Figure 3 The relative expression level of RsLNC2361 in leaves with transient overexpression of the RsLNC2361 gene;
[0029] Figure 4 The anthocyanin content in the control group and OE-RsLNC2361 tissue;
[0030] Figure 5 Phenotypic analysis of radish roots inoculated with RsLNC2361-pTY for control and RsLNC2361-pTY; pTY: empty vector control group; pTY-LNCR2361-1: treatment group 1; pTY-LNCR2361-2: treatment group 2;
[0031] Figure 6 The expression levels of anthocyanin synthesis-related genes in pTY-RsLNC2361;
[0032] Figure 7 The relative expression level of RsLNC2361 in pTY-RsLNC2361;
[0033] Figure 8 The anthocyanin content in the control group and pTY-RsLNC2361 tissues is shown. Detailed Implementation
[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0035] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0036] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0037] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0038] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0039] Example 1: Cloning and expression vector construction of radish RsLNC2361 gene
[0040] Based on the RsLNC2361 sequence and the characteristics of the overexpression vector, specific primers for RsLNC2361 with homologous arms of the pFGC1008 vector were designed.
[0041] PCR amplification was performed using cDNA from Zidan red-skinned red-fleshed radish as a template. The reaction system and program were set according to the 2× Hieff CanaceAdvanceFast PCR Master MIX manual (YESEN, China). The PCR amplification program was: 98℃ pre-denaturation for 40 s; 98℃ denaturation for 15 s, 62℃ annealing for 10 s, 72℃ extension for 20 s, 30 cycles; 72℃ extension for 5 min. The total PCR amplification volume was 20 μL: 1 μL forward primer, 1 μL reverse primer, 4 μL template cDNA, 10 μL high-fidelity enzyme mix, and 4 μL ddH2O. The PCR products were stored at 4℃. The amplification primers are as follows:
[0042] Forward primer: TTACAATTACCATGGGGCGCGCC GATGGTGTCTGAGGTGACGCTAG (SEQ ID NO: 2);
[0043] Reverse primer: AACATCGTATGGGTAGGTACC CATACTATCTACTTTATTAAAACAGAAAT (SEQ ID NO: 3).
[0044] The PCR products were purified by agarose gel electrophoresis and then sent to Sangon Biotech (Shanghai) Co., Ltd. for Sanger sequencing. The RsLNC2361 gene, with a full-length coding sequence of 536 bp, was cloned from the material Zidan red-skinned red-fleshed radish.
[0045] Nucleotide sequence of the RsLNC2361 gene (SEQ ID NO:1):
[0046] .
[0047] The obtained RsLNC2361 gene was ligated into a plant overexpression vector via homologous recombination. The prepared reaction system was subjected to homologous recombination at 37℃ for 30 min, followed by transformation into *E. coli* DH5α competent cells. After screening for the target gene, single clones were selected and cultured. Positive clones were screened by bacterial culture PCR and sent to the company for sequencing, forming the recombinant plasmid pFGC1008-RsLNC2361. The reaction system and program were set according to the GENE STAR PCR Master MIX manual. The PCR amplification program was: 94℃ pre-denaturation for 120 s; 94℃ denaturation for 30 s, 62℃ annealing for 30 s, 72℃ extension for 20 s, cycle number 35; 72℃ extension for 5 min. The total PCR amplification volume was 20 μL, 1 μL forward primer, 1 μL reverse primer, 2 μL bacterial culture template, 10 μL 2×PCR StarMix, and 6 μL ddH2O. The pFGC1008-RsLNC2361 vector plasmid was extracted and transformed into Agrobacterium tumefaciens GV3101. Positive clones of Agrobacterium were obtained after screening with CRM and Rif antibiotics and the target gene.
[0048] Example 2: Transient overexpression of radish RsLNC2361 in radish leaves
[0049] For resuspension preparation, the transformed Agrobacterium was shaken until turbid and collected in a sterile 50 mL centrifuge tube. The tube was centrifuged for 8-10 min (10000 rpm), and the supernatant was discarded. 5 mL of the resuspension was added, and the mixture was vortexed (protected from light). The OD value was measured using a micro spectrophotometer. 600 Adjust the value to around 0.6, place in a 28℃, 90rpm shaker in the dark for about 4 hours for induction, and it is ready for use. Water the material to be transformed thoroughly the day before transformation, and select healthy leaves of red-skinned, red-fleshed radishes at the two-leaf, two-heart stage. Before injection, ensure the leaf surface is clean and dry. Draw 500μL of the infection solution and inject it into the radish leaf using a 1mL disposable sterile syringe. After injection, place the radish seedlings in a light incubator at 28℃ in the dark for 2 days. Cover the injected radish plants with plastic wrap, then transfer them to a normal artificial climate chamber for cultivation. Closely observe the color change at the injection site after 10 days.
[0050] Example 3: Construction of a virus-induced gene silencing (VIGS) vector for the radish RsLNC2361 gene.
[0051] A VIGS vector for radish was constructed by Nanjing Genscript Biotech Co., Ltd. In the RsLNC2361 gene sequence, bases of TGA, TAA, or TAG were selected, with the first three bases avoiding the last 40 bp of GTA. The reverse complementary sequence (SEQ ID NO: 4) was then added. Homologous sequences of 15 bp corresponding to the ends of the linearized vector were added at both ends, resulting in a total of 110 bp double-stranded DNA fragment. The pTY-SVIGS vector plasmid was digested with SnaB I restriction endonuclease. The synthesized oligonucleotides were ligated to the linearized vector. The VIGS vector was transformed into competent DH5α cells for propagation. After blue-white screening, the cells were cultured and the plasmid was extracted using the OMEGA plasmid extraction kit. The extracted plasmid was stored at -20℃. The RsL NC2361 gene was silenced in 10-day-old red-fleshed radishes, and the extracted plasmid was injected into the root flesh of Zidan radishes. The injected radishes were kept in an artificial climate chamber at 25℃ / 22℃ with a 16-hour / 8-hour light / dark cycle, injected weekly for a total of three times. Phenotypic evaluation was conducted at week four.
[0052] Example 4: Determination of anthocyanin content
[0053] Radish material was thoroughly ground into powder in liquid nitrogen. 1g of the thoroughly ground powder sample was weighed and transferred to a 10mL centrifuge tube. 8mL of 0.05% pre-chilled hydrochloric acid-methanol solution (4℃) was added, vortexed, and placed in a 4℃ refrigerator protected from light. After 12 hours, the sample was centrifuged, and the supernatant was transferred to a 25mL volumetric flask. 8mL of the same hydrochloric acid-methanol solution was added to the centrifuge tube, vortexed, and the sample was centrifuged again at 4℃ for 6 hours. The supernatant was transferred to a 25mL volumetric flask, and this step was repeated once. The sample was then brought to a final volume with 0.05% pre-chilled hydrochloric acid-methanol solution (4℃). Two test tubes were prepared (1mL of extract in each). 4mL of 0.4mol / L citrate / disodium hydrogen phosphate buffer (pH 5.0) and 0.4mol / L KCl-HCl buffer (pH 1.0) were added to each tube, respectively. The solutions were mixed and allowed to stand at room temperature for 20 minutes. Using a 0.05% hydrochloric acid-methanol solution as a control, the absorbance values at 530 nm and 700 nm were measured using a dual-wavelength UV spectrophotometer. Each sample was tested three times.
[0054] Example 5: Analysis of the expression patterns of the RsLNC2361 gene and anthocyanin synthesis-related genes.
[0055] Total RNA was extracted and reverse transcribed using the GeneStar reverse transcription kit. Real-time quantitative PCR analysis (RT-qPCR) of SYBR Green Master Mix (GeneStar, China) was performed using a real-time quantitative PCR instrument (Hangzhou, China). RsActin was used as an internal control. The relative expression levels of candidate genes were calculated using Equation 2. -△△Ct (Livak and Schmittgen, 2001). All reactions were performed in triplicate. The expression levels of nine anthocyanin synthesis-related genes, including RsDFR, Rs3GT, RsTT8, RsC4H, RsANS, RsUFGT, RsCHS, and RsF3H (including RsLNC2361), were detected. Primer sequences for real-time quantitative PCR are shown in Table 1.
[0056] Table 1 Primer sequences for real-time quantitative PCR
[0057]
[0058]
[0059] The reaction system (total volume 20 μL) consists of: 1 μL forward primer, 1 μL reverse primer, 2 μL cDNA template, 10 μL 2×RealStar Fast SYBR qPCR Mix, and 6 μL ddH2O.
[0060] Reaction program: 95℃ pre-denaturation for 120s; 95℃ denaturation for 15s, 60℃ annealing for 30s, 40 cycles; hold at 4℃.
[0061] Example 6: Overexpression of the RsLNC2361 gene can promote anthocyanin synthesis.
[0062] from Figure 1 As can be seen, after transient overexpression of RsLNC2361 in radish leaves, a comparison of leaf color between the experimental and control groups revealed that the injection sites on the leaves of the transgenic lines showed a significant reddening phenomenon (e.g., ...). Figure 1 (As shown). RT-qPCR was then used to analyze the relative expression levels of anthocyanin biosynthesis-related genes and the target gene. The results showed that when RsLNC2361 was overexpressed, the expression levels of RsDFR, Rs3GT, RsTT8, RsC4H, RsANS, RsUFGT, RsCHS, RsF3H, and RsLNC2361 itself were all significantly increased (e.g., ...). Figure 2 and Figure 3 As shown in the figure. After measuring the anthocyanin content of the leaves, it was found that the anthocyanin content in leaves overexpressing the RsLNC2361 gene was significantly higher than that in the control group (as shown in the figure). Figure 4The above experimental results indicate that overexpression of RsLNC2361 can increase the anthocyanin content in radish leaves and promote anthocyanin accumulation.
[0063] Example 7: Silencing RsLNC2361 reduces the accumulation of anthocyanins in radish fleshy roots.
[0064] By constructing a VIGS silencing vector and injecting it into red-fleshed, red-skinned radishes, a comparison of the root flesh color between the experimental and control groups revealed that the injection site of the transgenic lines showed a significant whitening phenomenon (e.g., ...). Figure 5 (As shown). RT-qPCR analysis of the relative expression levels of anthocyanin biosynthesis-related genes and the target gene revealed that when RsLNC2361 was silenced in the root mesophyll, the expression levels of RsDFR, Rs3GT, RsTT8, RsC4H, RsANS, RsUFGT, RsCHS, RsF3H, and RsLNC2361 itself were all significantly downregulated (e.g., ...). Figure 6 and Figure 7 (As shown). Further determination of anthocyanin content in the root mesophyll revealed that the anthocyanin content in the experimental group was significantly lower than that in the control group (as shown). Figure 8 (As shown).
[0065] It is evident that transient overexpression of the RsLNC2361 gene in radish leaves can increase the anthocyanin content in radish leaves and significantly improve the expression level of anthocyanin biosynthesis-related genes. Silencing RsLNC2361 in radish root can reduce the accumulation of anthocyanins and the expression level of anthocyanin biosynthesis genes in the fleshy root.
[0066] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. Application of the RsLNC2361 gene in any of the following: (1) Application in regulating the synthesis of anthocyanins in radish; (2) Application in the breeding of transgenic radishes with high / low anthocyanin content; in, The nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:
1.
2. Application of recombinant vectors containing the RsLNC2361 gene in any of the following: (1) Application in regulating the synthesis of anthocyanins in radish; (2) Application in the breeding of transgenic radishes with high / low anthocyanin content; in, The recombinant vector is constructed by ligating the RsLNC2361 gene and an expression vector, and the nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:
1.
3. The use of a host bacterium containing the recombinant vector of claim 2 in any of the following: (1) Application in regulating the synthesis of anthocyanins in radish; (2) Application in the breeding of transgenic radishes with high / low anthocyanin content.
4. The application as described in any one of claims 1-3, characterized in that, The RsLNC2361 gene positively regulates the synthesis of anthocyanins in radish.
5. A method for regulating anthocyanin synthesis in radish, characterized in that, The method includes the step of introducing the RsLNC2361 gene into radish to regulate the synthesis of anthocyanins in radish; wherein the nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:
1.
6. The method as described in claim 5, characterized in that, The RsLNC2361 gene positively regulates the synthesis of anthocyanins in radish.
7. A breeding method for increasing the anthocyanin content of radishes, characterized in that, The method includes the step of overexpressing the RsLNC2361 gene in radish to increase the anthocyanin content of radish; wherein the nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:
1.
8. A breeding method for reducing anthocyanin content in radishes, characterized in that, The method includes the step of silencing the RsLNC2361 gene in radishes to reduce the anthocyanin content of radishes; wherein the nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:
1.
9. A method for cultivating a transgenic radish with high anthocyanin content, characterized in that, The method includes the step of overexpressing the RsLNC2361 gene in radishes to obtain transgenic radishes with high anthocyanin content; wherein the nucleotide sequence of the RsLNC2361 gene is shown in SEQ ID NO:1.