Application of RICTOR target spot in regulating and controlling formation of poultry fatty liver

By regulating the RICTOR target and interfering with its expression using RICTOR overexpression plasmids or siRNA, the problems of lipid transport disorders and intrahepatic lipid deposition in the formation of fatty liver in poultry were solved, achieving the effects of reducing fat production and lowering oxidative stress and inflammation, thus improving the health and production performance of chickens.

CN121065271APending Publication Date: 2025-12-05SICHUAN AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511242038.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-02
Publication Date
2025-12-05

AI Technical Summary

Technical Problem

The metabolic disorder that leads to fatty liver in poultry, especially in laying hens, is difficult to effectively regulate with current technology, resulting in lipid transport disorders and lipid deposition in the liver.

Method used

By regulating the RICTOR target, using RICTOR overexpression plasmids or siRNA to interfere with its expression, lipid metabolism and inflammatory response in chicken primary hepatocytes were regulated. The expression of RICTOR was inhibited using pcDNA3.1(+) vector-3xFlag-C and gga-let-7a-3p, which reduced lipogenesis and alleviated oxidative stress and inflammation.

Benefits of technology

It effectively reduces fat production in primary chicken hepatocytes, lowers oxidative stress and inflammation levels, regulates the disordered lipid metabolism process in the liver, and improves the health and production performance of chickens.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121065271A_ABST
    Figure CN121065271A_ABST
Patent Text Reader

Abstract

The invention discloses an application of an RICTOR target spot in regulating and controlling formation of poultry fatty liver. The anchored target spot sequence of the RICTOR is SEQ ID No.1. The invention further discloses a preparation method of the RICTOR. According to the invention, it is found for the first time that RICTOR is used as a target gene of gga-let-7a-3p and can participate in regulation of lipid metabolism, oxidative stress and inflammatory response of chicken primary hepatocytes, so that target molecules of laying hen adipose tissue EVs in the liver can be obtained, and the lipid metabolism disorder process of the liver can be aggravated or reduced by regulating expression of RICTOR.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of breeding, in particular to application of a RICTOR target point in regulating formation of fatty liver of poultry. BACKGROUND

[0002] Fatty liver syndrome (FLS) is a common metabolic disease in laying hens, and its pathogenesis is closely related to imbalance of lipid metabolism in the liver. As the main organ of lipid synthesis, the chicken liver will have insufficient apolipoprotein synthesis when there is excess energy, leading to lipid transport disorders and abnormal deposition in the liver, and ultimately causing fatty degeneration. Recent studies have confirmed that adipose tissue is not only an energy storage depot, but also an important endocrine organ that participates in systemic metabolic regulation by secreting various adipokines.

[0003] In the adipokine network, leptin, as an early discovered signaling molecule, maintains metabolic balance by regulating energy consumption and appetite, but leptin resistance often accompanying obesity can weaken its function. In contrast, adiponectin plays a more significant role in improving insulin sensitivity, promoting fatty acid oxidation and inhibiting hepatic gluconeogenesis. Notably, adipose tissue can also secrete pro-inflammatory factors such as TNF-α and IL-1β, which directly affect liver function through the portal system, exacerbating insulin resistance and metabolic disorders.

[0004] The abdominal fat of chickens, as the main fat distribution area, has multiple physiological significance in energy storage, body temperature regulation and meat quality improvement. Moderate abdominal fat deposition is not only an indicator of health status, but also an important factor in maintaining production performance. This metabolic dialogue between adipose tissue and the liver provides a new perspective for understanding the pathogenesis of FLS. SUMMARY

[0005] Based on the above reasons, the application proposes the application of the RICTOR target point in regulating the formation of fatty liver of poultry. Specifically, in order to achieve the purpose of the application, the application proposes the following technical solutions: The application relates to a RICTOR target point in regulating the formation of fatty liver of poultry. The RICTOR-anchored target sequence is SEQ ID No. 1 (which contains the binding site of gga-let-7a-3p), specifically GCCAGTTCTTATTTGACCTGACATACATGCCCTAAGTGATTTAGTAGTATTTTTCCCCACAAGAAACAACAGCCAGTAGTTCAGAGGGCAGAGGTTGGCACATCGAGGTGAGCTGCCCTTAGAAACATTTTAAAAGGCAGTAGCGACAGTACTGATCATTTTCTTGTCATTTTGGAGTG.

[0006] In a preferred embodiment of the present application, the regulation refers to overexpression in the avian by transfecting the overexpression plasmid of RICTOR, thereby reducing lipogenesis in chicken primary hepatocytes and reducing the levels of oxidative stress and inflammation.

[0007] In a preferred embodiment of the present application, the structure of the overexpression plasmid of RICTOR is pcDNA3.1 (+) vector-3xFlag-C.

[0008] In a preferred embodiment of the present application, the regulation refers to inhibiting the expression of RICTOR by RICTOR si-RNA.

[0009] In a preferred embodiment of the present application, the sequence of the RICTOR si-RNA is CCGTGTATGTGCGAGCAGATGTA and GGAGATACACGCTCGTCTACATT.

[0010] In a preferred embodiment of the present application, the regulation refers to inhibiting the expression of RICTOR by transfecting gga-let-7a-3p, the sequence of which is 5'-CUAUACAAUCUACUGUCUUUCC-3'.

[0011] In a preferred embodiment of the present application, the avian refers to laying hens.

[0012] Another aspect of the present application also relates to the use of the overexpression plasmid of RICTOR in the preparation of a medicament for reducing lipogenesis in chicken primary hepatocytes and reducing the levels of oxidative stress and inflammation.

[0013] The present application has the following beneficial effects: the present application first discovers that RICTOR is a target gene of gga-let-7a-3p, which can be involved in regulating the lipid metabolism, oxidative stress and inflammatory response of chicken primary hepatocytes, so it can be a target molecule of the EVs of the adipose tissue of laying hens in the liver, and by regulating the expression of RICTOR, the process of lipid metabolism disorder in the liver can be aggravated or reduced. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1: Prediction and identification of gga-let-7a-3p target genes, (A) Venn diagram of predicted target genes of gga-let-7a-3p; (B) qPCR screening of negative predicted target genes in gga-let-7a-3p overexpressed chicken hepatocytes; (C) Construction of pmirGLO-RICTOR-WT and pmirGLO-RICTOR-MT dual-luciferase reporter gene. Seed sequence is marked with red; mutant sequence is marked with green; (D) Dual-luciferase reporter assay after transfection of pmirGLO-RICTOR-WT or pmirGLO-RICTOR-MT and gga-let-7a-3p mimic or mimic NC in DF-1 cells.

[0015] Figure 2: Effect of gga-let-7a-3p on RICTOR / AKT / FoxOl signaling pathway, (A-C) Protein levels of RICTOR, AKT, phosphorylated AKT (p-AKT), FOXOl, phosphorylated FOXOl (p-FOXOl) were determined after overexpression or knockdown of gga-let-7a-3p.

[0016] Figure 3 : Efficiency of RICTOR overexpression and interference.

[0017] Figure 4 : Effect of RICTOR on lipid metabolism in chicken primary hepatocytes, (A-B) mRNA levels of lipid metabolism related genes after overexpression or interference of RICTOR; (C-D) Protein levels of FASN, CPT1A and PPARa in hepatocytes after overexpression or interference of RICTOR; (E-G) Accumulation of lipid droplets (LDs) in chicken hepatocytes after overexpression or interference of RICTOR. Scale bar = 50 pm; (H-I) Levels of TG and TC in hepatocytes after overexpression or interference of RICTOR.

[0018] Figure 5 : Effect of RICTOR on oxidative stress and inflammation in chicken primary hepatocytes, (A-B) Western blot analysis of Nrf2, SOD2, HO1, TNF-a, IL-1b and IL-6 expression in chicken hepatocytes after overexpression or interference of RICTOR; (C-F) Levels of MDA, T-SOD, TNF-a and IL-6 in hepatocytes after overexpression or interference of RICTOR.

[0019] Figure 6 : gga-let-7a-3p regulates lipid metabolic disorder in chicken primary hepatocytes through RICTOR / AKT / FOXOl signaling axis.

[0020] Figure 7 : gga-let-7a-3p agomir accelerated liver lipogenesis, oxidative stress and inflammation in chicks, wherein (A) the procedure of injecting miRNA mimics into chicks; (B) the body weight of chicks before and after injecting gga-let-7a-3p agonist; (C) the liver weight of chicks after injecting gga-let-7a-3p agonist; (D) representative micrographs of liver cross-sections stained by HE, oil red O and RICTOR immunohistochemical staining (IHC), scale bar = 50 μm; (E) the oil red O quantification results of liver; (F-G) the protein levels of related genes in liver after injecting gga-let-7a-3p agonist; (H-I) the concentrations of TC, TG, TNF-a and IL-6 in liver after injecting gga-let-7a-3p agonist; (J-K) the levels of T-SOD and MDA in liver after injecting gga-let-7a-3p agonist.

[0021] Figure 8 : pcDNA3.1 (+) commercial vector structure. The overexpression plasmid of RICTOR was constructed using pcDNA3.1 (+) commercial vector. DETAILED DESCRIPTION

[0022] For a further understanding of the present application, the technical solutions in the embodiments of the present application will be described in detail below in conjunction with the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the scope of protection of the present application.

[0023] Unless otherwise specified, the reagents involved in the embodiments of the present application are all commercially available and can be purchased through commercial channels.

[0024] Embodiment 1: 1. Experimental method 1.1 Prediction of target genes of gga-let-7a-3p The target genes of gga-let-7a-3p were predicted by two databases, TargetScan (https: / / www.targetscan.org / vert_72 / ) and miRDB (https: / / mirdb.org / ). The intersection of the prediction results of the two databases and the genes related to mTOR signaling pathway was obtained by using the Venn analysis (http: / / bioinformatics.psb.ugent.be / webtools / Venn / ). The genes in the intersection were the predicted target genes of gga-let-7a-3p.

[0025] 1.2 gga-let-7a-3p and RICTOR interaction verification experiment To further clarify the interaction between gga-let-7a-3p and RICTOR, the experiment was carried out by constructing RICTOR wild type (WT) and mutant (MT) report plasmid, and synthesizing gga-let-7a-3p mimics and corresponding negative control (NC), and carrying out dual luciferase reporter gene experiment in DF-1 cells. The specific experimental steps are as follows: (1) Gene synthesis and vector construction: The target sequence (about 200 bp, including the binding site of gga-let-7a-3p) of wild type sequence RICTOR-WT and mutant sequence RICTOR-MT was cloned into pmirGLO dual luciferase reporter vector, pmirGLO was purchased from Jin Kai Rui Biological Technology Co., Ltd., and gga-let-7a-3p mimics (sequence is CUAUACAAUCUACUGUCUUUCC) and its corresponding NC (sequence is UUGUACUACACAAAAGUACUG) control were synthesized by the above company.

[0026] (2) Cell transfection: Lipofectamine 3000 was used to transfect DF-1 cells. The experimental settings include four groups: NC-mimics+RICTOR-WT, gga-let-7a-3p-mimics+RICTOR-WT, NC-mimics+RICTOR-MT, and gga-let-7a-3p-mimics+RICTOR-MT.

[0027] (3) Dual luciferase experiment: 48 h after transfection, Dual-Luciferase® Reporter Assay System dual luciferase reporter gene detection kit was used to detect luciferase activity. First, the firefly luciferase activity was detected, then the sea kidney luciferase activity was detected, and the manufacturer's instructions were followed. Calculate the relative luciferase activity (RLU) of each sample, and standardize the firefly luciferase activity to the sea kidney luciferase activity.

[0028] (4) Experimental result analysis: By comparing the luciferase activity between different groups, the effect of gga-let-7a-3p on the expression of RICTOR-WT and RICTOR-MT reporter genes was evaluated. If the gga-let-7a-3p mimic can significantly down-regulate the activity of the RICTOR-WT reporter gene while having little effect on the activity of the RICTOR-MT, it indicates that gga-let-7a-3p directly regulates RICTOR expression through its predicted binding site. On the contrary, if there is no obvious effect or similar effect on the activity of the two reporter genes, it may indicate that the interaction of gga-let-7a-3p with RICTOR is not achieved through direct target binding.

[0029] 1.3 Design, construction and transfection of siRNA and overexpression plasmid of RICTOR According to the sequence of RICTOR, siRNA was designed, and the sequence was CCGTGTATGTGCGAGCAGATGTA and GGAGATACACGCTCGTCTACATT. The overexpression plasmid of RICTOR was constructed using the pcDNA3.1(+) commercial vector, which was purchased from Shanghai Link-Ma Biological Engineering Co., Ltd. (structure as shown in Figure 8 ), and the overexpression plasmid was constructed by Chengdu Baolu Biological Technology Co., Ltd. siRNA was constructed by Shanghai Jimabio Technology Co., Ltd. The cell density reached 70%-80% confluence when the cell transfection was carried out, and the specific steps of transfection were as follows: First, dilute the Lipofectamine 3000 reagent with Opti-MEM medium, and add 4 μL of diluted Lipofectamine 3000 to each 6-well plate hole. At the same time, siRNA or overexpression plasmid is also diluted with Opti-MEM medium for use. If it is an overexpression plasmid, additional p 3000 reagent is added to prepare a premix. Then, mix the premix of Lipofectamine 3000 with the premix of siRNA or overexpression plasmid, and incubate at room temperature for 20 min. Finally, transfect the mixture into cells, and adjust the transfection time according to the experimental requirements. After completion, collect the samples for subsequent analysis.

[0030] 1.4 In vivo overexpression of gga-let-7a-3p 40 healthy Roman chicks of 7 days old were randomly divided into 2 groups (n=20), and overexpression was completed by continuous 14-day liver in situ injection of stimulator gga-let-7a-3p agomir (i.e. 2'-methoxy modified gga-let-7a-3p), with a dose of 80 mg / g body weight each time, and the control group was injected with the same amount of agomir NC. The gga-let-7a-3p agomir and agomir NC were synthesized by Chengdu Baolu Biological Technology Co., Ltd. At 21 days, the weight was measured and liver samples were collected, and the liver tissue was divided into three parts, one of which was soaked in 4% paraformaldehyde fixing solution for liver section preparation, another part was quickly frozen in liquid nitrogen and stored at -80°C, and the expression of related proteins was detected by real-time qRT-PCR and Western blot. The specific injection steps are as follows: (1) Preparation and evaluation: Before the experiment, carefully select healthy chicks with good health and no obvious stress performance to reduce experimental variability. Evaluate their health status by light touch and observation of behavior, and ensure that each operation minimizes the disturbance to the animals.

[0031] (2) Sterile operating environment: All operations are carried out in strict sterile conditions, using 75% alcohol to disinfect the operating area and tools, including microsyringes, injection needles and the surface skin and feathers of the chick liver site, to avoid infection.

[0032] (3) Precise liver positioning: Inject about 3 mm from the midline 1 cm below the keel to determine the best injection point, ensuring accuracy of injection and reducing damage to surrounding tissues.

[0033] (4) Injection process: During the injection process, use fine operation skills to slowly and steadily inject gga-let-7a-3p agomir (i.e. 2'-methoxy modified gga-let-7a-3p) and agomir NC (i.e. 2'-methoxy modified NC) into the previously positioned liver area. According to previous test data, adjust the injection depth and speed to ensure the highest transfection efficiency and minimal tissue damage.

[0034] (5) Recovery and monitoring: After the injection is completed, the chicks are gently returned to the recovery area and monitored in suitable environmental conditions. Observe their behavior and physiological reactions, and record any unusual performance to ensure their health status.

[0035] 1.5 Immunohistochemical staining (IHC) For chicken liver immunohistochemical staining, the tissue sections were deparaffinated and rehydrated. Citrate buffer was used for antigen retrieval. The anti-RICTOR primary antibody was incubated overnight at 4°C to block endogenous peroxidase activity. After washing, the sections were incubated with the secondary antibody and developed with 3, 3'-diaminobenzidine (DAB). The stained sections were observed under a light microscope and images were captured with a digital camera. The expression of Rictor was evaluated by observing the intensity and distribution of cell staining in liver tissue.

[0036] 2 Results and analysis 2.1 Prediction and identification of gga-let-7a-3p target genes To further study the molecular mechanism of gga-let-7a-3p regulating lipid metabolism disorder in chicken primary hepatocytes, bioinformatics online software TargetScan and miRDB were used to predict the potential target genes of gga-let-7a-3p. At the same time, a Wayne analysis was performed with the related genes in the mTOR signaling pathway (mainly related to metabolic regulation and fat synthesis) enriched in KEGG in the research results of Chapter 4.3.1, and it was found that there were 3 common target mRNAs, including RICTOR, SOS2 and KRAS (Fig. 4A). Figure 1 A). Next, qRT-PCR was used to detect the mRNA expression level of the above 3 target genes after overexpression of gga-let-7a-3p in hepatocytes, and the results showed that only the mRNA expression level of RICTOR was significantly down-regulated after transfection of mimic gga-let-7a-3p (Fig. 4B). Figure 1 B), so RICTOR was selected as a candidate target gene of gga-let-7a-3p. Based on the target site, the target site and its sequence before and after it were constructed into a dual luciferase reporter gene vector (pmirGLO), and wild-type dual luciferase reporter gene (pmirGLO-RICTOR-WT) and mutant dual luciferase reporter gene (pmirGLO-RICTOR-MT) were constructed, respectively. The sequence of the binding site was mutated from "AGGTTG" to "GAACCA" (Fig. 4C). Figure 1 C). The results of the dual luciferase reporter assay of DF-1 cells in vitro showed that after co-transfection of dual luciferase reporter gene and mimic gga-let-7a-3p, the luciferase activity in pmirGLO-RICTOR-WT plasmid decreased, but there was no change in cells co-transfected with mutant reporter gene (Fig. 4D). Figure 1(D) indicates that gga-let-7a-3p has a target relationship with RICTOR. Furthermore, transfection of chicken primary hepatocytes with a PCDNA3.1 overexpression vector plasmid for RICTOR resulted in a significant increase in RICTOR protein levels according to Western blotting. However, co-transfection with mimic gga-let-7a-3p significantly downregulated RICTOR levels. Figure 1 E and 1 F). In summary, these results preliminarily indicate that RICTOR is a target gene of gga-let-7a-3p.

[0037] Western blot results further confirmed that overexpression of gga-let-7a-3p also reduced the levels of p-AKT and p-FOXO1 in chicken hepatocytes. Figure 2 (A and 2B), while inhibiting gga-let-7a-3p increased p-AKT and p-FOXO1 levels ...). Figure 2 (A and 2C).

[0038] 2.2 RICTOR reduces lipogenesis in primary chicken hepatocytes and alleviates oxidative stress and inflammation levels. The effects of RICTOR on chicken primary hepatocytes were further investigated by transfecting RICTOR siRNA and the overexpression vector plasmid pcDNA3.1-RICTOR. qRT-PCR results showed that RICTOR expression was significantly reduced after transfection with RICTOR siRNA. Figure 3 A), while a significant increase was observed after transfection with pcDNA3.1-RICTOR (A). Figure 3 B). Simultaneously, overexpression of RICTOR significantly downregulated the mRNA levels of FASN and SCD, and the protein level of FASN was also significantly downregulated, while the mRNA and protein levels of PPARα increased. Figure 4 AD reduced lipid droplet deposition in primary chicken hepatocytes. Figure 4 The contents of EF) and TG and TC ( Figure 4 (HI). Knocking down RICTOR in hepatocytes produces the opposite result.

[0039] Furthermore, we observed that overexpression of RICTOR significantly increased the expression levels of hepatocyte antioxidant-related proteins Nrf2, SOD2, and HO1, while interference with RICTOR significantly decreased the levels of these proteins. Figure 5 AB). Meanwhile, MDA levels were also significantly reduced after RICTOR overexpression ( ). Figure 5 C), T-SOD activity increased ( Figure 5 D). Furthermore, we found that RICTOR significantly reduced the protein levels of TNF-α, IL-1β, and IL-6 after surface examination. Figure 5A-B), the levels of TNF-a and IL-6 in hepatocytes were also lower than the control group Figure 5 E-F). However, the opposite results were observed after interfering RICTOR in hepatocytes. These results indicated that RICTOR could reduce lipogenesis, oxidative stress and inflammation in chicken primary hepatocytes.

[0040] 2.3 gga-let-7a-3p regulates lipid metabolism disorder in chicken primary hepatocytes through RICTOR / AKT / FOXOl signaling axis In addition, we found that the protein levels of FASN and TNF-a in hepatocytes were reduced after co-transfection of Inhibitor gga-let-7a-3p and Si-NC Figure 6 A-C). However, the addition of Si-RICTOR reversed this trend Figure 6 C). In addition, the phosphorylation levels of AKT and FOXOl were increased after co-transfection with Inhibitor gga-let-7a-3p and Si-NC, but the increased phosphorylation levels were reduced in the co-transfection group of Inhibitor gga-let-7a-3p and Si-RICTOR. Taken together, these results indicated that gga-let-7a-3p regulates chicken liver metabolism, oxidative stress and inflammation through the RICTOR / PI3K / AKT signaling pathway.

[0041] 2.4 gga-let-7a-3p promotes lipid synthesis, oxidative stress and inflammation in chicken liver To further verify the function of gga-let-7a-3p in vivo, we injected gga-let-7a-3p agmir into the liver of 7-day-old Roman chicks for 14 d Figure 7 A). On the 14th day after treatment, we found that the body weight and liver weight of chicks in the gga-let-7a-3p agonist group were significantly increased compared with the NC group Figure 7 B-C). The results of liver HE and oil red O staining showed that the hepatocyte fat vacuoles and lipid droplet deposition in the gga-let-7a-3p agonist group were significantly increased compared with the NC group Figure 7 D). At the same time, the results of immunohistochemistry and WB showed that the expression level of RICTOR in the liver of chicks in the gga-let-7a-3p agomir group was also significantly reduced Figure 7 D and Figure 7 E). The results of WB showed that the expression levels of FASN, TNFa and IL-1 β in the liver of chicks in the gga-let-7a-3p agomir group were higher, while the expression levels of PPARa, SOD2 and HO1 were lower compared with the NC group Figure 7E and 7G). ELISA results showed that the contents of TC, TG, TNF-α, IL-6 and MDA in the liver of the chicks injected with gga-let-7a-3 agonist were higher than those in the NC group, while the content of T-SOD was lower than that in the NC group Figure 7 H-K). In summary, gga-let-7a-3p can accelerate the lipid synthesis, oxidative stress and inflammatory response in the liver of chicks.

[0042] The above describes the preferred embodiments of the present application, but is not intended to limit the present application. Those skilled in the art can make improvements and changes to the embodiments disclosed herein without departing from the scope and spirit of the present application.

Claims

1. Use of RICTOR target in regulating formation of fatty liver in poultry, wherein the anchored target sequence of RICTOR is SEQ ID No.

1.

2. The use according to claim 1, wherein the regulation refers to overexpression in poultry by transfecting overexpression plasmid of RICTOR, thereby reducing lipogenesis in chicken primary hepatocytes and alleviating oxidative stress and inflammation level.

3. The use according to claim 2, wherein the structure of the overexpression plasmid of RICTOR is pcDNA3.1 (+) vector-3xFlag-C.

4. The use according to claim 1, wherein the regulation refers to inhibiting expression of RICTOR by RICTOR si-RNA.

5. The use according to claim 4, wherein the sequence of the RICTOR si-RNA is: CCGTGTATGTGCGAGCAGATGTA and GGAGATACACGCTCGTCTACATT.

6. The use according to claim 1, wherein the regulation refers to inhibiting expression of RICTOR by transfecting gga-let-7a-3p, wherein the sequence of the gga-let-7a-3p is: 5'-CUAUACAAUCUACUGUCUUUCC-3'.

7. The use according to any one of claims 1-6, wherein the poultry refers to laying hens.

8. Use of overexpression plasmid of RICTOR in preparation of a medicament for reducing lipogenesis in chicken primary hepatocytes and alleviating oxidative stress and inflammation level.

9. The use according to claim 8, wherein the structure of the overexpression plasmid of RICTOR is pcDNA3.1 (+) vector-3xFlag-C. ​ ​