Application of circZFAND6 as target spot in preparation of product for treating ovarian cancer

Abstract

The invention discloses application of circZFAND6 as a target spot in preparation of a product for treating ovarian cancer, and belongs to the technical field of biological medicine. The invention discloses a key action mechanism of circZFAND6 derived from TAMs exosome in the occurrence and development of the ovarian cancer. After the exosome circZFAND6 secreted by the TAMs is over-expressed and is taken by the ovarian cancer cells, the proliferation, migration and invasion capabilities of the cancer cells can be remarkably promoted; knock-down can effectively inhibit the malignant biological behaviors. According to the circZFAND6, the stability of c-Myc protein is maintained, glycolysis key enzyme expression regulated and controlled by c-Myc is up-regulated, the Warburg effect is enhanced, and the malignant progression of ovarian cancer is accelerated. The invention not only provides a solid theoretical basis and experimental evidence for the therapy strategy of the targeted circZFAND6 ovarian cancer, but also opens up a new direction for the intervention research of tumor metabolism reprogramming.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of circZFAND6 as a target in the preparation of products for treating ovarian cancer. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Ovarian cancer is the deadliest gynecological malignancy, with most patients diagnosed at an advanced stage (stage III / IV). Current standard treatments (cytoreductive surgery combined with platinum-based chemotherapy) have limited effectiveness for advanced patients and a high recurrence rate. There is an urgent clinical need for new intervention targets and precision treatment strategies.

[0004] Tumor-associated macrophages (TAMs) deliver functional molecules (such as circRNAs) to ovarian cancer cells via exosomes, regulating their malignant behavior (proliferation, metastasis, anti-apoptosis, etc.). However, the specific mechanisms of action, regulatory networks, and potential as diagnostic and therapeutic targets of specific circRNAs derived from TAM exosomes in ovarian cancer have not been fully elucidated.

[0005] Therefore, systematically elucidating the role of TAMs exosomal circRNAs in ovarian cancer progression is of great significance for discovering new diagnostic biomarkers and therapeutic targets. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the purpose of this invention is to provide an application of circZFAND6 as a target in the preparation of products for treating ovarian cancer. This invention reveals for the first time the key mechanism of action of circZFAND6 derived from TAMs exosomes in the occurrence and development of ovarian cancer, and that knocking down circZFAND6 can effectively inhibit the proliferation, migration and invasion of cancer cells.

[0007] To achieve the above objectives, the technical solution of the present invention is as follows: In a first aspect, the invention provides the use of a substance that inhibits or reduces the expression of circZFAND6 in one or more of the following: (a1) Products that inhibit the proliferation of ovarian cancer cells; (a2) Products that inhibit the migration and invasion of ovarian cancer cells; (a3) Products that inhibit the growth of ovarian cancer; (a4) Products that inhibit the malignant metastasis of ovarian cancer; (a5) Products that inhibit c-Myc-mediated glycolysis in ovarian cancer cells; (a6) Products for treating ovarian cancer.

[0008] In some embodiments of the present invention, the substances that inhibit circZFAND6 expression or reduce its activity include, but are not limited to, RNA interference molecules or antisense oligonucleotides, small molecule inhibitors, siRNA, shRNA, substances for lentiviral infection or gene knockout, etc., and are not specifically limited here.

[0009] In some embodiments of the present invention, the sequence of the siRNA is shown as SEQ ID NO.8-9, SEQ ID NO.10-11 or SEQ ID NO.12-13.

[0010] In some embodiments of the present invention, the product may be a pharmaceutical or an experimental reagent for non-pharmaceutical purposes. The experimental reagent may be used for basic research. For example, the product may be used to regulate the malignant biological behavior of ovarian cancer cells in vitro or in vivo, thereby preparing biological models related to ovarian cancer cells and laying the foundation for mechanistic research on diseases such as ovarian cancer. In some embodiments of the present invention, the circZFAND6 is derived from tumor-associated macrophage (TAM) exosomes.

[0011] A second aspect of the present invention provides the use of circZFAND6 as a target in screening drugs for the treatment of ovarian cancer.

[0012] In some embodiments of the present invention, the method for screening drugs for treating ovarian cancer includes: (b1) Treat the system that overexpresses or contains circZFAND6 with the candidate substance; set up a parallel control that is not treated with the candidate substance; (b2) After completing step (b1), detect the expression level of circZFAND6 in the system; if the expression level of circZFAND6 in the system treated with the candidate substance is significantly reduced compared with the parallel control, the candidate substance can be used as a candidate drug for the treatment of ovarian cancer.

[0013] In some embodiments of the present invention, the system is a cell system, a solution system, a tissue system, an organ system, or an animal system.

[0014] In some embodiments of the present invention, the cells in the cell system are ovarian cancer cells, the tissues in the tissue system are ovarian cancer tissues, and the organs in the organ system are ovaries or cancerous ovaries.

[0015] In some embodiments of the present invention, the animals in the animal system are mammals, including any one or more of mice, rats, guinea pigs, rabbits, monkeys, orangutans, and humans.

[0016] The beneficial effects of this invention are as follows: This invention reveals for the first time the crucial role of circZFAND6, derived from TAMs exosomes, in the development and progression of ovarian cancer. It is a key molecule driving malignant progression of ovarian cancer (including proliferation, migration, and invasion), filling a gap in research on the mechanisms of action of specific circRNAs in ovarian cancer. This invention elucidates the specific molecular pathway by which circZFAND6 exerts its effect: by stabilizing c-Myc protein, it upregulates the expression of key glycolytic enzymes it regulates, significantly enhancing the "Warburg effect" (i.e., aerobic glycolysis) in ovarian cancer cells and accelerating malignant progression, providing a new regulatory mechanism explanation for tumor metabolic reprogramming. Experiments demonstrate that the exosome circZFAND6 secreted by TAMs possesses a stable circular structure. When overexpressed and taken up by ovarian cancer cells, it significantly promotes the proliferation, migration, and invasion of cancer cells; conversely, knockdown of circZFAND6 effectively inhibits the malignant biological behavior of ovarian cancer cells. This demonstrates that circZFAND6 is a functional, druggable intervention target, laying a solid theoretical foundation and experimental evidence for developing innovative ovarian cancer therapies targeting circZFAND6 (such as RNAi therapy, antisense oligonucleotides, etc.). This invention not only provides a direct target (circZFAND6) but also reveals its key mechanism of regulating tumor metabolism (Warburg effect), opening up a novel treatment strategy and research direction of "targeting TAMs-exosomes-circRNA-metabolic reprogramming" to overcome the current treatment dilemmas of ovarian cancer (especially in advanced and recurrent patients). This not only provides a solid theoretical foundation and experimental evidence for ovarian cancer treatment strategies targeting circZFAND6 but also opens up new directions for interventional research on tumor metabolic reprogramming. As a key functional molecule for TAMs exosome delivery, the expression level of circZFAND6 or its form in body fluids has the potential to become a novel molecular marker for ovarian cancer diagnosis or prognostic assessment. Attached Figure Description

[0017] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0018] Figure 1 The expression of circZFAND6 in normal ovarian epithelial cells, ovarian cancer cells, and tumor-associated macrophages.

[0019] Figure 2This study validated the cyclization and stability of circZFAND6. In the figures, A represents Sanger sequencing results, B represents DNA agarose gel electrophoresis results, C represents drug resistance detection results after the addition of RNase R, and D represents half-life detection results after the addition of actinomycin D.

[0020] Figure 3 This section describes the identification and phagocytosis of exosomes derived from TAMs. A shows a transmission electron microscope image of exosomes, B shows the results of exosome nanoparticle tracking analysis, C shows the results of Western blot analysis of exosome markers, and D shows the results of FISH combined with immunofluorescence assay.

[0021] Figure 4 To assess the proliferation capacity of ovarian cancer cells after treatment with tumor-associated macrophage-derived exosomes with overexpression or knockdown of circZFAND6, the following data are presented: A represents the expression level of circZFAND6 in the overexpression and knockdown models; B represents the CCK-8 cell proliferation assay results in the overexpression and knockdown models; and C represents the colony formation assay results in the overexpression and knockdown models.

[0022] Figure 5 To assess the migration and invasion capabilities of ovarian cancer cells after treatment with exosomes derived from tumor-associated macrophages that overexpress or knock down circZFAND6, the results are presented in A as a scratch assay and B as a Transwell assay.

[0023] Figure 6 This study aimed to screen and validate proteins interacting with circZFAND6. In the figures, A represents the results of a Western blot experiment after RNA pulldown, and B represents the results of an RNA immunoprecipitation experiment.

[0024] Figure 7 To stabilize c-Myc protein expression with circZFAND6, enhance the activity of c-Myc-regulated glycolytic enzymes, and promote glycolysis in ovarian cancer cells. In the figures, A represents the results of co-immunoprecipitation (Co-IP) experiments; B represents the Western blot results of glycolytic enzymes after circZFAND6 overexpression; C represents the Western blot results of glycolytic enzymes after circZFAND6 knockdown; D represents the amount of lactate produced in the cell supernatant after circZFAND6 overexpression; E represents the amount of lactate produced in the cell supernatant after circZFAND6 knockout; F represents the amount of glucose consumed in the cell supernatant after circZFAND6 overexpression; and G represents the amount of glucose consumed in the cell supernatant after circZFAND6 knockout. Detailed Implementation

[0025] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0026] The circZFAND6 is derived from human chromosome 15, and its corresponding DNA nucleotide sequence is: GGTGCAACTGAGGAACATGGCTCAAGAAACTAATCACAGCCAAGTGCCTATGCTTTGTTCCACTGGCTGTGGATTTTATGGAAACCCTCGTACAAATGGCATGTGTTCAGTATGCTATAAAGAACATCTTCAAAGACAGAATAGTAGTAATGGTAGAATAAGCCCACCTGCAACCTCTGTCAGTAGTCTGTCTGAATCTTTACCAGTTCAATGCACAGATGGCAGTGTGCCAGAAGCCCAGTCAGCATTAGACTCTACATCTTCATCTATGCAGCCCAGCCCTGTATCAAATCAGTCACTTTTATCAGAATCTGTAGCATCTTCTCAATTGGACAGTACATCTGTGGACAAAGCAGTACCTGAAACAGAAGATGTGCAGG (SEQ ID NO.1).

[0027] Example 1: Extraction and Identification of TAMs Exosomes 1. In vitro induction of TAMs THP-1 cells were induced into M0 macrophages by treating them with 100 ng / mL PMA for 48 h, and then the M0 macrophages were induced into tumor-associated macrophages (TAMs) by treating them with ovarian cancer cell (OVCAR8 and SKOV3) conditioned medium for 72 h.

[0028] 2. Extraction of TAMs exosomes TAMs cells transfected with expression plasmids or siRNA were cultured for 48 hours, and the supernatant was collected for exosome extraction. First, the cell culture supernatant was centrifuged at 300×g for 10 minutes to remove cells, followed by centrifugation at 2000×g for 20 minutes to remove cell debris. Then, large vesicles and debris were removed by centrifugation at 10000×g for 30 minutes. Finally, the exosomes were precipitated by ultracentrifugation (100000×g, 4°C, 70 minutes), resuspended in PBS, and centrifuged again to purify the exosomes.

[0029] 3. Identification of TAMs exosome characteristics The extracted exosomes were observed using transmission electron microscopy to determine their typical vesicle morphology, and their particle size distribution was detected using nanoparticle tracking analysis. The specificity of exosome marker proteins CD63, Alix, and TSG101 was verified by Western blot detection.

[0030] Example 2: RT-qPCR detection of circZFAND6 expression Total RNA was extracted from normal ovarian epithelial cells, the ovarian cancer cell line OVCAR8, and tumor-associated macrophages (TAMs). cDNA was synthesized by reverse transcription using the PrimeScript™ RT Reagent Kit, and real-time quantitative PCR (qPCR) was performed using SYBR® GreenMaster Mix. β-actin was used as an internal control gene, and 2... -ΔΔCt The method calculates the relative expression level of the target gene.

[0031] Example 3: Cycloning and Stability Verification of circZFAND6 1. Circulation verification of circZFAND6 Total RNA was extracted from treated OVCAR8 and SKOV3 cells for RT-qPCR. The RT-qPCR amplification products were used as templates for Sanger sequencing using corresponding forward and reverse primers. Sequencing results were analyzed using Chromas software to read peak diagrams and compared with reference sequences to verify the correctness of the target sequences.

[0032] The sequence of the forward primer is: GAGCCCAGTCAGCATTAGA (SEQ ID NO.2).

[0033] The reverse primer sequence is: TTGAGCCATGTTCCTCAGTT (SEQ ID NO.3) Simultaneously, the RT-qPCR amplification product was mixed with 6× loading buffer at a 5:1 ratio and loaded onto the gel, with 5 μL of DNA marker added as a molecular weight reference. Electrophoresis conditions were set to 5–10 V / cm (depending on gel length) in a 1% agarose gel for 30–60 minutes. After electrophoresis, the gel was placed in a gel imaging system for observation and photographing under UV light. The length and approximate concentration of the sample DNA fragments were determined based on the marker bands.

[0034] To verify the stability of circZFAND6, total RNA was extracted from TAMs and treated OVCAR8 and SKOV3 cells and subjected to RNase R treatment experiments. Each reaction mixture consisted of 20 μL, including: 1 μg total RNA, 2 μL 10× reaction buffer, 2 μL RNase R enzyme (experimental group) or 2 μL DEPC water (mock control group), 1 μL RNase inhibitor, and the remaining volume was brought to 20 μL with DEPC water. After mixing, the mixture was incubated at 37°C for 30 minutes for RNase R digestion, followed by heating at 70°C for 10 minutes to terminate the reaction. RT-qPCR was performed using divergent primers for circZFAND6 and convergent primers for ZFAND6 to assess the expression of circZFAND6 and linear ZFAND6 mRNA in different treatment groups.

[0035] The sequences of the divergent primers are as follows: Forward primer: GAGCCCAGTCAGCATTAGA (SEQ ID NO.4) Reverse primer: TTGAGCCATGTTCCTCAGTT (SEQ ID NO.5) The sequence of the convergence primers is as follows: Forward primer: CCTGCAACCTCTGTCAGTAGTCT (SEQ ID NO.6) Reverse primer: GGGCTGCATAGATGAAGATGTAG (SEQ ID NO.7) Pretreated OVCAR8 and SKOV3 ovarian cancer cells were seeded at a density of 60%–70% in six-well plates. After the cells were stably adhered, a treatment solution was prepared by diluting actinomycin D stock solution at a ratio of 1:1000 in complete culture medium (RPMI-1640). Actinomycin D treatment times were set at 0, 4, 8, 12, and 24 hours. After treatment, total RNA was extracted from each well, and RT-qPCR was performed using divergent primers for circZFAND6 and convergent primers for ZFAND6 to analyze the degradation of circZFAND6 and linear ZFAND6 mRNA at different time points.

[0036] Example 4: Construction of circZFAND 6 overexpression and interfering sequences and cell transfection 1. Carrier Construction The full-length sequence of circZFAND6 was amplified from human ovarian cancer cell cDNA by RT-PCR and cloned into the pLO5-ciR expression plasmid, named pLO5-ciR-circZFAND6, for overexpression experiments.

[0037] Three small interfering RNA (siRNA) sequences targeting circZFAND6 were designed and synthesized by a commercial company, and named si-circZFAND6#1, si-circZFAND6#2, and si-circZFAND6#3, respectively. A non-specific siRNA was also included as a negative control (si-NC) to evaluate the specific interference effect.

[0038] The sequences of the three small interfering RNAs are as follows: si-circZFAND6#1: Chain of Justice: GAAGAUGUGCAGGGUGUGCTT (SEQ ID NO.8); Antonym chain: GCACACCCUGCACAUCUUCTT (SEQ ID NO.9).

[0039] si-circZFAND6#2: Chain of Justice: GAUUGUGCAGGGUGUGCAACTT (SEQ ID NO.10); Antonym chain: GUUGCACACCCUGCACAUCTT (SEQ ID NO.11).

[0040] si-circZFAND6#3: Chain of Justice: CAGGGUGUGCAACUGAGGATT (SEQ ID NO.12); Antonym chain: UCCUCAGUUGCACACCCUGTT (SEQ ID NO.13).

[0041] The sequence of the nonspecific siRNA is: Chain of Justice: UUCUCCGAACGUGUCACGUTT (SEQ ID NO.14) Antonym chain: ACGUGACACGUUCGGAGAATT (SEQ ID NO.15).

[0042] 2. Cell transfection and validation.

[0043] The pcDNA3.1-circZFAND6 plasmid or siRNA was transfected into TAMs using Lipofectamine™ 3000 transfection reagent. RNA was extracted from cells 48 hours after transfection, and changes in circZFAND6 expression levels were detected by RT-qPCR. The two siRNAs with the most significant interference effects were selected for subsequent functional experiments based on their interference efficiency.

[0044] Example 5: Effect of circZFAND6 on the malignant phenotype of ovarian cancer cells 1. Colony Formation Experiment OVCAR8 and SKOV3 cells were seeded into 6-well plates, with approximately 500 cells per well. Cells were cultured at 37°C and 5% CO2 for 10–14 days. After colony formation, cells were fixed with 4% paraformaldehyde and stained with crystal violet. Cell colonies larger than 50 μm in diameter were observed and counted under a microscope to assess cell proliferation and colony formation capacity.

[0045] 2. CCK-8 cell proliferation experiment Cells were seeded at a density of 3000 cells per well in 96-well plates. At 0, 24, 48, 72 and 96 hours, 10 μL of CCK-8 reagent was added to each well. After incubation for another hour, the absorbance (OD value) at each time point was measured at a wavelength of 450 nm, and cell growth curves were plotted to assess proliferation capacity.

[0046] 3. Scratch test OVCAR8 or SKOV3 cells were seeded in 6-well plates and cultured until the cell density reached approximately 90%. Vertical scratches were made on the cell monolayer using a 200 μL sterile pipette tip, and the scratch width was initially photographed and recorded. After gently washing with PBS to remove cell debris, serum-free medium was added, and the cells were cultured for another 24 hours. The scratch width was photographed again, and the degree of scratch closure was used to assess cell migration ability.

[0047] 4. Transwell migration and invasion experiments OVCAR8 or SKOV3 cells resuspended in serum-free medium were seeded into the upper chamber of a Transwell chamber, while RPMI-1640 complete medium containing 10% fetal bovine serum was added to the lower chamber as a chemokine.

[0048] Migration assays were performed using Transwell chambers without a basement membrane; invasion assays were performed by pre-coating the upper luminal membrane with Matrigel to simulate the ability of cells to invade the matrix. After incubation for 24 hours (migration) or 48 hours (invasion), non-migrating / invading cells were removed, and cells that had crossed the membrane surface were fixed with paraformaldehyde, stained with crystal violet, and counted under a microscope to assess cell migration and invasion capabilities.

[0049] Example 6: Screening and validation of circZFAND6 interacting proteins 1. RNA pulldown A biotin-labeled circZFAND6 probe was synthesized via in vitro transcription and co-incubated with OVCAR8 and SKOV3 cell lysates to capture proteins that specifically bind to circZFAND6. Subsequently, streptavidin magnetic beads were added to enrich the RNA-protein complex, followed by multiple washes to remove non-specifically bound components. The purified complex was then subjected to silver staining to observe the overall protein binding, and mass spectrometry was used to screen for candidate proteins that may interact with circZFAND6. Finally, Western blot was used to validate the selected candidate proteins and confirm their specific binding relationship with circZFAND6.

[0050] 2. RNA Immunoprecipitation Assay Ovarian cancer cell lysate was incubated with 14-3-3σ antibody to capture complexes interacting with the 14-3-3σ protein. The antibody-protein complexes were then enriched using Protein A / G magnetic beads and washed multiple times to remove non-specific conjugates. Co-precipitated RNA was extracted from the enriched complexes, and the expression level of circZFAND6 was detected using RT-qPCR to assess whether it directly or indirectly binds to the 14-3-3σ protein. Isotype IgG was used as a negative control to ensure the specificity and reliability of the results.

[0051] Example 7: circZFAND6 promotes glycolysis in ovarian cancer cells by stabilizing c-Myc expression. 1. Detection of expression of key enzymes in glycolysis Total protein was extracted from ovarian cancer cells in TAMs exosomes that had been overexpressed or knocked down with circZFAND6. Western blot was used to detect the protein expression levels of key downstream glycolytic enzymes regulated by c-Myc: hexokinase 2 (HK2), phosphoglycerate kinase 1 (PGK1), and lactate dehydrogenase A (LDHA). β-actin was used as an internal control for normalization analysis to assess the regulatory role of circZFAND6 in the expression of glycolysis-related molecules.

[0052] 2. Analysis of lactic acid production and glucose consumption Supernatants were collected from ovarian cancer cells in different treatment groups and corresponding control groups after 48 hours of culture. Lactate production and residual glucose concentration in the culture medium were measured using commercially available lactate and glucose assay kits. All data were normalized to cell count to ensure comparability and accuracy of the results.

[0053] Example 6 Statistical Analysis All experimental data are expressed as mean ± standard deviation (Mean ± SD). Each experiment was performed independently at least three times. All experimental data were statistically analyzed using software. Differences between two groups were compared using a two-tailed independent samples t-test, and data comparisons among multiple groups were performed using one-way ANOVA. P < 0.05 was considered statistically significant (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001).

[0054] Experimental results 1. circZFAND6 is specifically highly expressed in tumor-associated macrophages. RT-qPCR results ( Figure 1 The results showed that circZFAND6 was significantly highly expressed in TAMs compared to normal ovarian epithelial cells and ovarian cancer cells.

[0055] 2. circZFAND6 was identified as a circular RNA and was stably expressed. Sanger sequencing results ( Figure 2 Figure A shows that circZFAND6 is 381 nt long and is formed by the reverse splicing of exon 3 and exon 5. DNA agarose gel electrophoresis results ( Figure 2 Figure B shows that circZFAND6 can only be amplified by divergent primers from cDNA, but not by genomic DNA from ovarian cancer cells. Furthermore, circZFAND6 exhibits stronger resistance to RNase R treatment compared to linear ZFAND6. Figure 2(Figure C). Actinomycin D treatment verified that the half-life of circZFAND6 was longer than that of linear ZFAND6 mRNA. Figure 2 (D diagram).

[0056] 3. Identification of TAM-derived exosomes and exosome phagocytosis Exosomes were successfully isolated from the supernatant of TAMs cell culture. Transmission electron microscopy (TEM) revealed that the extracted exosomes exhibited a typical double-membrane-enclosed, circular vesicle structure. Figure 3 (Figure A). Nanoparticle tracking analysis (NTA) results showed that the particle size of these exosomes was mainly distributed between 50–150 nm, consistent with the typical characteristics of exosomes. Figure 3 (Figure B in the middle). Western blot analysis showed that the isolated products were enriched with exosome-specific marker proteins CD63, Alix, and TSG101, while the endoplasmic reticulum marker protein Calnexin was not detected, further indicating that the extracted exosomes had high purity. Figure 3 (Figure C). Furthermore, FISH combined with immunofluorescence (FISH-IF) experiments showed that ovarian cancer cells could effectively phagocytose exosomes derived from TAMs, suggesting their potential role in intercellular communication. Figure 3 (D diagram).

[0057] 4. TAMs-derived exosomes promote ovarian cancer cell proliferation via circZFAND6. Overexpression and knockdown models of circZFAND6 were constructed in TAMs, respectively. TAM exosomes were extracted and added to OVCAR8 and SKOV3 cell culture media. After 48 hours, the intervention efficiency was verified by RT-qPCR. The results showed that the expression level of circZFAND6 changed significantly in the corresponding treatment groups, indicating a good intervention effect. Figure 4 (Figure A). Subsequently, exosomes secreted by TAMs from the different treatment groups were added to the ovarian cancer cell culture system. CCK-8 cell proliferation and colony formation assays showed that, compared to the control group, overexpression of circZFAND6 significantly enhanced the proliferation ability of ovarian cancer cells; while knockdown of circZFAND6 significantly inhibited cell proliferation (…). Figure 4 (Figures B and C in the middle).

[0058] 5. TAMs-derived exosomes promote ovarian cancer cell migration and invasion via circZFAND6. Scratch test ( Figure 5 Figure A) and Transwell experiment ( Figure 5(Figure B) The results showed that, compared with the control group, overexpression of circZFAND6 significantly enhanced the migration and invasion abilities of ovarian cancer cells. Conversely, the cell migration and invasion abilities of the circZFAND6 knockdown group were significantly weakened. 6.14-3-3σ is a binding protein of circZFAND6. RNA pulldown combined with mass spectrometry analysis was used to screen and identify circZFAND6 as a protein that specifically binds to 14-3-3σ. Further Western blot and RNA immunoprecipitation (RIP) experiments were used to verify their interaction, confirming that circZFAND6 can directly bind to 14-3-3σ. Figure 6 (Figures A and B in the middle).

[0059] 7. circZFAND6 promotes glycolysis in ovarian cancer cells by stabilizing c-Myc expression. Co-immunoprecipitation (Co-IP) experiments showed that 14-3-3σ could form a complex with c-Myc, suggesting a protein-protein interaction between the two. Figure 7 (Figure A). Further Western blot analysis showed that, with circZFAND6 overexpression, c-Myc protein levels were significantly upregulated, and the expression of its downstream glycolysis key enzymes HK2, PGK1, and LDHA also increased accordingly; conversely, when circZFAND6 was knocked down, c-Myc expression levels decreased, and the expression of glycolysis-related enzymes was also significantly reduced. Figure 7 Figures B and C in the middle section). To evaluate the regulatory effect of circZFAND6 on glycolysis, the amount of lactate production and glucose consumption in the culture supernatant of ovarian cancer cells after 48 hours of culture in different treatment groups were further examined. The results showed that overexpression of circZFAND6 significantly enhanced glycolytic activity, while knockdown of circZFAND6 led to a decrease in glycolysis levels (Figures B and C in the middle section). Figure 7 (DG map).

[0060] In summary, this invention systematically reveals that circZFAND6 is highly expressed in tumor-associated macrophages and can be delivered to ovarian cancer cells via exosome-mediated delivery, effectively promoting the proliferation, migration, and invasion of ovarian cancer cells. Further research found that circZFAND6, by binding to 14-3-3σ, stabilizes c-Myc protein expression, thereby enhancing c-Myc-mediated glycolysis, promoting metabolic reprogramming of tumor cells, and accelerating the malignant progression of ovarian cancer. Therefore, targeted inhibition of circZFAND6 expression can not only significantly block the malignant behavior of ovarian cancer cells but also provide a practical direction for metabolic pathway intervention. This invention provides an important theoretical basis and potential molecular target for metabolic targeted therapy of ovarian cancer.

[0061] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. The application of substances that inhibit circZFAND6 expression or reduce its activity in one or more of the following: (a1) Products that inhibit the proliferation of ovarian cancer cells; (a2) Products that inhibit the migration and invasion of ovarian cancer cells; (a3) Products that inhibit the growth of ovarian cancer; (a4) Products that inhibit the malignant metastasis of ovarian cancer; (a5) Products that inhibit c-Myc-mediated glycolysis in ovarian cancer cells; (a6) Products for treating ovarian cancer.

2. The application as described in claim 1, characterized in that, The substances that inhibit circZFAND6 expression or reduce its activity include RNA interference molecules or antisense oligonucleotides targeting circZFAND6, small molecule inhibitors, siRNA, shRNA, substances that induce lentiviral infection or gene knockout.

3. The application as described in claim 2, characterized in that, The sequence of the siRNA is shown in SEQ ID NO.8-9, SEQ ID NO.10-11 or SEQ ID NO.12-13.

4. The application as described in claim 1, characterized in that, The product is a drug or a laboratory reagent for non-medical purposes.

5. The application as described in claim 1, characterized in that, The source of circZFAND6 is tumor-associated macrophage exosomes.

6. Application of circZFAND6 as a target in screening drugs for the treatment of ovarian cancer.

7. The application as described in claim 6, characterized in that, The method for screening drugs for treating ovarian cancer includes: (b1) Treat the system that overexpresses or contains circZFAND6 with the candidate substance; set up a parallel control that is not treated with the candidate substance; (b2) After completing step (b1), detect the expression level of circZFAND6 in the system; if the expression level of circZFAND6 in the system treated with the candidate substance is significantly reduced compared with the parallel control, the candidate substance can be used as a candidate drug for the treatment of ovarian cancer.

8. The application as described in claim 7, characterized in that, The system can be a cell system, solution system, tissue system, organ system, or animal system.

9. The application as described in claim 8, characterized in that, The cells in the cell system are ovarian cancer cells, the tissues in the tissue system are ovarian cancer tissues, and the organs in the organ system are ovaries or cancerous ovaries.

10. The application as described in claim 8, characterized in that, The animals in the animal system are mammals, including any one or more of mice, rats, guinea pigs, rabbits, monkeys, orangutans, and humans.

Images