Primer composition for detecting avian influenza NA gene as well as detection method and detection device thereof

Abstract

The invention belongs to the technical field of virus detection, and particularly relates to a primer composition for detecting an avian influenza NA gene, a detection method and a detection device. The avian influenza NA genes comprise NA genes of an influenza A virus H5N1, an influenza A virus H5N6, an influenza A virus H7N7, an influenza A virus H7N9 and an influenza A virus H9N2, and the primer composition comprises nucleotide sequences as shown in SEQ ID No.1-25. The primer composition for detecting the NA gene causing the highly pathogenic human and livestock co-infected avian influenza, provided by the invention, can be used for detecting whether a sample contains the NA gene causing the highly pathogenic human and livestock co-infected avian influenza, namely NA genes of influenza A virus subtypes H5N1, H5N6, H7N7, H7N9 and H9N2, and a result can be conveniently, quickly and accurately detected; in a practical application process, a detection result can be obtained within 40 minutes.

Description

Technical Field

[0001] This invention belongs to the field of virus detection technology, specifically relating to a primer composition, detection method, and detection device for detecting avian influenza NA gene. Background Technology

[0002] Influenza virus infections are seasonal, including influenza A and influenza B, and each outbreak can lead to large numbers of hospitalizations and tens of thousands of deaths. According to estimates by the World Health Organization, hundreds of thousands to millions of people die from influenza globally each year, making it the second leading cause of death after AIDS. Avian influenza viruses, which are zoonotic, not only circulate within their natural hosts but also spread across species to humans. Due to their high variability, they are a major source of significant threat to human health. Avian influenza occasionally spreads from waterfowl to poultry and other mammalian species, forming several stable avian influenza lineages in poultry, which may mutate into highly pathogenic (HPAIV) variants. These infections present with a wide range of clinical symptoms, from asymptomatic infection to conjunctivitis or flu-like symptoms, and can even develop into severe acute respiratory illness. Highly pathogenic avian influenza, a zoonotic disease, not only exhibits high pathogenicity but also shows strong potential for human-to-human transmission under certain circumstances. Antiviral treatment is the core measure for influenza treatment, and it is necessary to improve the ability to accurately identify influenza viruses in the early stages. Therefore, rapid and accurate point-of-care testing (POCT) technology is crucial for the diagnosis and detection of pathogens in the sputum, urine, and blood of infected individuals. Common highly pathogenic avian influenza subtypes include H5N1, H5N6, H7N7, H7N9, and H9N2.

[0003] H5N1, H5N6, H7N7, H7N9, and H9N2 subtypes all belong to the genus *Influenza A* within the family Orthomyxoviridae. Their nucleic acid consists of segmented, single-stranded, negative-sense RNA encoding 11 proteins in eight segments, each segment encoding a different protein, including RNA polymerases (PB1, PB2, PA), hemagglutinin (HA), nucleoprotein (NP), neuraminidase (NA), matrix protein (MP), and non-structural proteins (NS1 and NEP / NS2). The mortality rate of H5N1 virus infection is as high as 52.8%. In humans, infection can lead to severe respiratory illness with a high case fatality rate. Patients may experience severe complications such as acute pneumonia, which may include high fever, cough, shortness of breath, respiratory distress due to lung infection, pneumonia, and general fatigue and weakness. Severe cases may develop multiple organ dysfunction, leading to death. The mortality rate of H5N6 influenza is as high as 65.2%. Common symptoms after human infection with H5N6 influenza include fever, cough, sputum production, and sore throat. The probability of severe illness and mortality is high. In the H7N7 virus subtype, a mutation occurs where lysine at position 627 of the PB2 protein replaces glutamic acid (E627K mutation). At temperatures similar to those in the human upper respiratory tract, this mutation increases the activity and replication capacity of viral polymerase in mammalian cell lines, significantly enhancing the transmissibility and pathogenicity of avian influenza in mammals, potentially causing large-scale, highly pathogenic influenza epidemics in humans. The mortality rate of H7N9 influenza is as high as 39.2%. Some H7N9 strains have acquired the ability to bind to receptors in the human upper respiratory tract, making the virus easier to spread among human populations and more likely to trigger a severe human influenza pandemic. After infection with the H7N9 influenza virus, patients experience severe flu-like symptoms such as fever and cough, possibly accompanied by muscle aches and headaches. Severe cases often develop rapidly, with severe pneumonia appearing within 3-7 days, accompanied by high fever and difficulty breathing. They typically progress quickly to acute respiratory distress syndrome (ARDS), sepsis, and even multiple organ dysfunction, posing a serious health threat to the human population. H9N2 is a gene donor for highly pathogenic avian influenza viruses such as H5N1 and H7N9. Although the H9N2 subtype usually causes mild respiratory symptoms such as cough and sneezing, its widespread distribution makes the potential harm to the host difficult to control and prolonged. This subtype of avian influenza has overcome the species barrier and can directly infect humans, and the relatively short recovery period makes it easy to overlook. This provides opportunities for the virus to further adapt within the human body and potentially recombine with human influenza viruses, which could lead to its large-scale spread in the human population.

[0004] In clinical practice, the conventional methods for diagnosing highly pathogenic avian influenza pathogens include isolation and culture, smear microscopy, serological detection, PCR, RT-PCR, or next-generation sequencing. These methods are time-consuming, have poor inhibitory resistance, are costly, and their detection sensitivity needs improvement. Therefore, there is an urgent need to provide a rapid, efficient, low-cost, highly sensitive, and highly inhibitory diagnostic technology for highly pathogenic avian influenza pathogens. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a primer composition, detection method, and detection device for detecting avian influenza NA genes. This method can be used to detect whether a sample contains the NA genes of highly pathogenic zoonotic avian influenza: NA genes of influenza A virus subtypes H5N1, H5N6, H7N7, H7N9, and H9N2. It provides convenient, rapid, and accurate results. In practical applications, this invention can obtain detection results within 40 minutes.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a primer composition for detecting avian influenza NA genes, including but not limited to the NA genes of influenza A virus H5N1, influenza A virus H5N6, influenza A virus H7N7, influenza A virus H7N9, and influenza A virus H9N2, as well as the NA genes of other avian influenza strains possessing these NA genes. The primer composition includes, but is not limited to, the nucleotide sequences shown in SEQ ID No. 1-25, and also includes DNA molecules that have the same function as the described nucleotide sequences after substitution and / or deletion and / or addition of one or more nucleotides of the nucleotide sequences shown in SEQ ID No. 1-25.

[0008] Furthermore, the nucleotide sequence of the primer composition used to detect the influenza A virus H5N1 is shown in SEQ ID No. 1-6.

[0009] Furthermore, the nucleotide sequences of the primer composition used to detect the influenza A virus H5N6 are shown in SEQ ID No. 7-10.

[0010] Furthermore, the nucleotide sequences of the primer composition used to detect the influenza A virus H7N7 are shown in SEQ ID No. 11-14.

[0011] Furthermore, the nucleotide sequences of the primer composition used to detect the influenza A virus H7N9 are shown in SEQ ID No. 15-20.

[0012] Furthermore, the nucleotide sequences of the primer composition used to detect the influenza A virus H9N2 are shown in SEQ ID No. 21-25.

[0013] Furthermore, the primer composition also includes a DNA molecule having the same function as the described nucleotide sequence after substitution and / or deletion and / or addition of one or more nucleotides of the nucleotide sequence shown in SEQ ID No. 1-25.

[0014] This invention also provides a method for detecting avian influenza NA genotyping, the method comprising the step of detection using the primer composition described above via loop-mediated isothermal amplification; the loop-mediated isothermal amplification reaction conditions are 60-65℃ for 40 min; the molar ratio of the primer compositions SEQ ID No. 1-6 for detecting the H5N1 gene of influenza A virus is 1:1:4-16:4-16:2-8:2-8; the molar ratio of the primer compositions SEQ ID No. 7-10 for detecting the H5N6 gene of influenza A virus is 1:1:4-16:4-16; the molar ratio of the primer compositions SEQ ID No. 11-14 for detecting the H7N9 gene of influenza A virus is 1:1:4-16:4-16; and the molar ratio of the primer compositions SEQ ID No. 11-14 for detecting the H7N7 gene of influenza A virus is 1:1:4-16:4-16. The molar concentration ratio of No. 15-20 is 1:1:4-16:4-16:2-8:2-8; the molar concentration ratio of the primer composition SEQ ID No. 21-25 for detecting the H9N2 gene of influenza A virus is 1:1:4-16:4-16:2-8.

[0015] A detection device for detecting avian influenza NA genotyping, the detection device comprising the primer composition according to any one of claims 1-7, the detection device including but not limited to kits, gene chips, microfluidic devices, automated detectors and other devices suitable for avian influenza gene extraction.

[0016] Furthermore, the detection steps of the detection device include:

[0017] (1) Extract genomic nucleic acid from the sample to be tested;

[0018] (2) Given that the virus to be tested is an RNA virus, the genomic nucleic acid extracted in step (1) is first reverse transcribed to obtain a cDNA template; then the primer composition is used to perform loop-mediated isothermal amplification of the NA gene of influenza A virus H5N1, influenza A virus H5N6, influenza A virus H7N7, influenza A virus H7N9 and influenza A virus H9N2.

[0019] The primer composition described in this invention can be used to detect whether a sample contains the NA gene of highly pathogenic zoonotic avian influenza: the NA gene of influenza A virus subtypes H5N1, H5N6, H7N7, H7N9 and H9N2.

[0020] If the above primer combination can specifically amplify the cDNA template in the sample, then the sample to be tested contains or is suspected of containing the NA gene of the H5N1, H5N6, H7N7, H7N9 and H9N2 subtypes of influenza A virus. If it cannot specifically amplify the cDNA template in the sample, then the sample to be tested does not contain the NA gene of the H5N1, H5N6, H7N7, H7N9 and H9N2 subtypes of influenza A virus.

[0021] The present invention discloses the following technical effects:

[0022] The primer composition provided by this invention for detecting the NA gene of highly pathogenic avian influenza (H5N1, H5N6, H7N7, H7N9, and H9N2 subtypes) can be used to detect whether a sample contains the NA gene of highly pathogenic avian influenza (H5N1, H5N6, H7N7, H7N9, and H9N2 subtypes), providing convenient, rapid, and accurate results. In practical applications, detection results can be obtained within 40 minutes.

[0023] The loop-mediated isothermal amplification (LAMP) technique used in this invention has the characteristics of being fast, efficient, low-cost, highly sensitive, and highly resistant to inhibition. It is a core component for the prevention, diagnosis, treatment, and medication guidance of critically ill patients with highly pathogenic influenza and a key technology for the diagnosis of highly pathogenic zoonotic avian influenza. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 The fluorescence curves for amplifying the NA gene of influenza A virus H5N1 subtype, influenza A virus H5N6 subtype, influenza A virus H7N7 subtype, influenza A virus H7N9 subtype, influenza A virus H9N2 subtype, human genome, and blank control using primer sets for influenza A virus H5N1 subtype in Example 1 of the present invention are shown.

[0026] Figure 2The fluorescence curves for amplifying the NA gene of influenza A virus H5N6 subtype, influenza A virus H5N1 subtype, influenza A virus H5N6 subtype, influenza A virus H7N7 subtype, influenza A virus H7N9 subtype, influenza A virus H9N2 subtype, human genome, and blank control using primer sets for influenza A virus H5N6 subtype in Example 2 of the present invention are shown.

[0027] Figure 3 The fluorescence curves for amplifying the NA gene of influenza A virus H5N1, H5N6, H7N7, H7N9, and H9N2 subtypes, along with the human genome and a blank control, using primer sets for the H7N7 subtype of influenza A virus in Example 3 of this invention are shown.

[0028] Figure 4 The fluorescence curves for amplifying the NA gene of influenza A virus H5N1, H5N6, H7N7, H7N9, and H9N2 subtypes, along with the human genome and a blank control, using primer sets for the H7N9 subtype of influenza A virus in Example 4 of this invention.

[0029] Figure 5 The fluorescence curves for amplifying the NA gene of influenza A virus H5N1, H5N6, H7N7, H7N9, and H9N2 subtypes, as well as the human genome and blank control, using primer sets for influenza A virus H9N2 subtype in Example 5 of this invention are shown.

[0030] Figure 6 Primers were used to amplify the NA gene of the H5N1 subtype of influenza A virus in Example 1 of this invention. 4 copies / μL of the NA gene of influenza A virus H5N1 subtype, 10 3 copies / μL of the NA gene of influenza A virus H5N1 subtype, 10 2 Fluorescence curves of the NA gene, human genome, and blank control of influenza A virus H5N1 subtype copies / μL.

[0031] Figure 7 Primers were used to amplify the NA gene of the H5N6 subtype of influenza A virus in Example 2 of this invention. 4 copies / μL of the NA gene of influenza A virus H5N6 subtype, 10 3copies / μL of the NA gene of influenza A virus H5N6 subtype, 10 2 Fluorescence curves of the NA gene, human genome, and blank control of influenza A virus H5N6 subtype copies / μL.

[0032] Figure 8 Primers were used to amplify the NA gene of the H7N7 subtype of influenza A virus in Example 3 of this invention. 4 copies / μL of the NA gene of the H7N7 subtype of influenza A virus, 10 3 copies / μL of the NA gene of the H7N7 subtype of influenza A virus, 10 2 Fluorescence curves of the NA gene, human genome, and blank control of influenza A virus H7N7 subtype copies / μL.

[0033] Figure 9 Primers were used to amplify the NA gene of the H7N9 subtype of influenza A virus in Example 4 of this invention. 4 copies / μL of the NA gene of the H7N9 subtype of influenza A virus, 10 3 copies / μL of the NA gene of the H7N9 subtype of influenza A virus, 10 2 Fluorescence curves of the NA gene, human genome, and blank control of influenza A virus H7N9 subtype copies / μL.

[0034] Figure 10 Primers were used to amplify the NA gene of the H9N2 subtype of influenza A virus in Example 5 of this invention. 4 copies / μL of the NA gene of influenza A virus H9N2 subtype, 10 3 copies / μL of the NA gene of influenza A virus H9N2 subtype, 10 2 Fluorescence curves of the NA gene, human genome, and blank control of influenza A virus H9N2 subtype copies / μL. Detailed Implementation

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0037] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0038] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0039] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0040] Unless otherwise specified, the test methods used in the following implementations are all commonly used test methods in this field;

[0041] Unless otherwise specified, the test materials used in the following implementations are all commonly used test materials in this field.

[0042] The primer composition for detecting the NA gene of highly pathogenic zoonotic avian influenza A virus subtypes H5N1, H5N6, H7N7, H7N9 and H9N2 in this invention comprises the nucleotide sequence shown in SEQ ID No. 1-20, and further comprises a DNA molecule having the same function as the described nucleotide sequence after substitution and / or deletion and / or addition of one or more nucleotides of the nucleotide sequence shown in SEQ ID No. 1-25.

[0043] The detection method using the above primer composition is as follows:

[0044] (1) Extract genomic nucleic acid from the sample to be tested;

[0045] (2) Given that the virus to be tested is an RNA virus, the extracted genomic RNA is first reverse transcribed to obtain a cDNA template; then the primer composition described in any one of claims 1-6 is used to perform loop-mediated isothermal amplification of the NA gene of influenza A virus H5N1, influenza A virus H5N6, influenza A virus H7N7, influenza A virus H7N9 and influenza A virus H9N2.

[0046] Example 1

[0047] Example 1 utilizes a synthetically produced plasmid containing the NA gene of the H5N1 subtype of influenza A virus. The detection kit used in this example is prepared using the reaction system described in this application and is used to detect the NA gene of the H5N1 subtype of influenza A virus. The plasmid containing the NA gene of the H5N1 subtype of influenza A virus used in this example was synthesized by Beijing Qingke Biotechnology Co., Ltd. The synthesized plasmid was used as a template, and the reaction system is shown in Table 1.

[0048] Table 1. NA gene fluorescence quantitative PCR reaction system for influenza A virus H5N1 subtype (25 μL tube).

[0049]

[0050]

[0051] The nucleotide sequences of the primers for the NA gene of influenza A virus H5N1 subtype are as follows:

[0052] F3(SEQ ID No.1):TTTTCGGAGACAACCCAC

[0053] B3(SEQ ID No.2):CACCCATTTGGATCCCAA

[0054] FIP(SEQ ID No.3): CCTTTCACCCCATATGCCCCGCCCCAATGATGGAACAG

[0055] BIP(SEQ ID No.4):AATACGGCAATGGGTGTTTGGATCATTTCAAAGCCGCTCC

[0056] LF(SEQ ID No.5):GACATCGGACCACAACTGC

[0057] LB(SEQ ID No.6):TCGGGAGGACCAAAAGCA;

[0058] The reaction system was prepared according to Table 1. After preparation, the system was vortexed and briefly centrifuged. Using a micropipette, the system was added to an eight-tube set for real-time fluorescence detection. The system was vortexed again and briefly centrifuged to collect the system at the bottom of the tube. The eight-tube set was then placed in a quantitative PCR instrument and the following reaction procedure was followed: LAMP cycling was performed at 65°C for 1 minute, for a total of 60 cycles. Fluorescence excitation light in the 480-500 nm wavelength range was detected. Based on the fluorescence signal change curve, the number of cycles (Ct value) required to reach the threshold fluorescence intensity was determined.

[0059] The results are as follows Figure 1 As shown, the plasmid fluorescence curve of the NA gene of influenza A virus H5N1 subtype is a specific S-shaped curve; the NA genes of influenza A virus H5N6 subtype, influenza A virus H7N7 subtype, influenza A virus H7N9 subtype, influenza A virus H9N2 subtype, human genomic cDNA, and blank control curves are used as baselines. It can be seen that the primer combination used in this embodiment can specifically detect the NA gene of influenza A virus H5N1 subtype. Figure 6 It can be seen that 10 4 10 copies / μL of NA gene plasmid of influenza A virus H5N1 subtype 3 10 copies / μL of NA gene plasmid of influenza A virus H5N1 subtype 2 copies / μL of the NA gene of the H5N1 subtype of influenza A virus.

[0060] All plasmids exhibited specific S-shaped fluorescence curves within 40 minutes. This indicates that the above primer combinations can be used within 10 minutes. 2 With a template concentration of copies / μL, the NA gene of the H5N1 subtype of influenza A virus can be detected within 40 minutes, exhibiting high sensitivity.

[0061] Example 2

[0062] Example 2 utilizes a synthetically produced plasmid containing the NA gene of the H5N6 subtype of influenza A virus. The detection kit used in this example is prepared using the reaction system described in this application and is used to detect the NA gene of the H5N6 subtype of influenza A virus. The plasmid containing the NA gene of the H5N6 subtype of influenza A virus used in this example was synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0063] The synthesized plasmid was used as a template, and the reaction system is shown in Table 2:

[0064] Table 2. NA gene fluorescence quantitative PCR reaction system for influenza A virus H5N6 subtype (25 μL tube).

[0065]

[0066] The nucleotide sequences of the primers for the NA gene of influenza A virus H5N6 subtype are as follows:

[0067] F3(SEQ ID No.7):AAGATAACATGCATTTCAGCA

[0068] B3(SEQ ID No.8):GGCTTGGTCAAGTTGAGAA

[0069] FIP (SEQ ID No. 9):

[0070] GTCCAATATTTAGGCCCAAATTGGCACAGGAGTAACACTATCGGT

[0071] BIP (SEQ ID No. 10):

[0072] CCAAACATGAATGAGACCAATCCATTCTTTCTTTCGTTCTTATTCACT.

[0073] The reaction system was prepared according to Table 2. After preparation, the system was vortexed and briefly centrifuged. Using a micropipette, the system was added to an eight-tube set for real-time fluorescence detection. The system was vortexed again and briefly centrifuged to collect the system at the bottom of the tube. The eight-tube set was then placed in a quantitative PCR instrument and the following reaction procedure was followed: LAMP cycling was performed at 65°C for 1 minute, for a total of 60 cycles. Fluorescence excitation light in the wavelength range of 480-500 nm was detected, and the Ct value required to reach the threshold fluorescence intensity was determined based on the fluorescence signal change curve.

[0074] The results are as follows Figure 2 As shown, the plasmid fluorescence curve of the NA gene of influenza A virus H5N6 subtype is a specific S-shaped curve; the NA genes of influenza A virus H5N1 subtype, influenza A virus H7N7 subtype, influenza A virus H7N9 subtype, influenza A virus H9N2 subtype, human genomic cDNA, and blank control curves are used as baselines. It can be seen that the primer combination used in this embodiment can specifically detect the NA gene of influenza A virus H5N6 subtype. Figure 7 It can be seen that 10 4 10 copies / μL of NA gene plasmid of influenza A virus H5N6 subtype 3 10 copies / μL of NA gene plasmid of influenza A virus H5N6 subtype 2copies / μL of the NA gene of the H5N6 subtype of influenza A virus

[0075] All plasmids exhibited specific S-shaped fluorescence curves within 40 minutes. This indicates that the above primer combinations can be used within 10 minutes. 2 With a template concentration of copies / μL, the NA gene of the H5N6 subtype of influenza A virus can be detected within 40 minutes, exhibiting high sensitivity.

[0076] Example 3

[0077] Example 3 utilizes a synthetically produced plasmid containing the NA gene of the H7N7 subtype of influenza A virus. The detection kit used in this example is prepared using the reaction system described in this application and is used to detect the NA gene of the H7N7 subtype of influenza A virus. The plasmid containing the NA gene of the H7N7 subtype of influenza A virus used in this example was synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0078] The synthesized plasmid was used as a template, and the reaction system is shown in Table 3:

[0079] Table 3. NA gene PCR reaction system for influenza A virus H7N7 subtype (25 μL each).

[0080]

[0081] The nucleotide sequences of the primers for the NA gene of the H7N7 subtype of influenza A virus are as follows:

[0082] F3(SEQ ID No.11):ATGGGGATAACACATGGC

[0083] B3 (SEQ ID No.12): TGGATTGTAGCATTCACTGT

[0084] FIP (SEQ ID No. 13):

[0085] TTGGGGTCAGTACCTGCATTAGAGCCCCAGATCAAGAAGT

[0086] BIP (SEQ ID No. 14):

[0087] CTAGAATAGCAGAACGACAGGAAATCATCATTCCAATAGTCAATAAAGC.

[0088] The reaction system was prepared according to Table 3. After preparation, the system was vortexed and briefly centrifuged. Using a micropipette, the system was added to an eight-tube set for real-time fluorescence detection. The system was vortexed again and briefly centrifuged to collect the system at the bottom of the tube. The eight-tube set was then placed in a quantitative PCR instrument and the following reaction procedure was followed: LAMP cycling was performed at 65°C for 1 minute, for a total of 60 cycles. Fluorescence excitation light in the 480-500 nm wavelength range was detected, and the Ct value required to reach the threshold fluorescence intensity was determined based on the fluorescence signal change curve.

[0089] The results are as follows Figure 3 As shown, the plasmid fluorescence curve of the NA gene of the influenza A virus H7N7 subtype is a specific S-shaped curve; the NA genes of the influenza A virus H5N1 subtype, influenza A virus H5N6 subtype, influenza A virus H7N9 subtype, influenza A virus H9N2 subtype, human genomic cDNA, and blank control curves are used as baselines. It can be seen that the primer combination used in this embodiment can specifically detect the NA gene of the influenza A virus H7N7 subtype. Figure 8 It can be seen that 10 4 10 copies / μL of NA gene plasmid of influenza A virus H7N7 subtype 3 10 copies / μL of NA gene plasmid of influenza A virus H7N7 subtype 2 copies / μL of the NA gene of the H7N7 subtype of influenza A virus.

[0090] All plasmids exhibited specific S-shaped fluorescence curves within 40 minutes. This indicates that the above primer combinations can be used within 10 minutes. 2 With a template concentration of copies / μL, the NA gene of the H7N7 subtype of influenza A virus can be detected within 40 minutes, exhibiting high sensitivity.

[0091] Example 4

[0092] Example 4 utilizes a synthetically produced plasmid containing the NA gene of the H7N9 subtype of influenza A virus. The detection kit used in this example is prepared using the reaction system described in this application and is used to detect the NA gene of the H7N9 subtype of influenza A virus. The plasmid containing the NA gene of the H7N9 subtype of influenza A virus used in this example was synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0093] The synthesized plasmid was used as a template, and the reaction system is shown in Table 4:

[0094] Table 4. 25 μL reaction system for quantitative PCR reaction of the NA gene of influenza A virus H7N9 subtype.

[0095]

[0096]

[0097] The nucleotide sequences of the primers for the NA gene of the H7N9 subtype of influenza A virus are as follows:

[0098] F3(SEQ ID No.15):ACTGGAACTGCTAAGCATAT

[0099] B3(SEQ ID No.16):ATGTTTGGGTCATTCGGT

[0100] FIP(SEQ ID No.17):TTGAGCCCTGCCAATTGTCCAGAATGTTCATGTTACGGGA

[0101] BIP (SEQ ID No. 18):

[0102] AGACCAGTGATTCAGATAGACCCACGGGGACTGTCTGTAAGG

[0103] LF(SEQ ID No.19):TGCAGGTAATCCCTGTTCGTT

[0104] LB (SEQ ID No. 20): GTAGCAATGACACACACTAGTCA.

[0105] The reaction system was prepared according to Table 4. After preparation, the system was vortexed and briefly centrifuged. Using a micropipette, the system was added to an eight-tube set for real-time fluorescence detection. The system was vortexed again and briefly centrifuged to collect the system at the bottom of the tube. The eight-tube set was then placed in a quantitative PCR instrument and the following reaction procedure was followed: LAMP cycling was performed at 65°C for 1 minute, for a total of 60 cycles. Fluorescence excitation light in the 480-500 nm wavelength range was detected, and the Ct value required to reach the threshold fluorescence intensity was determined based on the fluorescence signal change curve.

[0106] The results are as follows Figure 4 As shown, the plasmid fluorescence curve of the NA gene of the influenza A virus H7N9 subtype is a specific S-shaped curve; the NA genes of the influenza A virus H5N1 subtype, influenza A virus H5N6 subtype, influenza A virus H7N7 subtype, influenza A virus H9N2 subtype, human genomic cDNA, and blank control curves are used as baselines. It can be seen that the primer combination used in this embodiment can specifically detect the NA gene of the influenza A virus H7N9 subtype. Figure 9 It can be seen that 104 10 copies / μL of NA gene plasmid of influenza A virus H7N9 subtype 3 10 copies / μL of NA gene plasmid of influenza A virus H7N9 subtype 2 copies / μL of the NA gene of the H7N9 subtype of influenza A virus

[0107] All plasmids exhibited specific S-shaped fluorescence curves within 40 minutes. This indicates that the above primer combinations can be used within 10 minutes. 2 With a template concentration of copies / μL, the NA gene of the H7N9 subtype of influenza A virus can be detected within 40 minutes, exhibiting high sensitivity.

[0108] Example 5

[0109] Example 5 utilizes a synthetically produced plasmid containing the NA gene of the H9N2 subtype of influenza A virus. The detection kit used in this example is prepared using the reaction system described in this application and is used to detect the NA gene of the H9N2 subtype of influenza A virus. The plasmid containing the NA gene of the H9N2 subtype of influenza A virus used in this example was synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0110] The synthesized plasmid was used as a template, and the reaction system is shown in Table 5:

[0111] Table 5. NA gene PCR reaction system for influenza A virus H9N2 subtype (25 μL each).

[0112]

[0113] The nucleotide sequences of the primers for the NA gene of influenza A virus H9N2 subtype are as follows:

[0114] F3(SEQ ID No.21):CATTTATAATGGCATGCTTACC

[0115] B3 (SEQ ID No. 22): CTTCCTGCTAGTTGGCTAA

[0116] FIP (SEQ ID No. 23):

[0117] CAAGTTCATTGATGCAAACACATTTATCGGTTCATGGTCTAACAAC

[0118] BIP (SEQ ID No. 24):

[0119] TCCGGTAGTAATGACTGATGGAATGTGAACAATTTTCCCTTCTC

[0120] LB (SEQ ID No. 25): GTCGGGAAGGGCTGACA.

[0121] The reaction system was prepared according to Table 5. After preparation, the system was vortexed and briefly centrifuged. Using a micropipette, the system was added to an eight-tube set for real-time fluorescence detection. The system was vortexed again and briefly centrifuged to collect the system at the bottom of the tube. The eight-tube set was then placed in a quantitative PCR instrument and the following reaction procedure was followed: LAMP cycling was performed at 65°C for 1 minute, for a total of 60 cycles. Fluorescence excitation light in the 480-500 nm wavelength range was detected, and the Ct value required to reach the threshold fluorescence intensity was determined based on the fluorescence signal change curve.

[0122] The results are as follows Figure 5 As shown, the plasmid fluorescence curve of the NA gene of the influenza A virus H9N2 subtype is a specific S-shaped curve; the NA genes of the influenza A virus H5N1 subtype, influenza A virus H5N6 subtype, influenza A virus H7N7 subtype, influenza A virus H7N9 subtype, human genomic cDNA, and blank control curves are used as baselines. It can be seen that the primer combination used in this embodiment can specifically detect the NA gene of the influenza A virus H9N2 subtype. Figure 10 It can be seen that 10 4 10 copies / μL of NA gene plasmid of influenza A virus H9N2 subtype 3 10 copies / μL of NA gene plasmid of influenza A virus H9N2 subtype 2 copies / μL of the NA gene of the H9N2 subtype of influenza A virus

[0123] All plasmids exhibited specific S-shaped fluorescence curves within 40 minutes. This indicates that the above primer combinations can be used within 10 minutes. 2 With a template concentration of copies / μL, the NA gene of the H9N2 subtype of influenza A virus was detected within 40 minutes, demonstrating high sensitivity.

[0124] In summary, the primer compositions prepared in Examples 1-5 were used to diagnose the NA genotyping of highly pathogenic zoonotic avian influenza using the loop-mediated isothermal amplification (LAMP) method. Specifically, in Example 1, the molar ratio of primers F3, B3, FIP, BIP, LF, and LB was 1:1:4-16:4-16:2-8:2-8; in Example 2, the molar ratio of primers F3, B3, FIP, and BIP was 1:1:4-16:4-16; and in Example 3, the primer composition… The molar ratio of primers F3, B3, FIP, and BIP was 1:1:4-16:4-16; in Example 4, the molar ratio of primers F3, B3, FIP, BIP, LF, and LB was 1:1:4-16:4-16:2-8:2-8; in Example 5, the molar ratio of primers F3, B3, FIP, BIP, and LB was 1:1:4-16:4-16:2-8; the loop-mediated isothermal amplification conditions were a constant temperature reaction at 60-65℃ for 40 min. From the above results, it is clear that the primer combinations of the present invention can specifically detect gene fragments of corresponding pathogens within 10... 2 The detection of copies is effective and specific for the detection of human genomes and other pathogens. Results can be read within 40 minutes and the experiment is reproducible.

[0125] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A primer composition for detecting the NA gene of avian influenza, characterized in that, The avian influenza NA gene includes, but is not limited to, the NA genes of influenza A virus H5N1, influenza A virus H5N6, influenza A virus H7N7, influenza A virus H7N9, and influenza A virus H9N2. The primer composition includes the nucleotide sequence shown in SEQ ID No. 1-25, and also includes a DNA molecule having the same function as the described nucleotide sequence after substitution and / or deletion and / or addition of one or more nucleotides of the nucleotide sequence shown in SEQ ID No. 1-25.

2. The primer composition for detecting the NA gene of avian influenza according to claim 1, characterized in that, The nucleotide sequence of the primer composition used to detect the influenza A virus H5N1 is shown in SEQ ID No. 1-6.

3. The primer composition for detecting the NA gene of avian influenza according to claim 1, characterized in that, The nucleotide sequences of the primer composition used to detect the influenza A virus H5N6 are shown in SEQ ID No. 7-10.

4. The primer composition for detecting the NA gene of avian influenza according to claim 1, characterized in that, The nucleotide sequences of the primer compositions used to detect the influenza A virus H7N7 are shown in SEQ ID No. 11-14.

5. The primer composition for detecting the NA gene of avian influenza according to claim 1, characterized in that, The nucleotide sequences of the primer composition used to detect the influenza A virus H7N9 are shown in SEQ ID No. 15-20.

6. The primer composition for detecting the NA gene of avian influenza according to claim 1, characterized in that, The nucleotide sequences of the primer composition used to detect the influenza A virus H9N2 are shown in SEQ ID No. 21-25.

7. The primer composition for detecting the NA gene of avian influenza according to claim 1, characterized in that, The primer composition further includes a DNA molecule having the same function as the described nucleotide sequence after substitution and / or deletion and / or addition of one or more nucleotides of the nucleotide sequence shown in SEQ ID No. 1-25.

8. A detection method for detecting avian influenza NA genotyping, characterized in that, The detection method includes the step of detecting the virus using the primer composition according to any one of claims 1-7 via loop-mediated isothermal amplification; the loop-mediated isothermal amplification reaction conditions are 60-65℃ for 40 min; the molar ratio of the primer compositions SEQ ID No. 1-6 for detecting the influenza A virus H5N1 gene is 1:1:4-16:4-16:2-8:2-8; the molar ratio of the primer compositions SEQ ID No. 7-10 for detecting the influenza A virus H5N6 gene is 1:1:4-16:4-16; the molar ratio of the primer compositions SEQ ID No. 11-14 for detecting the influenza A virus H7N9 gene is 1:1:4-16:4-16; the molar ratio of the primer compositions SEQ ID No. 11-14 for detecting the influenza A virus H7N7 gene is 1:1:4-16:4-16; the molar ratio of the primer compositions SEQ ID No. 11-14 for detecting the influenza A virus H7N7 gene is 1:1:4-16:4-16. The molar concentration ratio of No. 15-20 is 1:1:4-16:4-16:2-8:2-8; the molar concentration ratio of the primer composition SEQ ID No. 21-25 for detecting the H9N2 gene of influenza A virus is 1:1:4-16:4-16:2-8.

9. A detection device for detecting avian influenza NA genotyping, the detection device comprising the primer composition according to any one of claims 1-7, the detection device including but not limited to kits, gene chips, microfluidic devices, automated detectors, and other devices suitable for avian influenza gene extraction.

10. The detection device according to claim 9, characterized in that, The detection steps of the detection device include: (1) Extract genomic nucleic acid from the sample to be tested; (2) Given that the virus to be tested is an RNA virus, the genomic nucleic acid extracted in step (1) is first reverse transcribed to obtain a cDNA template, and then the NA gene of influenza A virus H5N1, influenza A virus H5N6, influenza A virus H7N7, influenza A virus H7N9 and influenza A virus H9N2 is amplified by loop-mediated isothermal amplification using the primer composition described in any one of claims 1-6.

Images