Application of microglial cell TAK1 gene as target spot in treatment of retinal neovascular diseases

Abstract

The invention relates to application of a microglial cell TAK1 gene as a target spot in treatment of retinal neovascular diseases. The invention finds that by specifically knocking out the microglial cell TAK1 gene, the number of neovascular clusters under pathological conditions can be effectively reduced, migration and proliferation of retinal tissue neovascular endothelial cells are inhibited, pathological retinal neovascularization is effectively inhibited, but the physiological angiogenesis capability of human retinal microvascular endothelial cells is not influenced. Therefore, retina neovascular diseases including diabetic retinopathy, premature infant retinopathy, retinal vein occlusion, familial exudative vitreoretinopathy and the like can be effectively treated by specifically knocking out the microglial cell TAK1 gene. The invention provides a new target and a new idea for the treatment of retinal neovascular diseases.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and relates to a gene therapy drug, in particular to application of microglial cell TAK1 gene as a target point in treatment of retinal neovascular disease. BACKGROUND

[0002] At present, a variety of retinal diseases are one of the main reasons for global visual function loss, causing a huge medical burden. Retinal neovascular disease is a kind of disease covering people of all ages in the clinic at present, which is the most common cause of irreversible blindness, including diabetic retinopathy (Diabetic Retinopathy, DR), retinopathy of prematurity (Retinopathy Of Prematurity ROP), retinal vein occlusion (Retinal Vein Occlusion, RVO) and familial exudative vitreoretinopathy (Familial Exudative Vitreoretinopathy, FEVR) and the like. The most typical pathological feature of retinal neovascular disease is pathological neovascularization caused by unbalanced changes between retinal neovascularization (Retinal neovascularization, RNV) generation and anti-angiogenic factors. The generation of retinal pathological neovascularization is caused by a variety of mechanisms, including inflammatory response, oxidative stress, mitochondrial abnormalities, epigenetics and intestinal flora imbalance.

[0003] At present, the treatment methods for retinal pathological neovascularization in the clinic include anti-vascular endothelial growth factor (Vascular Endothelial Growth Factor, VEGF) drug intravitreal injection treatment, laser photocoagulation treatment and vitrectomy surgery and the like. These treatment methods have certain disadvantages: drug treatment mainly depends on targeting VEGF, the effect duration is short, and repeated administration is required; laser treatment has a certain damaging effect on the retina; vitreoretinal surgery is a salvage treatment.

[0004] Therefore, the potential therapeutic target of intervening multiple pathogenesis pathways shows great advantages and potential for the treatment of neovascular retinal diseases. However, the existing gene therapy related research mainly targets endothelial cells, lacks macroscopic regulation of the retinal inflammatory microenvironment, and may affect the generation and development of normal blood vessels in the application process. SUMMARY

[0005] Based on this, the application aims to provide the application of microglial cell TAK1 gene as a target in treating retinal neovascular disease, and pathological retinal neovascularization can be specifically inhibited by knocking out microglial cell TAK1 gene, and retinal neovascular disease can be effectively treated.

[0006] The technical solution for achieving the above-mentioned purpose comprises the following.

[0007] The first aspect of the application is to provide the application of a reagent for knocking out microglial cell TAK1 gene in the preparation of a drug for treating retinal neovascular disease.

[0008] In some embodiments, the reagent is a recombinant lentivirus vector containing sgRNA for knocking out microglial cell TAK1 gene and a microglial cell-specific promoter.

[0009] In some embodiments, the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 1.

[0010] In some embodiments, the microglial cell-specific promoter is TMEM119.

[0011] In some embodiments, the retinal neovascular disease includes diabetic retinopathy, retinopathy of prematurity, retinal vein occlusion, and familial exudative vitreoretinopathy.

[0012] The second aspect of the application is to provide a drug for treating retinal neovascular disease, wherein the active ingredient of the drug comprises a reagent for knocking out microglial cell TAK1 gene; the reagent is a recombinant lentivirus vector containing sgRNA for knocking out microglial cell TAK1 gene and a microglial cell-specific promoter.

[0013] In some embodiments, the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 1.

[0014] In some embodiments, the microglial cell-specific promoter is TMEM119.

[0015] In some embodiments, the dosage form of the drug is an eye injection, preferably an intravitreal injection.

[0016] The third aspect of the application is to provide a method for inhibiting pathological retinal neovascularization for non-treatment purposes, comprising the following steps: introducing a reagent for knocking out microglial cell TAK1 gene into a test sample, so that the microglial cell TAK1 gene in the test sample is knocked out.

[0017] In some embodiments, the agent is a recombinant lentivirus vector containing sgRNA for knocking out TAK1 gene of microglia cells and a microglia cell-specific promoter.

[0018] In some embodiments, the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 1.

[0019] In some embodiments, the microglia cell-specific promoter is TMEM119.

[0020] The present application finds that by specifically knocking out TAK1 gene of microglia cells, the number of pathological new blood vessel clusters can be effectively reduced, the migration and proliferation of retinal tissue new blood vessel endothelial cells can be inhibited, and pathological retinal neovascularization can be effectively inhibited without affecting the physiological angiogenesis ability of human retinal microvascular endothelial cells. Therefore, by specifically knocking out TAK1 gene of microglia cells, retinal neovascular diseases, including diabetic retinopathy, retinopathy of prematurity, retinal vein occlusion, and familial exudative vitreoretinopathy, etc. can be effectively treated. The present application provides a new target and idea for the treatment of retinal neovascular diseases.

[0021] The present application also obtains sgRNA capable of effectively knocking out TAK1 gene of microglia cells by CRISPR-Cas9 technology through research and screening, which can efficiently and specifically knock out TAK1 gene in microglia cells, making it completely negative expression. The sgRNA and microglia cell-specific promoter are inserted into a lentivirus vector skeleton to obtain a recombinant lentivirus vector, and by directly injecting the recombinant lentivirus vector into the vitreous body, the TAK1 gene in the microglia cells can be knocked out, making it completely negative expression, so that pathological retinal neovascularization can be effectively inhibited without affecting the generation and development of normal blood vessels, thereby treating retinal neovascular diseases. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 LentiCRISPRv2 vector map inserted with TAK1 sgRNA.

[0023] Figure 2 Killing effect of different concentration gradients of puromycin on HMC3.

[0024] Figure 3 Transfection effect of different MOI values of GFP control lentivirus on HMC3.

[0025] Figure 4 Single cell culture well obtained by positive cell plating.

[0026] Figure 5Representative sequencing results of TAK1 DNA sequence base insertion and deletion across sgRNA target region.

[0027] Figure 6 Western Blot detection results of TAK1 protein expression of sgRNA1- sgRNA3 group monoclonal cell strains.

[0028] Figure 7 Fluorescence quantification results of TAK1 protein expression of wild type HMC3 cells and TAK1 KO HMC3 cells.

[0029] Figure 8 TAK1-KO inhibits the expression levels of LPS-induced HMC3 inflammatory factors TNF-α, IL-6, IL-1β, *0.01 <= P < 0.05, **0.001 >= P < 0.009, ***0.0001 >= P < 0.009, ****P < 0.0001.

[0030] Figure 9 Angiogenesis of HRMEC cells co-cultured with HMC3 cells; wherein, A is the angiogenesis of HRMEC cells co-cultured with HMC3 cells; B is the number of angiogenesis of each group; *0.01 <= P < 0.05, **0.001 >= P < 0.009, ***0.0001 >= P < 0.009, ****P < 0.0001 scale = 100 μm.

[0031] Figure 10 Immunofluorescence detection results of intercellular junction protein ZO-1; wherein, A is the immunofluorescence image; B is the statistical chart; *0.01 <= P < 0.05, **0.001 >= P < 0.009, ***0.0001 >= P < 0.009, ****P < 0.0001.

[0032] Figure 11 TAK1 iMG-KO Mouse breeding flow chart.

[0033] Figure 12 Flow chart for establishing OIR model of mice.

[0034] Figure 13 Experimental results of successfully constructing OIR mouse model; wherein, A is the IB4 staining of retinal smears of Normal P17 and OIR P17 groups; B is the area statistics of retinal neovascularization and non-perfusion area.

[0035] Figure 14To inhibit retinal neovascularization of OIR mouse model by specific knockout of microglial cell TAK1; wherein, A is each group of vascular immunofluorescence IB-4 staining; B is the statistics of non-perfusion area and neovascular area of retina; *0.01 <= P < 0.05, **0.001 >= P < 0.009, ***0.0001 >= P < 0.009, ****P < 0.0001 scale = 100 μm.

[0036] Figure 15 To inhibit retinal neovascular endothelial cell migration breakthrough of inner limiting membrane of OIR mouse model by specific knockout of microglial cell TAK1; wherein, A is each group of retinal paraffin section HE staining; B is the statistics of the number of cells breaking through the inner limiting membrane of the retina; *0.01 <= P < 0.05, **0.001 >= P < 0.009, ***0.0001 >= P < 0.009, ****P < 0.0001 scale = 100 μm. DETAILED DESCRIPTION

[0037] In order to facilitate the understanding of the present application, the present application will be described more fully below. The present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present application more thorough and comprehensive.

[0038] The experimental methods in the following examples not specified in the specific conditions, generally in accordance with the conventional conditions, for example, Green and Sambrook, editor of the fourth edition of "molecular cloning laboratory manual" (Molecular Cloning: A Laboratory Manual) has been published in 2013, or in accordance with the manufacturer's recommended conditions. The various common chemical reagents used in the examples, are commercially available products.

[0039] Unless otherwise defined, all technical and scientific terms used in the present application have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terms used in the specification of the present application are only for the purpose of describing the specific embodiments and are not used to limit the present application. The term "and / or" used in the present application includes any and all combinations of one or more related listed items.

[0040] The present application will be further described in detail below in conjunction with specific examples.

[0041] Example 1

[0042] To explore the regulation of TAK1 knockout on HMC3 inflammatory response after using Crispr-CAS9 to construct CRISPR-mediate TAK1 KO HMC3 cell line, and co-culture HMC3 and HRMEC to evaluate the effect of HMC3 cell knockout TAK1 on the angiogenesis biological process of HRMEC.

[0043] In this study, TAK1 sgRNA lentivirus was constructed for TAK1 gene knockout of HMC3 cells. In order to achieve TAK1 gene knockout (not just inhibition) of HMC3 cells, and make it completely negative expression, multiple sgRNA sequences were designed at the position of TAK1 gene open reading frame, and the following four sgRNAs were used as examples to illustrate.

[0044] sgRNA1: GAGTTGTTTGCAAAGCTAAG (SEQ ID NO: 1);

[0045] sgRNA2: GTCCCTGTGAATTAGCGCTT (SEQ ID NO: 2);

[0046] sgRNA3: AGAGCCTGATGACTCGTTGT (SEQ ID NO: 3);

[0047] sgRNA4: TTTGGGAAGTGATAACGCGT (SEQ ID NO: 4).

[0048] I. Experimental method

[0049] 1. Construction of TAK1 sgRNA lentiCRISPRv2 lentivirus

[0050] 1.1 Liposome transfection of HEK293T cells and virus collection

[0051] (1) The lentiCRISPRv2 vector (schematic diagram as shown in Figure 1 ) inserted with TAK1 sgRNA, packaging plasmid, psPAX2 and envelope plasmid VSV-G were inoculated into liquid LB culture overnight, then plasmid DNA was extracted with endotoxin-free large extraction kit, and the DNA concentration was determined.

[0052] (2) The HEK293T cells were inoculated into 10 cm culture dishes one day before transfection, and the DMEM medium containing 10% FBS was used, 5% CO2, 37°C, and the cells were cultured for 24 h. The inoculation density was controlled to be about 80% ~ 90% of the suitable transfection density.

[0053] (3) The liquid was changed 1 h before transfection, and I Continue to culture in the culture dish.

[0054] (4) Mix A and B respectively. A contains 1.5 mL I, 4 μg DNA (packaging plasmid pMD2.G, psPAX2 and target gene plasmid respectively, added in a mass ratio of 1:1:2), gently blow the mixture with a gun head to mix. B is 1.5 mL I, 40 μL Lipofectamine 2000, gently blow the mixture with a gun head to mix, and stand at room temperature for 5 min. Mix A and B, gently blow the mixture, and stand at room temperature for 20 min.

[0055] (5) Slowly add the mixed A and B to the prepared cell culture dish using a pipette, gently shake to distribute the mixture evenly, and culture at 37°C, 5% CO2. Replace the medium with DMEM complete medium after 6 h of transfection, and place the culture dish in a culture incubator at 37°C, 5% CO2 for 48 h.

[0056] (6) After 48 h of transfection, aspirate the culture supernatant, centrifuge at 4°C, 2000 g for 30 min. The obtained centrifugal supernatant is used for removing cell debris by 0.45 μM filtration and stored for later use. The collected supernatant can also be stored in a 4°C refrigerator, and an equal amount of DMEM complete medium is added to the cell culture dish. After 24 h of incubation in the cell culture incubator, the supernatant is collected again, and the two times of collected supernatant are filtered, centrifuged and collected virus particles.

[0057] (7) The centrifugal filtrate obtained in the previous step is transferred to a centrifuge tube using a pipette, and centrifuged at 50000 g for 2 h. The supernatant is discarded, and the lentivirus particles in the precipitate are collected.

[0058] (8) Resuspend the precipitate with 200 μL HBSS buffer, and divide the resuspension into aliquots and store in a -80°C refrigerator.

[0059] 1.2 Lentivirus purification

[0060] (1) Transfer 200 μL virus concentrate and 1.5 mL 20% sucrose solution to a centrifuge tube, and centrifuge at 50,000 g for 2 h after equilibration.

[0061] After centrifugation, discard the supernatant, collect the precipitated virus particles, resuspend the precipitate with 200 μL HBSS per tube buffer, and determine the virus titer.

[0062] 1.3 Titer determination (fluorescence counting method)

[0063] (1) Seed HEK293T cell suspension into 96-well plates, 1×10⁶ cells per well. 4 Cells were inoculated at a volume of 100 μL and incubated overnight in a 37°C, 5% CO2 incubator.

[0064] (2) On the second day, the virus stock solution was serially diluted with DMEM complete medium using the limiting dilution method, each time by 10⁻⁶. -1 Up to 10 -10 Discard the culture medium in the wells and add a 10:10 dilution to the culture wells. -4 Up to 10 -10 For each dilution of the virus solution, three replicates were made, with 100 μL of different concentrations of virus dilution suspension added to each well.

[0065] (3) After 16 hours of transfection, the medium was replaced with DMEM complete medium and incubated at 37°C with 5% CO2.

[0066] (4) Observe the fluorescence expression under a fluorescence microscope after 48–72 h. Select wells with fluorescence rates of 1–20% and calculate the titer according to the following formula: Virus titer = number of fluorescent cells × dilution factor × 1000.

[0067] 2. Establishment of CRISPR-mediate TAK1 KO HMC3 cell line

[0068] HMC3 cells were transfected with TAK1 sgRNA lentiCRISPRv2 lentivirus for 72 hours, followed by selection with 1.0 μg / mL puromycin. Cells were allowed to grow for at least 7 days after transduction to achieve complete TAK1 gene knockout. Single clones of TAK1-KO HMC3 cells were generated through extreme dilution. DNA sequencing across the sgRNA targeting region was used to verify the presence of TAK1 in the TAK1-KO HMC3 cells, confirming the presence of base insertions, deletions, duplications, or mutations. Western blotting further confirmed the absence of TAK1 protein expression in TAK1-KO HMC3 cells.

[0069] 2.1 Screening of Puromycin Concentrations

[0070] Cells were counted at 1.5 × 10⁻⁶. 5 HMC3 cells were seeded in 6-well plates. When the cell density reached about 70%-90%, the medium was replaced with complete medium containing different concentrations of puromycin. The killing effect of puromycin on cells was observed and recorded after 24h and 48h.

[0071] 2.2 Selection of MOI value for lentivirus transfection

[0072] Multiplicity of Infection (MOI) is an important parameter to measure the efficiency of viral vector infection, defined as the ratio of the number of viral particles to the number of target cells required to achieve a specific infection rate. Its formula is: MOI = (virus titer x virus suspension volume) / total number of cells. When the MOI value increases, the probability of contact between virus and cell increases, but too high MOI may lead to cell toxicity (usually with a critical threshold of cell survival rate > 80%). In this study, the control lentivirus expressing green fluorescence protein (GFP) was used to select the optimal multiplicity of infection of target cells.

[0073] (1) One day before transduction (day 0), HMC3 cells were seeded at a density of 1.5 x 10 5 cells / cm 2 in a 6-well plate. The culture system was DMEM medium containing 10% fetal bovine serum, penicillin and streptomycin. The culture plate was placed in a dynamic balance incubator at 37°C, 5% CO2, and the cell confluence was maintained at 30%-50%.

[0074] (2) On the day of transduction (day 1), the lentivirus vector stored at -80°C was slowly reconstituted (about 15 minutes) on an ice box. After reconstitution, the virus suspension was filtered through a 0.22 μm filter membrane, and pre-cooled PBS buffer was added to the working volume. To avoid aggregation of virus particles, gentle blowing (about 10 times) was used to mix, and vortexing was avoided to prevent envelope rupture.

[0075] (3) Medium replacement: discard the original culture medium, add 1 mL of fresh culture medium (containing 10% FBS) per well Virus loading calculation: based on the previously determined lentivirus titer and optimized MOI value (1.5±0.3), the required virus amount for each well was calculated according to the formula Virus Volume = (MOI x Cell Number) / Virus Titre. After reconstitution, the virus suspension was immediately stored at 4°C (<2 hours) to avoid repeated freeze-thawing. The virus suspension was slowly added along the wall of the culture hole, and the culture plate was tilted (about 45°) to allow the liquid to flow naturally and cover the cell surface.

[0076] (4) Immediate toxicity assessment: observe the morphological changes of cells every 2 hours after transduction (phase contrast microscope, 20x objective), and record the proportion of cell shrinkage. Fluorescent signal tracking: on day 2, GFP expression was detected using an inverted fluorescence microscope at an excitation wavelength of 488 nm. On day 4, ImageJ software was used to quantitatively analyze the proportion of GFP-positive cells (≥80% was determined as effective transduction).

[0077] (5) Change the liquid, remove the virus-containing medium 24 hours after transduction, add fresh complete medium (containing 10% FBS) and maintain the culture conditions: continue to be placed at 37°C, 5% CO2 environment, and change the culture medium every 48 hours. Change the liquid on the second day, aspirate the virus-containing medium, add fresh complete medium, and place in a 37°C, 5% CO2 carbon dioxide incubator overnight culture. On the fourth day, observe the expression of green fluorescent protein in HMC3 cells under a fluorescence microscope, and select the MOI value of 80% cells expressing GFP for subsequent experiments.

[0078] 3. Obtaining of TAK1 KO HMC3 monoclonal cell strain

[0079] Based on the probabilistic basis of single cell colony formation (Poisson distribution model), the transfected positive cells after puromycin screening were single cloned by limited dilution method. By accurately controlling the concentration of cell suspension, a single cell was allowed to proliferate independently in a limited culture volume (100 μL / well), ensuring that a single clone cell line with uniform genotype was finally obtained. After positive cells screened by puromycin were resuspended in pre-cooled PBS, they were accurately diluted to the target concentration using a pipette. 100 μL of cell suspension was added to each well, and a randomized seeding method was used to avoid position effects. Blank control wells (containing only medium) were pre-set for background correction. The bottom of the culture plate was gently tapped to evenly distribute the cells. After 24 hours of culture, single cell wells were observed using an inverted microscope, target well positions were marked, and a well coordinate system file was established. The cell proliferation state was observed daily at a fixed time, and fresh culture medium (containing 1% penicillin-streptomycin) was changed every 48 hours. When single clone cells formed visible colonies (about 7-10 days), the cloned cells in the target well position were collected: after cell counting using 0.25% trypsin digestion for 1 minute, they were aliquoted into 24-well plates at a ratio of 1:3, gradually expanded to T75 culture bottles, and then subjected to subsequent experiments.

[0080] 3.1 DNA Sanger sequencing of monoclonal cell strain

[0081] After the above monoclonal cell strain is replaced into a 12-well plate, part of the cells are used to extract the genomic DNA of the cell strain using a TIANamp Genomic DNA Kit: the cells are resuspended using the culture medium to obtain a cell suspension, the cell suspension is centrifuged at 10,000 rpm for 1 min, and the supernatant is discarded; 200 μL of buffer GA is added to the centrifuge tube, and the centrifuge tube is shaken with fingers until it is completely suspended; 20 μL of a Proteinase K solution is added to the centrifuge tube, and after being mixed by inversion, 200 μL of buffer GB is added, and the centrifuge tube is mixed by inversion; the centrifuge tube is placed in a 70°C metal bath for 10 min until the solution becomes clear, and then 200 μL of anhydrous ethanol is added to the centrifuge tube after centrifugation to remove the water droplets on the lid of the centrifuge tube; the resulting solution and flocculent precipitate are both added to an adsorption column CB3, and the adsorption column is placed in a collection tube, which is centrifuged at 12,000 rpm for 30 s, and the waste liquid is discarded; the adsorption column CB3 is placed back into the collection tube; 500 μL of buffer GD is added to the adsorption column CB3, which is centrifuged at 12,000 rpm for 30 s, and the waste liquid is discarded; 600 μL of a rinse solution PW is added to the adsorption column CB3, which is centrifuged at 12,000 rpm for 30 s, and the waste liquid is discarded; the above step is repeated; the adsorption column CB3 is placed back into the collection tube, which is centrifuged at 12,000 rpm for 2 min, and the waste liquid is discarded. The adsorption column CB3 is left at room temperature for several minutes to completely dry the residual rinse solution in the adsorption material. Note: The purpose of this step is to remove the residual rinse solution from the adsorption column, because the residual ethanol in the rinse solution will affect subsequent enzyme reactions (such as enzyme digestion and PCR). The adsorption column CB3 is transferred into a clean EP tube, and 50 μL of elution buffer TE is carefully added to the middle of the adsorption membrane, which is left at room temperature for 3 min, and then centrifuged at 12,000 rpm for 2 min, and the solution is collected into a centrifuge tube to obtain the DNA template solution.

[0082] The target fragment DNA amplification across the sgRNA target region is performed using an ultra-high-fidelity PCR kit. The template DNA is thawed on ice; 2x UltraHiFi Mix II, PCR Enhancer, and ultrapure water are thawed at room temperature, and after thawing, they are quickly placed in an ice box for standby. Before use, the 2x UltraHiFi Mix II is vortexed and mixed.

[0083] The TAK1 gRNA primer sequence (the amplified fragment size is 608 bp) is shown in Table 1:

[0084] Table 1

[0085]

[0086] The reaction system was prepared according to the following Table 2.

[0087] Table 2

[0088]

[0089] The reaction procedure was set according to the following Table 3.

[0090] Table 3

[0091]

[0092] The PCR amplification product was sent to Shanghai Shenguo for sequencing.

[0093] 3.2 Western Blot detection of TAK1 protein expression in each editing positive monoclonal cell strain

[0094] (1) Protein extraction

[0095] 1) Cell lysis system construction

[0096] RIPA lysis buffer containing 1:100 protease inhibitor cocktail was used to prepare the lysis system. According to the single hole capacity of the 6-hole plate (60-100 μL), the lysis solution and protease inhibitor were premixed at a ratio of 100:1 to ensure that the amount added to each hole was accurate to 60±5 μL.

[0097] 2) Cell collection and lysis

[0098] Digestion termination: after discarding the culture medium, 2 mL of pre-cooled PBS buffer was added to each hole, and the cell suspension was collected by gently blowing 3 times. Transfer and centrifugation: the cell suspension was transferred to a pre-cooled 1.5 mL EP tube and centrifuged at 1200 x g for 5 minutes at 4°C; washing treatment: after discarding the supernatant, the residual culture medium was completely absorbed using a pipette tip, and the cell pellet was resuspended by adding pre-cooled PBS.

[0099] Lysis resuspension: 60-100 μL of lysis buffer was added to the EP tube, and the cell mass was gently dispersed using a 10 μL pipette tip (avoid vortexing). Mechanical disruption: water bath ultrasonic method: the EP tube was placed in an ice-water mixed water bath, and the ultrasonic disrupter was used for 30 times x 30 seconds disruption (power 200 W).

[0100] 3) Centrifugal purification

[0101] Primary centrifugation: centrifuged at 13000 x g for 15 minutes at 4°C to separate cell debris and soluble protein. Secondary centrifugation: the supernatant was transferred to a new EP tube and centrifuged at 16000 x g for 10 minutes at 4°C to remove trace impurities.

[0102] (2) Protein concentration determination

[0103] Configuration A liquid with B liquid, A: B = 200:4 (uL), add 200uL mixed liquid per hole; sample in 96-well plate: standard hole sample, the concentration of standard Bsa used is 2ug / uL, as shown in Table 4.

[0104] Table 4

[0105]

[0106] The sample hole sample amount is shown in Table 5.

[0107] Table 5

[0108]

[0109] After the sample is added, the hole plate is placed in an incubator, incubated at 37°C for 30min, and the absorbance at wavelength 562nm is detected using an enzyme marker; the standard curve and formula of the protein concentration obtained by fitting are calculated using the obtained absorbance value.

[0110] After calculating the sample concentration using the obtained formula, the sample is placed in a metal bath after SDS, 95°C, 10min. The protein sample after the metal bath is placed in a-20°C refrigerator or-80°C refrigerator for standby.

[0111] (3) Gel electrophoresis

[0112] After preparing the gel, prepare the electrophoresis liquid and add it after installing the gel; according to the sample concentration measured, the protein amount per hole is 10ug, and the marker hole adds 5-10uL of marker; set the constant voltage to 200V, the initial current to 30mA, and run for 30 minutes. By monitoring the bubble generation direction (normal should be from anode to cathode), ensure that the system is well sealed. Prepare the transfer membrane liquid in advance, and do the membrane pretreatment: cut the polyvinylidene fluoride (PVDF) membrane into 5x8 cm specifications, immerse it in methanol for 5 minutes for hydrophobic activation, then transfer it to the membrane buffer solution for 20 minutes, and wait for use.

[0113] (4) Transfer membrane

[0114] After electrophoresis, take the gel, cut the gel, clamp the gel and PVDF membrane in the transfer clamp, and carefully remove the bubbles; transfer membrane parameters: 400mA, 30min.

[0115] (5) Blocking

[0116] Take out the PVDF membrane, immerse it in the fast blocking liquid, and slowly shake on a horizontal shaker at room temperature for 10-15min.

[0117] (6) Antibody incubation

[0118] Dilute the primary antibody as recommended in the instructions, transfer the membrane to the prepared primary antibody dilution buffer, and incubate overnight at 4°C. Wash the membrane four times with rapid shaking for 3-5 minutes each time using TBST; dilute the secondary antibody 1:1000, incubate with the secondary antibody, and shake slowly on a shaker for 1-2 hours.

[0119] (7) Development

[0120] Wash the PVDF membrane with TBST four times with rapid shaking, each time for 3-5 minutes; prepare the developer solution in the dark, with a:b = 1:1; cover the PVDF membrane with the developer solution and develop it on the machine.

[0121] 3.3 TAK1 Immunofluorescence Detection of TAK1 Protein Expression

[0122] (1) Cell culture and slide pretreatment: HMC3 cells were cultured at 2×10⁻⁶ cells / slides. 4 cells / cm 2 Density seeding was performed on coverslips pre-coated with poly-L-lysine, placed in DMEM medium containing 10% fetal bovine serum, and cultured at 37°C in a 5% CO2 dynamic equilibrium incubator until cell confluence reached 80%-90%. Excessive cell adhesion was avoided.

[0123] (2) Fixation and permeabilization: Cell fixation: After removing the culture medium, gently wash three times with pre-cooled PBS buffer. Add 4% paraformaldehyde fixative and incubate at 4°C for 20 minutes. After fixation, wash three more times with PBS buffer, 5 minutes each time.

[0124] (3) Membrane permeability treatment: Add 1% Triton X-100 ( Incubate with T9258 permeabilizer at 4°C for 10 minutes. Remove unpermeated cell debris by centrifugation (4°C, 1200×g, 5 minutes), followed by washing three times with PBS buffer.

[0125] (4) Antibody blocking and incubation: Blocking reaction: Add 3% bovine serum albumin (BSA, Blocking solution (A7032) was incubated at 37°C for 1 hour to block non-specific binding sites. After blocking, the blocking solution was discarded, and the sample was washed three times with PBS buffer. Primary antibody incubation: Diluted primary antibody (recommended concentration: 1:200, optimized according to antibody instructions) was added, and incubated overnight at 4°C. The next day, the sample was removed and washed three times with PBS buffer for 5 minutes each time. Secondary antibody labeling: Fluorescent secondary antibody (dilution ratio: 1:500) was added and incubated at room temperature in the dark for 1-2 hours. After incubation, the sample was washed three times again with PBS buffer, and finally rinsed once with distilled water to remove residual reagents.

[0126] (5) Imaging and data analysis: The samples were added with anti-quenching mounting medium and observed under fluorescence microscope. The images were collected through excitation filter set for GFP, and the fluorescence intensity was quantitatively analyzed by ImageJ Fiji software, with DAPI-stained nuclei as the internal reference region.

[0127] 4. TAK1-KO inhibits the expression level of LPS-induced HMC3 inflammatory factors TNF-a, IL-6, IL-1b

[0128] After establishing the CRISPR-mediated knockout TAK1 HMC3 cell model, LPS was used to induce inflammation, and the expression levels of HMC3 inflammatory factors TNF-a, IL-6, IL-1b were detected by ELISA.

[0129] 4.1 Elisa detection of LPS-induced HMC3 inflammatory factor expression level

[0130] (1) Cell pretreatment: Wild-type HMC3 cells (WT) and TAK1-KO HMC3 cells (KO) were inoculated at a density of 5 x 10 4 cells / cm 2 in a 6-well plate and cultured in DMEM medium containing 10% fetal bovine serum in a 37°C, 5% CO2 dynamic balance incubator until the cell confluence reached 70%-90%, and then replaced with serum-free medium for starvation treatment.

[0131] (2) Inflammation stimulation and sample collection: After 12 hours of starvation treatment, the culture medium was replaced with complete culture medium containing 100 ng / mL LPS, and incubated for 24 hours. The following operation specifications must be strictly followed: culture medium replacement: when the old culture medium was discarded, 1 mL of pre-cooled PBS buffer was added to each well.

[0132] (3) LPS loading: LPS suspension was slowly added along the wall of the culture hole, and the culture plate was tilted (45°) to evenly cover the cell surface with liquid. The morphological changes of the cells were observed, and the toxic effects (such as cell shrinkage ratio > 15%) were recorded.

[0133] (4) Supernatant sample treatment: The culture supernatant of each group of cells was collected and immediately transferred to a pre-cooled centrifuge tube, and centrifuged at 1200 x g for 10 minutes at 4°C to remove cell debris. According to the ELISA kit instructions, the sample was diluted to the recommended concentration range (recommended 1:5-1:20).

[0134] (5) ELISA detection process: standard curve construction: the recombinant protein standard was diluted according to the gradient, and was added to the 96-well enzyme-labeled plate. Each well was added with 50 μL of standard solution, and was incubated at 37°C for 1 hour. Sample loading: each well was added with 50 μL of the sample to be detected, and blank control (only diluent was added), positive control (known high concentration sample) and negative control (PBS instead of sample) were set. Color development reaction: incubation in the dark, after termination of the reaction, color developing liquid was added, and OD value was determined at 450 nm wavelength.

[0135] (6) Data analysis model: the standard curve was fitted by using double logarithmic coordinate system. The OD correction value of each sample (experimental group OD-blank group OD) was calculated, and the target protein concentration was obtained by substituting the standard curve equation. The experimental data was expressed as Mean ± SEM, and the difference between groups was tested by One-way ANOVA (P<0.05 was significant difference).

[0136] 5. TAK1-KO HMC3 cells and HRMEC cells were co-cultured

[0137] In order to further explore the influence of TAK1 gene knockout in microglial cells (HMC3) on the angiogenesis biological process of HRMEC, TAK1-KO HMC3 cells were co-cultured with HRMEC cells to simulate the interaction environment of HMC3 cells and HRMEC cells in vivo, and the angiogenesis ability of HRMEC cells was evaluated by using tube formation experiment and immunofluorescence detection of intercellular junction protein ZO-1, so as to reflect the influence of TAK1 gene knockout in HMC3 cells on the angiogenesis biological process of HRMEC.

[0138] 5.1 Transwell

[0139] Wild type HMC3 cells (WT), TAK1-KO HMC3 cells (KO) and HRMEC cells in good growth state were selected respectively, and the cells were digested by trypsin, centrifuged after stopping digestion, and the culture solution was removed, and then washed with PBS for 1 to 2 times; then, the wild type HMC3 cells, TAK1-KO HMC3 cells were resuspended with culture medium containing 0.05%-0.2% BSA, and the cell density was adjusted to 1 to 10 x 10 5Cell; 100 μL of wild-type HMC3 cell and TAK1-KO HMC3 cell suspensions were added to the upper chamber of the Transwell chamber, and HRMEC cells were resuspended in complete medium and added to the lower chamber. After 12 h, the cells adhered, and the medium in the upper chamber was replaced with complete medium containing LPS at a concentration of 100 ng / mL. After 48 h of culture: (1) the HRMEC cells in the lower chamber were digested with trypsin to obtain a cell suspension, and the cell density was adjusted to 9000 cells / well. The cells were seeded on a pre-prepared angiogenesis slide and incubated in a cell incubator for 3 h before being photographed under a light microscope for recording and counting the number of angiogenesis;

[0140] (2) Immunofluorescence detection of the expression of intercellular junction protein ZO-1.

[0141] 6. Statistical analysis

[0142] Statistical analysis was performed using SPSS 26.0 and GraphPad Prism 9.0. The statistical data were expressed as mean ± standard deviation (SD). The differences between the two groups were compared by Student's T test. When P < 0.05, the difference was considered statistically significant.

[0143] II. Experimental results

[0144] 1. Successful establishment of TAK1 KO HMC3 monoclonal cell strain

[0145] Four TAK1 sgRNA lentiCRISPRv2 lentiviruses containing sgRNA1- sgRNA4 were successfully constructed: TAK1 sgRNA1 lentiCRISPRv2, TAK1 sgRNA2 lentiCRISPRv2, TAK1 sgRNA3 lentiCRISPRv2, and TAK1 sgRNA4 lentiCRISPRv2. The above-mentioned TAK1 sgRNA lentiCRISPRv2 lentivirus was used to express the inserted puromycin resistance gene to screen lentivirus transfected positive cells. Before transfection, the killing effect of different concentrations (1-8 μg / mL) of puromycin-containing complete medium on HMC3 cells was evaluated, and the concentration of puromycin that could kill all HMC3 cells in about 48 hours was selected. It was observed that all concentrations of puromycin killed all HMC3 cells in the culture plate at 48 h. To minimize the toxicity of puromycin on HMC3 cells, the lowest concentration of 1 μg / mL was selected for positive cell screening. Figure 2

[0146] ​To obtain better transfection effect, different MOI values (4-10) of GFP lentivirus were used to transfect HMC3 cells, and the MOI value of 80% cells expressing GFP at 48 h after transfection was selected for subsequent transfection experiment. It was observed that when the MOI value was 10, the expression of GFP in HMC3 cells was high, and this MOI value was selected for subsequent transfection of HMC3 cells. Figure 3

[0147] During the experiment, HMC3 cells transfected with TAK1 sgRNA4 lentiCRISPRv2 lentivirus died, which may be due to the lethal toxicity of sgRNA4 to HMC3 cells. Therefore, cells transfected with TAK1 sgRNA1 lentiCRISPRv2, TAK1 sgRNA2 lentiCRISPRv2 and TAK1 sgRNA3 lentiCRISPRv2 lentivirus were used for further study.

[0148] The positive cells obtained by drug screening after transfection of each group were planted in 96-well plates using limiting dilution method, and single cell culture wells were selected. After continuous culture, different size culture plates were replaced according to the density of single clone formation to obtain sufficient number of TAK1 KO HMC3 single clone cells for subsequent experiments. Figure 4 After obtaining the single clone cell lines, the target fragments in the sgRNA targeting region were amplified by PCR and sequenced by Sanger sequencing, and the single clone lines with base insertion or deletion in the target DNA fragment region were obtained. Figure 5 The representative sequencing results are shown in the following table.

[0149] Further, Western Blot was used to screen TAK1 protein expression in edited positive single clone cell lines. As shown in Figure 6 , only the sgRNA1 group could make TAK1 protein expression negative, and the sgRNA2 and sgRNA3 groups could only inhibit the expression of TAK1 protein but could not make it negative expression. The single clone cell lines with negative TAK1 protein expression screened by Western Blot were used for subsequent study.

[0150] To verify the TAK1 knockout effect of the single clone cell lines, wild type HMC3 cells and single clone cell lines with negative TAK1 protein expression screened by Western Blot were planted on cell slides for immunofluorescence staining. The results showed that Figure 7 ), compared with wild type HMC3 cells, TAK1-KO group HMC3 cells had no TAK1 fluorescence expression, and the difference was statistically significant.

[0151] ​2. TAK1-KO inhibits the expression levels of LPS-induced HMC3 inflammatory factors TNF-a, IL-6, IL-1β

[0152] To detect the regulatory effect of TAK1 gene knockout on the expression levels of inflammatory factors in HMC3 cells, we used an Elisa kit to detect the concentrations of TNF-a, IL-6, IL-1β in the culture solution after centrifugation after culturing wild type HMC3 cells (WT) and TAK1-KO HMC3 cells (KO) in a medium with a LPS concentration of 10 ng / mL for 24 h. The results are shown in Figure 8 As shown, TAK1-KO can significantly inhibit the expression levels of LPS-induced HMC3 inflammatory factors TNF-a, IL-6, IL-1β.

[0153] 3. TAK1-KO HMC3 cells inhibit the angiogenic ability of HRMEC cells

[0154] The angiogenic ability of HRMEC cells co-cultured with TAK1-KO HMC3 cells was evaluated, and the results are shown in Figure 9 As shown, compared with the WT group, the number of HRMEC cell tubes in the WT+LPS group was more, and the difference was statistically significant, indicating that co-culturing with LPS-induced HMC3 cells enhanced the angiogenic ability of HRMEC cells; compared with the WT+LPS group, the number of angiogenesis in the LPS+TAK1-KO group was lower, and the difference was statistically significant, indicating that co-culturing TAK1-KO HMC3 cells with HRMEC cells inhibited the angiogenic ability of HRMEC cells; compared with the KO group, the number of angiogenesis in the TAK1-KO+LPS group had no statistically significant difference, and the number of angiogenesis in the KO group and the LPS+TAK1-KO group had no statistically significant difference compared with the WT group, indicating that co-culturing the KO group with the LPS+TAK1-KO group and HRMEC cells had no effect on the physiological angiogenic ability of HRMEC. In addition, compared with the WT+LPS group, the expression state of the intercellular junction protein in the LPS+TAK1-KO group was stable Figure 10 ). These results show that specific knockout of TAK1 in microglial cells can inhibit pathological retinal neovascularization and microglial cell adhesion within blood vessels.

[0155] Example 2

[0156] Specific knockout of TAK1 in microglial cells inhibits retinal tissue neovascularization in OIR mouse models.

[0157] I. Materials and methods

[0158] 1. Experimental animals

[0159] The genetically modified mice in this section were purchased from Guangdong Yaoke Biotechnology Co., Ltd. The animal experiment protocol in this section has been approved by the Experimental Animal Ethics Committee of South China Agricultural University (No. 2024F817).

[0160] The genetically modified mice were constructed by Cre-LoxP gene editing technology. The construction process of Cre-loxP knockout mice is as follows: 1. Constructing Flox mice: First, insert LoxP sequences into both ends of the DNA region that needs to be deleted. This region is usually referred to as the flox region. The obtained mouse is called Flox mouse, whose gene function remains unchanged under normal circumstances. 2. Select Cre tool mouse: According to the experimental requirements, select Cre tool mouse with tissue or cell-specific promoter. These mice can express Cre recombinase in specific tissues or cells. 3. Cross and screen: Cross the Flox mouse with the Cre tool mouse, and screen for mice carrying both Flox and Cre genes through multiple generations of mating. These mice will achieve conditional gene knockout in specific tissues or cells when Cre recombinase is expressed.

[0161] 2. Main reagents and instruments

[0162] 2.1 Main reagents

[0163] The main reagents are shown in Table 6.

[0164] Table 6

[0165]

[0166]

[0167] 2.2 Main instruments

[0168] The main reagents are shown in Table 7.

[0169] Table 7

[0170]

[0171] 3. Experimental methods

[0172] 3.1 Genotype detection of genetically engineered mice

[0173] (1) DNA extraction

[0174] Place the mouse tail (~2mm) in a 1.5mL centrifuge tube, add 75μL lysis buffer and 0.75μL proteinase K solution, incubate at 56℃ for 15min; continue incubation at 95℃ for 30min; cool to 4℃, add 75μL equilibration buffer to each centrifuge tube to obtain DNA that can be used for subsequent PCR.

[0175] (2) PCR

[0176] PCR was performed after loading according to Table 8 below.

[0177] Table 8

[0178]

[0179] The PCR reaction conditions are shown in Table 9.

[0180] Table 9

[0181]

[0182] The PCR primer sequences are shown in Table 10.

[0183] Table 10

[0184]

[0185] 3.2 TAK1 iMG-KO Establishment and induction of mice

[0186] TAK1 flox / flox mice were mated with VE-cadherin(BAC)-CreERT2 mice to obtain VE-cadherin(BAC)-CreERT2 / TAK1flox / flox mice, and TAK1 deletion in microglial cells in the VE-cadherin(BAC)-CreERT2 / TAK1flox / flox mice was induced by intraperitoneal or intramuscular injection of Tamoxifen (62.5 mg / kg) dissolved in anhydrous ethanol and corn oil. iMG-KO Mice were only given a single injection of Tamoxifen. Figure 11 TAK1 iMG-KO Flow chart of breeding mice.

[0187] 3.3 Establishment of a retinopathy (OIR) model

[0188] After obtaining TAK1 iMG-KO Mice, an oxygen-induced retinopathy (OIR) model was established, and the establishment flow chart is shown in Figure 12 , and the OIR mouse model was successfully constructed. Figure 13 .

[0189] II. Experimental results

[0190] 1. Specific knockout of microglial cell TAK1 inhibits retinal tissue neovascularization in the OIR mouse model.

[0191] In order to clarify the influence of microglial cell TAK1 specific knockout on the retinal avascular area and neovascularization of the OIR model mice, after the OIR modeling of mice, the eyeballs were taken for retinal smearing IB4 fluorescence staining, and then photographed under a fluorescence microscope, and the retinal avascular area and retinal neovascularization cluster were statistically analyzed. The results show that Figure 14 ), no central avascular area was found in the wild type control group mice, and no pathological neovascular cluster was found, and the rest of the three groups had central avascular area and neovascular cluster. Compared with the OIR disease control group, the avascular area of the remaining three groups had no statistical significance; compared with the OIR disease control group, the number of neovascular clusters in the TAK1-KO group was less, and the difference was statistically significant.

[0192] 2. Specific knockout of microglial cell TAK1 inhibits the migration of retinal tissue neovascular endothelial cells of OIR mouse model to break through the internal limiting membrane

[0193] In order to explore the influence of microglial cell TAK1 specific knockout on the migration and proliferation of vascular endothelial cells of the OIR model mice, the wild type nest mice and the genetically engineered nest mice injected with Tamoxifen were placed in an oxygen box with an oxygen concentration of 75% at 7 days after birth, and then taken out to normal air at P12 and continued to be cultured to p17, and then the mice were sacrificed to take eyeballs for paraffin embedding, sectioning and HE staining, and the number of endothelial cells breaking through the internal limiting membrane of each group was observed under an optical microscope and counted. The results show that Figure 15 ), compared with the wild type mice, the rest of the three groups had different numbers of endothelial cells breaking through the internal limiting membrane, and different amounts of neovascularization appeared. Compared with the OIR disease model group, the number of endothelial cells breaking through the internal limiting membrane in the Tamoxinfen group had no statistical significance, indicating that injection of Tamoxifen had no significant effect on the migration and proliferation of endothelial cells; the number of vascular endothelial cells breaking through the internal limiting membrane in the TAK1-KO group was less than that in the OIR disease model group, and the difference was statistically significant, indicating that specific knockout of microglial cell TAK1 can effectively inhibit the migration of retinal tissue neovascular endothelial cells of the OIR mouse model to break through the internal limiting membrane.

[0194] The above-described embodiments only express several embodiments of the present application, which are described in detail and specifically, but cannot be understood as limiting the scope of the patent. It should be noted that for ordinary skilled persons in the art, several modifications and improvements can be made without departing from the concept of the present application, which all belong to the protection scope of the present application. Therefore, the protection scope of the present application patent should be subject to the appended claims.

Claims

1. Application of reagents that knock out the TAK1 gene in microglia in the preparation of drugs for treating retinal neovascular diseases.

2. The application as described in claim 1, characterized in that, The reagent is a recombinant lentiviral vector containing sgRNA that knocks out the microglia TAK1 gene and a microglia-specific promoter.

3. The application as described in claim 2, characterized in that, The nucleotide sequence of the sgRNA is shown in SEQ ID NO:

1.

4. The application as described in claim 2, characterized in that, The microglia-specific promoter is TMEM119.

5. The application as described in any one of claims 1 to 4, characterized in that, The neovascular diseases of the retina include diabetic retinopathy, retinopathy of prematurity, retinal vein occlusion, and familial exudative vitreoretinopathy.

6. A drug for treating retinal neovascularization, characterized in that, The active ingredient of the drug contains a reagent for knocking out the TAK1 gene in microglia; the reagent is a recombinant lentiviral vector containing sgRNA that knocks out the TAK1 gene in microglia and a microglia-specific promoter.

7. The drug as described in claim 6, characterized in that, The nucleotide sequence of the sgRNA is shown in SEQ ID NO: 1; and / or, The microglia-specific promoter is TMEM119.

8. The drug as described in claim 6, characterized in that, The drug is in the form of an ocular injection, preferably an intravitreal injection.

9. A method for inhibiting pathological retinal neovascularization without therapeutic intent, characterized in that, Includes the following steps: The reagent that knocks out the TAK1 gene in microglia is introduced into the test sample, thereby knocking out the TAK1 gene in microglia in the test sample.

10. The method as described in claim 9, characterized in that, The reagent is a recombinant lentiviral vector containing sgRNA that knocks out the microglia TAK1 gene and a microglia-specific promoter. Preferably, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO: 1; and / or, The microglia-specific promoter is TMEM119.

Images