Application of Dnmt3L in diagnosis and treatment of heart failure

Abstract

The application discloses application of Dnmt3L in diagnosis and treatment of heart failure. The application firstly finds that overexpression of Dnmt3L is an inducing factor of early heart failure, and based on this, the application provides a method for constructing an animal model of heart failure based on overexpression of Dnmt3L. In addition, the application uses a substance for targeting and inhibiting expression of Dnmt3L to process myocardial cells, and it is verified that inhibition of Dnmt3L can inhibit apoptosis of the myocardial cells, and therefore the application also provides application of an inhibitor of Dnmt3L in preparation of a drug for treating heart failure. The application provides a new thought for mechanism research, diagnosis and treatment of heart failure, and has a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of Dnmt3L in the diagnosis and treatment of heart failure. Background Technology

[0002] Cardiovascular disease has become the leading cause of death in China, and heart failure is a clinical syndrome resulting from the end-stage progression of various cardiovascular diseases. Although some new drugs have been applied clinically in recent years, approximately 50% of heart failure patients still die within 5 years of diagnosis. Heart failure has a poor prognosis and high mortality rate, making it one of the leading causes threatening human health and increasing the burden on healthcare.

[0003] Heart failure (HF) is currently treated primarily with diuretics and neurohormone antagonists to improve clinical course, reduce hospitalization rates, and lower mortality. While ACE inhibitors (ARBs), beta-blockers, and mineralocorticoid antagonists (MRAs) are the mainstays of current treatment regimens, they often fail to achieve optimal therapeutic outcomes. Therefore, developing novel medications for heart failure is crucial.

[0004] Furthermore, studying the pathogenesis of heart failure is crucial for understanding and treating it. Animal models of human diseases are experimental subjects and materials established in biomedical research that mimic human disease manifestations. Animal models help to more conveniently and effectively understand the occurrence and development of human diseases and to study prevention and treatment measures. Therefore, providing an animal model of heart failure is of great significance for understanding and treating heart failure. Summary of the Invention

[0005] To overcome the shortcomings of the prior art, the purpose of this invention is to provide the application of Dnmt3L in the diagnosis of heart failure, the treatment of heart failure, and the construction of animal models of heart failure.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] The first aspect of the present invention provides for any of the following applications:

[0008] (1) Application of Dnmt3L inhibitors in the preparation of drugs for treating heart failure;

[0009] (2) Application of Dnmt3L inhibitors in the preparation of agents that inhibit cardiomyocyte apoptosis;

[0010] (3) Application of reagents for detecting Dnmt3L expression levels in the preparation of products for diagnosing heart failure;

[0011] (4) Application of Dnmt3L in constructing computer models or systems for diagnosing heart failure;

[0012] (5) Application of Dnmt3L in screening candidate drugs for the treatment of heart failure.

[0013] In this invention, Dnmt3L includes wild-type, mutant, or fragments thereof. The term encompasses full-length, unprocessed Dnmt3L, any form of Dnmt3L derived from cell-processed Dnmt3L, and naturally occurring variants of Dnmt3L (e.g., splice variants or allelic variants). The term covers, for example, human Dnmt3L and Dnmt3L from any other vertebrate source, including mammals such as primates and rodents (e.g., mice and rats), human Dnmt3L gene ID: 29947, mouse Dnmt3L gene ID: MGI:1859287.

[0014] In this invention, treatment can refer to therapeutic procedures or preventative measures, wherein the goal is to prevent or slow (alleviate) an undesirable physical condition, impairment, or disease, or to achieve a beneficial or desired clinical outcome. In this invention, treatment can refer to both treatment and prevention. Beneficial or desired clinical outcomes include, but are not limited to, symptom relief; reduction of the severity of a symptom, impairment, or disease; stabilization (i.e., non-exacerbation) of the state of a symptom, impairment, or disease; delaying the onset of a symptom, impairment, or disease or slowing its progression; improving the state of a symptom, impairment, or disease; and relief (whether partial or complete) (whether detectable or undetectable) or improvement of a symptom, impairment, or disease. Treatment may include causing a clinically noticeable response without excessive side effects. Treatment also includes extended survival compared to the expected survival without treatment.

[0015] Furthermore, the inhibitor reduces the expression level of Dnmt3L.

[0016] Furthermore, the inhibitors include nucleic acid inhibitors and protein inhibitors.

[0017] Furthermore, the inhibitor is selected from nucleic acid inhibitors.

[0018] Furthermore, the nucleic acid inhibitors include siRNA, shRNA, ribozymes, and antisense oligonucleotides.

[0019] Furthermore, the nucleic acid inhibitor is selected from shRNA.

[0020] Furthermore, the sequence of the shRNA is shown in SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8.

[0021] Furthermore, the sequence of the shRNA is shown in SEQ ID NO.7.

[0022] In this invention, an inhibitor refers to an inhibitor that can specifically bind to Dnmt3L, preferably human Dnmt3L, or bind to Dnmt3L polynucleotides or fragments thereof, and inhibit the activity and / or expression of Dnmt3L protein or polynucleotides. These include nucleic acid inhibitors and protein inhibitors.

[0023] Among them, protein inhibitors include antibodies, which are monoclonal, chimeric, human or humanized antibodies, or antibody fragments or synthetic antibodies.

[0024] The nucleic acid inhibitor is unmodified or modified with one or more chemical groups selected from the group consisting of: 2'O-methoxy, thiophosphate, locked nucleic acid, and cholesterol.

[0025] In embodiments of the present invention, the inhibitor is selected from nucleic acid inhibitors, including siRNA, shRNA, ribozymes, and antisense oligonucleotides.

[0026] Here, siRNA (small interfering RNA) refers to isolated RNA molecules, preferably longer than 10 nucleotides, more preferably longer than 15 nucleotides, and most preferably 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. These RNA molecules are used to recognize target genes or mRNAs to be degraded. The range of 19 to 25 nucleotides represents the optimal size for siRNA.

[0027] siRNA can include partially purified RNA, substantially pure RNA, synthetic RNA, or recombinant RNA, as well as RNA modified to differ from native RNA by adding, deleting, substituting, and / or altering one or more nucleotides. These alterations may include adding non-nucleotide substances, such as adding to the ends of the siRNA or to one or more internal nucleotides; modifications that make the siRNA resistant to nuclease digestion (e.g., using 2'-substituted ribonucleotides or modifying the sugar phosphate backbone); or replacing one or more nucleotides in the siRNA with deoxyribonucleotides. Additionally, as described above with respect to modified oligonucleotides, siRNA can be modified to improve its stability, particularly by introducing one or more phosphate thioester linkages.

[0028] shRNA (small hairpin RNA) is a non-coding small RNA molecule that can form hairpin structures. shRNA can suppress gene expression through the RNA interference pathway.

[0029] Antisense oligonucleotides (antisense nucleic acid sequences) may comprise nucleotide sequences complementary to sense nucleic acids encoding proteins (e.g., complementary to the coding strand of a double-stranded cDNA molecule or complementary to Dnmt3L mRNA). Antisense oligonucleotides and delivery methods are well known in the art (Goodchild, Curr. Opin. Mol. Ther., 6(2): 120-128 (2004); Clawson et al., GeneTher., 11(17): 1331-1341 (2004)), which are incorporated herein by reference in their entirety. Antisense oligonucleotides may be complementary to the entire coding strand of the target sequence or only to a portion thereof. In another embodiment, the antisense oligonucleotide is antisense with respect to the non-coding region of the coding strand of the nucleotide sequence in Dnmt3L mRNA. The length of an antisense oligonucleotide can be, for example, about 7, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more nucleotides.

[0030] Ribozymes are a class of RNAs that can be engineered to enzymatically cleave and inactivate other RNA targets in a specific sequence-dependent manner. Ribozymes and their delivery methods are well known in the art (Hendry et al., BMC Chem. Biol., 4(1): 1 (2004); Grasi et al., Curr. Pharm. Biotechnol., 5(4): 369-386 (2004); Bagheri et al., Curr. Mol. Med., 4(5): 489-506 (2004); Kashani-Sabet M., Expert Opin. Biol. Ther., 4(11): 1749-1755 (2004), each incorporated herein by reference in its entirety. Ribozymes inhibit translation by cleaving target RNA, thereby preventing the expression of target genes. Ribozymes can be chemically synthesized in the laboratory using methods known in the art and their structural modifications can be made to increase their stability and catalytic activity. Alternatively, ribozyme genes can be introduced into cells using gene delivery mechanisms known in the art.

[0031] In a specific embodiment of the present invention, the nucleic acid inhibitor is selected from shRNA.

[0032] Furthermore, the reagent includes a probe that specifically recognizes the Dnmt3L gene, primers that specifically amplify the Dnmt3L gene, and / or a binding agent that specifically binds to the protein encoded by the Dnmt3L gene.

[0033] Furthermore, the primer sequences for specifically amplifying the Dnmt3L gene are shown in SEQ ID NO.2-3.

[0034] Furthermore, the reagent also includes a detectable marker.

[0035] Furthermore, the labeling includes radioactive isotopes, enzymes, fluorescent molecules, and magnetic particles.

[0036] Furthermore, the products include reagent kits, chips, test strips, and nucleic acid membrane strips.

[0037] In this invention, the probe may be, for example, a full-length target gene nucleic acid or a portion thereof, such as an oligonucleotide with a length of at least 15, 30, 50, 100, 250 or 500 nucleotides and sufficient to specifically hybridize with the target gene mRNA or genomic DNA under stringent conditions.

[0038] In this invention, primers refer to short nucleic acid molecules, such as DNA oligonucleotides, for example, sequences of at least 15 nucleotides, which can form a hybrid between the primer and the target nucleic acid strand through nucleic acid hybridization and annealing with a complementary target nucleic acid molecule. The primers can be extended along the target nucleic acid molecule using polymerase. Therefore, primers can be used to amplify target nucleic acid molecules, wherein the primer sequence is specific to the target nucleic acid molecule, for example, the primer will hybridize with the target nucleic acid molecule under very high-tightness hybridization conditions.

[0039] In this invention, specific binding refers to the formation of a complex of two or more molecules that can be measured under physiological or assay conditions and is selective. Antibodies or antigen-binding proteins or other molecules are considered to be specifically bound to a protein, antigen, or epitope when, under appropriately selected conditions, this binding is not substantially inhibited, while nonspecific binding is inhibited. Specific binding is characterized by high affinity and selectivity for compounds, proteins, epitopes, or antigens. Nonspecific binding typically has lower affinity.

[0040] In this invention, a label refers to a composition capable of generating a detectable signal indicating the presence of a target polynucleotide in a sample. Suitable labels include, but are not limited to, radioisotopes, nucleotide chromophores, enzymes, substrates, fluorescent molecules, chemiluminescent components, magnetic particles, and bioluminescent components. Therefore, a label is any composition detectable by a device or method, including but not limited to spectroscopic, photochemical, biochemical, immunochemical, electrochemical, optical, chemical detection devices, or any other suitable device. In some embodiments, the label can be visually detected without the aid of a device. The term "label" is used to refer to any chemical group or portion having a detectable physical property, or any compound capable of causing a chemical group or portion to exhibit a detectable physical property, such as an enzyme that catalyzes the conversion of a substrate into a detectable product. Labels also encompass compounds that inhibit the expression of a particular physical property. A label can also be a compound that is a member of a binding pair, the other member of which has a detectable physical property.

[0041] Among them, radioactive isotopes include but are not limited to 3 H, 14 C 35 S, 125 I, 131 I.

[0042] Enzymes include, but are not limited to, horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase, and acetylcholinesterase.

[0043] Fluorescent molecules include, but are not limited to, FITC, rhodamine, and lanthanide phosphors.

[0044] In this invention, the kit also includes buffers, preservatives, or protein stabilizers. The kit may also contain essential components (e.g., substrates) for detecting the detectable reagent. The kit may also contain a control sample or a series of control samples, which can be measured and compared with the test sample contained therein. Each component of the kit is typically packaged in a separate container, and all different containers are packed into one package with instructions for observing whether the test subject has a disease related to the abnormal expression of the target gene or is at risk of developing said disease.

[0045] Other components of the kit include, but are not limited to: tools for collecting biological samples, tools for labeling detection reagents (binding agents), membranes for immobilizing Dnmt3L protein or Dnmt3L nucleic acid in biological samples, tools for adding biological samples onto the membrane, tools for binding reagents to Dnmt3L in the subject's biological samples, a secondary antibody, tools for isolating total RNA from the subject's biological fluid, tools for performing gel electrophoresis, tools for generating cDNA from the isolated total RNA, tools for performing hybridization assays, and tools for performing PCR.

[0046] The kit may optionally include a set of printed or electronic instructions (e.g., disk or CD) containing information about the kit components and / or how to perform various assays (e.g., Dnmt3L levels, comparison with control standards, etc.). The kit may also be commercially available as part of a larger package that includes instruments for the determination of other biochemical components.

[0047] A second aspect of the present invention provides a pharmaceutical composition for treating heart failure.

[0048] Furthermore, the pharmaceutical composition includes an inhibitor of Dnmt3L.

[0049] Furthermore, the pharmaceutical composition also includes other medications for treating heart failure.

[0050] Furthermore, the other medications for treating heart failure include one or more of diuretics, beta-blockers, and neurohormone antagonists.

[0051] Furthermore, the pharmaceutical composition also includes a pharmaceutically compatible carrier.

[0052] In this invention, pharmaceutical compatibility refers to a non-toxic material that does not interact with the active component of the pharmaceutical composition. The pharmaceutically compatible carrier refers to a natural or synthetic, organic or inorganic component that, when used in combination with the active component, facilitates application. According to this invention, the pharmaceutically compatible carrier comprises one or more compatible solid or liquid fillers, diluents, or encapsulating substances suitable for administration to a patient. The components of the pharmaceutical compositions of this invention generally do not exhibit interactions that significantly affect the desired therapeutic effect.

[0053] In this invention, the pharmaceutical composition further includes a buffer, which includes, but is not limited to, acetate, citrate, borate and phosphate.

[0054] The pharmaceutical compositions are typically provided in a homogeneous dosage form and can be prepared by known methods. The pharmaceutical compositions of the present invention may be in the form of, for example, capsules, tablets, lozenges, solutions, suspensions, syrups, elixirs, or emulsions.

[0055] A third aspect of this invention provides a method for constructing an animal model of heart failure.

[0056] Furthermore, the construction method includes mating Dnmt3L overexpressing animals with Myh6-Cre animals to obtain a heart failure animal model.

[0057] Furthermore, the construction method also includes the step of animal genotype identification.

[0058] Furthermore, the animal genotype was identified using PCR.

[0059] Furthermore, the primer sequences used for genotyping of the heart failure animal model are shown in SEQ ID NO.2-5.

[0060] Furthermore, the method for constructing the Dnmt3L overexpressing animal includes: introducing Cas9-mRNA, donor vector and gRNA sequence shown in SEQ ID NO.1 into the fertilized egg of an animal, transplanting the fertilized egg into the oviduct of a surrogate recipient animal, and having the surrogate recipient animal give birth to obtain the Dnmt3L overexpressing animal.

[0061] In this invention, gRNA, also known as sgRNA, refers to small guide RNA (sgRNA), which is a post-transcriptional modification process called RNA editing in the body. gRNA is a small non-coding RNA that can pair with pre-mRNA and insert uracil to produce functional mRNA. The RNA molecule edited by guide RNA is approximately 60–80 nucleotides in length, transcribed from a single gene, has a 3' oligo-U tail, a sequence in the middle that is precisely complementary to the edited mRNA, and an anchoring sequence at the 5' end that is complementary to the unedited mRNA sequence.

[0062] Furthermore, the donor vector includes a gene sequence carrying Dnmt3L.

[0063] Furthermore, the donor vector contains the expression cassette “CAG promoter-loxP-3*SV40 pA-loxP-Kozak-MouseDnmt3L CDS-rBG pA”.

[0064] Furthermore, the methods for introduction include electroporation, calcium phosphate method, liposome method, DEAE dextran method, microinjection, viral infection, or liposome transfection.

[0065] Furthermore, the vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, poxviruses, baculoviruses, papillomaviruses, papillomaviruses, bacteriophages, and plasmids.

[0066] Furthermore, the animal in question is a mammal.

[0067] Furthermore, the mammals include rodents, carnivores, chiropterans, hedgehogs, and insectivores.

[0068] Furthermore, the mammal is selected from rodents.

[0069] Furthermore, the rodents include those belonging to the families Cricetidae, Cricetidae, Muridae, Falconidae, Spineridae, Moleidae, Echidnae, and Rockrats.

[0070] Furthermore, the rodent is selected from the Muridae family.

[0071] Furthermore, the rodent is selected from mice.

[0072] The fourth aspect of the present invention provides an animal model of heart failure obtained by the construction method described in the third aspect of the present invention.

[0073] The fifth aspect of the present invention provides a method according to any one of the following:

[0074] (1) A method for screening candidate drugs for treating heart failure, the method comprising contacting a test substance with a system expressing or containing Dnmt3L, detecting the expression level of Dnmt3L in the system, selecting a substance that can reduce the expression level of Dnmt3L as a candidate drug for treating heart failure, or the method comprising administering one or more candidate substances to a heart failure animal model prepared by the construction method described in the third aspect of the present invention.

[0075] (2) A method for inhibiting cardiomyocyte apoptosis in vitro for non-therapeutic purposes, the method comprising administering an inhibitor of Dnmt3L to cardiomyocytes;

[0076] (3) A method for evaluating the therapeutic effect of a drug for treating heart failure, the method comprising administering one or more drugs for treating heart failure to an animal model of heart failure prepared by the construction method described in the third aspect of the present invention.

[0077] Furthermore, the candidate drugs include, but are not limited to, protein analogs, antibodies, DNA, RNA, and small molecule compounds.

[0078] Furthermore, the sources of the small molecule compounds are selected from: newly synthesized or existing databases; wherein existing databases include, but are not limited to, general natural product databases (COCONUT, Super Natural II, NPASS), plant natural product databases (KNApSaCK, CMAUP, TriForC, Alkamid, NPACT DB, BioPhytMol), traditional Chinese medicine natural product databases (TCM@Taiwan, CEMTDD, CHDD, ETCM, TM-MC, TCMID, YaTCM), microbial natural product databases (StreptomeDB, NP Altas, ProCarDB, PAMDB, Lichen Database), marine natural product databases (MNPD, SWMD), natural product databases from different countries and regions (IMPPAT, NeMedPlant, MedPServer, TlPdb, AfroDB, ANPDB, BIOFACQUIM, NUBBEDB), and food natural product databases (FooDB, BitterDB, Phenol-Explorer, PhytoHub, SuperSweet). Databases including: toxic natural product databases (Exposome-Explorer, T3DB, Snake Neurotoxin Database, TPPT), natural product industry catalogs (Greenpharma, AnalytiConDiscovery, InterBioScreen, Indofine Chemical Company, Pi Chemicals Systems\Specs, TargetMol), databases deduplicated using MS data (MoNA, MassBank, METLIN, HMDB, YMDB, ReSpect, GNPS), and databases deduplicated using NMR data (NMRShiftDB, NAPROC-13), etc.

[0079] The sixth aspect of this invention provides the application of the animal model of heart failure prepared by the construction method described in the third aspect of this invention in studying the pathogenesis of heart failure, screening candidate drugs for the treatment of heart failure, and / or evaluating the therapeutic effects of drugs for the treatment of heart failure.

[0080] Advantages and beneficial effects of the present invention:

[0081] This invention is the first to discover that overexpression of Dnmt3L is an early inducing factor for heart failure. Based on this, this invention provides a method for constructing an animal model of heart failure based on Dnmt3L overexpression. Furthermore, this invention employs a genetic inhibition method, treating cardiomyocytes with a substance that targets and inhibits Dnmt3L expression. Verification has shown that inhibiting Dnmt3L can suppress cardiomyocyte apoptosis. This invention provides new insights into the mechanism research, diagnosis, and treatment of heart failure, and has broad application prospects. Attached Figure Description

[0082] Figure 1 The study demonstrated the successful construction of a heart-specific mouse model overexpressing Dnmt3L; among which... Figure 1 A represents the control group (right figure) mouse genotype (Dnmt3L) in the PCR experiment. CKI / CKI ) and experimental group (left figure) mouse genotype (Dnmt3L) CKI / CKI (Cre), the results showed that the target gene was successfully inserted into the experimental group, confirming the successful construction of the model; Figure 1 B shows that the distribution and expression of Dnmt3L in the heart tissue of the control group and the Dnmt3L overexpression group were detected by immunohistochemistry. The results showed that Dnmt3L was highly expressed only in the heart tissue of the experimental group (Dnmt3L overexpression group) of mice. Figure 1 C represents the change in Dnmt3L protein expression in two groups of fetal heart tissue samples detected by Western blot. The results showed that Dnmt3L was highly expressed in the heart tissue of the Dnmt3L overexpression group.

[0083] Figure 2 The study showed that Dnmt3L overexpression induced a heart failure phenotype; among which... Figure 2 A shows a phenotypic observation of mice; Figure 2 B shows the survival curves of the two groups of mice, with blue representing the control group and red representing the Dnmt3L overexpression group. Figure 2 C represents the echocardiographic score of the heart function in Dnmt3L-overexpressing heart-specific mice;

[0084] Figure 3 The results of histological examination show the pathological effects of Dnmt3L overexpression on myocardial tissue; among which... Figure 3 A represents HE staining analysis of changes in myocardial tissue; Figure 3 B shows representative images of cardiac fibrosis and interstitial fibrosis quantified by Masson staining analysis, comparing the area of ​​interstitial fibrosis in the three groups of mice (n=5 for each group). Figure 3 C represents TUNEL staining to detect cardiomyocyte apoptosis and the apoptosis rate in different groups;

[0085] Figure 4 The study showed the effect of low Dnmt3L expression on H2O2-induced cardiomyocyte apoptosis; among which... Figure 4 A represents the changes in the activity of H9C2 cells after treatment with different concentrations of H2O2 using the CCK8 assay, n=3. Compared with the control group, *P<0.05, **P<0.01; Figure 4 B is Hoechst 33342 staining to observe the apoptosis of H9C2 cells after treatment with different concentrations of H2O2. Red arrows mark apoptotic cells. Scale bar = 100 μm. Figure 4 C represents the results of apoptosis under five different fields of view for statistical analysis. Compared with the control group, **P<0.01, and the values ​​are expressed as mean ± SE. Figure 4 D represents the changes in Dnmt3L protein levels in cardiomyocytes after transfection with different plasmids, as detected by Western blot. Figure 4 E represents the changes in cell viability detected and compared by the CCK8 assay for psilencer3.1, psilencer3.1 + H2O2, and psilencer3.1-Dnmt3L + H2O2, n=3. Compared with the psilencer3.1 group, **P<0.01; compared with the psilencer3.1 + H2O2 group, ##P<0.01. Figure 4 F is Hoechst 33342 staining to observe the apoptosis of psilencer3.1, psilencer3.1+ H2O2 and psilencer3.1-Dnmt3L +H2O2. Red arrows mark apoptotic cells. Scale bar = 100 μm. Figure 4 G represents the results of apoptosis under 5 different fields of view for statistical analysis. Compared with the psilencer3.1 group, **P<0.01, and compared with the psilencer3.1 + H2O2 group, ##P<0.01; values ​​are expressed as mean ± SE. Detailed Implementation

[0086] The present invention will be further described below with reference to embodiments. The following description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make equivalent modifications to the disclosed technical content to create equivalent embodiments. Any simple modifications or equivalent changes made to the following embodiments based on the technical essence of the present invention without departing from the scope of the invention are all within the protection scope of the present invention.

[0087] Unless otherwise specified in the following examples, the conditions should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0088] Example 1: Construction and Identification of Dnmt3L Heart-Specific Mice

[0089] I. Experimental Methods

[0090] Construction principle: Dnmt3L mice (Dnmt3L) were custom-constructed at Cyagen (Suzhou) Biotechnology Co., Ltd. CKI / CKI The C57BL / 6J strain of mice was crossed with the Myh6-Cre mouse strain (C57BL / 6J) to produce heart-specific Dnmt3L overexpression mice. CKI / CKI Myh6-Cre group (strain C57BL / 6J), i.e. heart failure model mouse.

[0091] Specific construction and identification methods:

[0092] CKI / CKI (Mice). F1 generation targeted mice were crossed with mice that specifically expressed Myh6-Cre in the myocardium to obtain heterozygous or homozygous mice that simultaneously carried the targeting allele and the Cre transgene (i.e., heart failure model mice).

[0093] gRNA: CTCCAGTCTTTCTAGAAGATGG (SEQ ID NO.1)

[0094] 1) Identification: High expression of Dnmt3L in the heart tissue of Dnmt3L-specific mice was confirmed by qRT-PCR, immunohistochemistry and Western blot, respectively.

[0095] pcr primers:

[0096] Primers1:

[0097] F1: 5'-CTGACCCCAAAGGAAGAAGAGT-3' (SEQ ID NO.2)

[0098] R1: 5'-CTTTATTAGCCAGAAGTCAGATGC-3' (SEQ ID NO.3)

[0099] Product size: 305 bp

[0100] Primers4:

[0101] Myh6-cre-F: 5'-GAAATGACAGACAGATCCCTCCTATC-3' (SEQ ID NO.4)

[0102] Myh6-cre-R: 5'-CGACGATGAAGCATGTTTAGCTG-3' (SEQ ID NO.5)

[0103] Cre amplicon: 533 bp

[0104] 2) Mouse phenotypic observation: After birth, observe Dnmt3L overexpressing heart-specific mice (Dnmt3L) CKI / CKI Myh6-Cre group) and control group mice (Dnmt3L) CKI / CKI Morphological changes of groups;

[0105] 3) Echocardiography: Detecting changes in cardiac function in mice at different ages;

[0106] 4) HE staining: HE staining is used to detect morphological changes in cardiac tissue;

[0107] 5) TUNEL staining: TUNEL staining is used to detect cardiomyocyte apoptosis;

[0108] 6) Masson staining: Masson staining is used to detect the degree of fibrosis in cardiac tissue;

[0109] 7) Immunohistochemistry: Immunohistochemistry was used to detect the expression of Dnmt3L protein in cardiac tissue.

[0110] II. Experimental Results

[0111] (1) A heart-specific mouse model overexpressing Dnmt3L was successfully constructed and validated.

[0112] To clarify the impact of Dnmt3L overexpression on cardiac function, we collaborated with Cyagen Biosciences to obtain Dnmt3L. CKI / CKI Overexpressing mice were then crossbred and identified with the heart-specific tool mouse Myh6-Cre. First, the mouse genotype was detected by PCR to obtain the Dnmt3L-specific transgenic mouse phenotype (Dnmt3L). CKI / CKI Myh6-Cre mouse) Figure 1 A). Secondly, we used immunohistochemistry to verify the heart-specific expression of Dnmt3L at the tissue level. The immunohistochemical results showed that, compared with the control group, the expression level of Dnmt3L protein in the heart tissue of the experimental group mice was significantly upregulated (A). Figure 1 B). Western blot results further confirmed that Dnmt3L expression was significantly increased in the heart tissue of Dnmt3L transgenic mice. Figure 1 (C) These results demonstrate that we have successfully obtained a heart-specific mouse model with Dnmt3L overexpression, providing an important experimental basis for subsequent research.

[0113] (2) Dnmt3L overexpression induces heart failure phenotype

[0114] To investigate the effects of Dnmt3L overexpression on the heart, we used Dnmt3L-overexpressing heart-specific mice (Dnmt3L... CKI / CKI Myh6-Cre group) and control group mice (Dnmt3L) CKI / CKI Phenotypic observation, echocardiographic functional analysis, and histological examination were performed on the group. Firstly, from a phenotypic perspective, we found that compared to the control group, Dnmt3L heart-specific overexpression mice, with increasing age (around 5-6 months), exhibited heart failure phenotypes such as hunchback, limited mobility, and dyspnea with shortness of breath. Figure 2 A), and they began to die around 6-7 months after birth. Figure 2 B). Meanwhile, echocardiography results showed that the control group (Dnmt3L) CKI / CKIThe cardiac functional data of 1-month-old, 2-month-old, and 6-month-old mice showed little difference, indicating that cardiac function in normal control mice did not differ significantly with age. However, the differences were significant at different time points after Dnmt3L overexpression. Specifically, at 1 month of age, the cardiac function of Dnmt3L-overexpressing mice was basically normal, but by 2 months of age, the ejection fraction (EF%) and left ventricular fractional shortening (FS%) in the Dnmt3L overexpression group began to decrease, indicating impaired cardiac function. By 6 months of age, the EF% and FS% in the Dnmt3L overexpression group decreased significantly, while the left ventricular diameter (LVID,s) increased significantly, especially the FS% which had decreased to below 30%, reflecting severe deterioration of cardiac function and symptoms of heart failure. Figure 2 C and Table 1).

[0115] (3) Histological examination of the pathological effects of Dnmt3L overexpression on myocardial tissue

[0116] HE staining results further confirmed the myocardial pathological changes in the Dnmt3L overexpression group mice. Results are as follows: Figure 3 As shown in Figure A, the myocardial fibers of the control group mice were tightly and regularly arranged without pathological changes; while the Dnmt3L overexpression group mice showed mild ventricular dilation at 2 months of age; by 6 months of age, the pathological changes in the Dnmt3L overexpression group mice were further aggravated, with significant ventricular dilation and disordered myocardial fiber arrangement. Masson staining results showed that, compared with the control group, the Dnmt3L overexpression group mice had mild fibrosis at 2 months of age; by 6 months of age, the fibrosis area had significantly expanded (…). Figure 3 B) suggests that fibrosis may be an important factor in the accelerated cardiac lesions caused by Dnmt3L overexpression. TUNEL apoptosis staining showed that, compared with the control group, cardiomyocyte apoptosis began to occur in the Dnmt3L overexpression group at 2 months of age, and the apoptosis rate was significantly increased and further increased at 6 months of age, suggesting that Dnmt3L overexpression may cause cardiac muscle tissue lesions by promoting cardiomyocyte apoptosis. Figure 3 C).

[0117] Example 2: The therapeutic effect of Dnmt3L on heart failure

[0118] I. Experimental Methods

[0119] 1) Plasmid purchase: psilencer3.1-Dnmt3L-1, psilencer3.1-Dnmt3L-2, psilencer3.1-Dnmt3L-3 and corresponding control plasmids were purchased from UBO Biotechnology Co., Ltd.

[0120] The target sequence corresponding to Dnmt3L is identified as follows:

[0121] sh1: GGAAGAGCAATGGCCGAAATC (SEQ ID NO.6);

[0122] sh2: GCAAGCCCTGTGGAGATATAC (SEQ ID NO.7);

[0123] sh3: GCCCTTCTTCTGGATATTTGT (SEQ ID NO.8);

[0124] 2) Cardiac cell culture and treatment: H9C2 cardiac cells were routinely cultured, subjected to oxidative stress treatment with different concentrations of H2O2, and transfected with Dnmt3L interference plasmid.

[0125] 3) Western blot: Changes in Dnmt3L protein levels were detected by Western blot.

[0126] 4) CCK-8: Detects changes in cardiomyocyte activity using CCK8;

[0127] 5) Hoechst 33342 apoptosis staining: Hoechst 33342 apoptosis staining was used to detect cardiomyocyte apoptosis.

[0128] II. Experimental Results

[0129] Cardiomyocyte apoptosis is a crucial molecular mechanism driving the occurrence and development of heart failure. Oxidative stress can induce cardiomyocyte damage and apoptosis through multiple pathways. Therefore, we established an in vitro cardiomyocyte apoptosis model using H2O2. Gradient concentration experiments revealed that the decrease in cell viability was most stable and reproducible under 300 μM H2O2 treatment. CCK-8 assay results showed that cell survival was significantly reduced under 300 μM H2O2 treatment. Figure 4 A); meanwhile, Hoechst 33342 apoptosis staining analysis further confirmed that the apoptosis rate was significantly increased under this condition ( Figure 4BC). The above results indicate that we successfully constructed a H2O2-induced cardiomyocyte apoptosis model. Based on this model, we investigated whether Dnmt3L expression inhibition could effectively inhibit cardiomyocyte apoptosis. To increase the reliability of the experiment and screen for the most effective plasmid to inhibit Dnmt3L expression, we constructed three different Dnmt3L-targeting interference plasmids psilencerDNA3.I-Dnmt3L (psilencer3.1-Dnmt3L-1, psilencer3.1-Dnmt3L-2, psilencer3.1-Dnmt3L-3) to inhibit Dnmt3L expression. Western blot protein quantification results showed that compared with transfection with the empty psilencer3.1 vector, the psilencer3.1-Dnmt3L-2 transfection group showed the greatest decrease in Dnmt3L protein expression. Figure 4 D). Therefore, in the following experiments, we selected the psilencer3.1-Dnmt3L-2 (hereinafter referred to as psilencer3.1-Dnmt3L) interference plasmid for further research. CCK8 assay results showed that, compared with the control group, the activity of H9C2 cells decreased after the addition of 300 μM H2O2. However, when the psilencer3.1-Dnmt3L interference plasmid was simultaneously transfected, the inhibitory effect of H2O2 on cell activity was significantly counteracted. Figure 4 E). Hoechst33342 apoptosis staining results showed that, compared with the control group, the addition of 300 μM H2O2 significantly increased the number of H9C2 cells undergoing apoptosis. However, the addition of psilencer3.1-Dnmt3L interference plasmid significantly inhibited the induction of H2O2 on H9C2 cells. Figure 4 FG).

[0130] In summary, the above experimental results demonstrate that high expression of Dnmt3L is an inducing factor in the early stages of heart failure, and that inhibiting Dnmt3L expression can significantly inhibit cardiomyocyte apoptosis and thus treat heart failure.

[0131] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.

Claims

1. Application of Dnmt3L inhibitors in the preparation of agents that inhibit H2O2-induced cardiomyocyte apoptosis; The inhibitor is selected from shRNA, and the sequence of the shRNA is shown in SEQ ID NO.

7.

2. A method for constructing a mouse model of heart failure, characterized in that, The construction method includes mating Dnmt3L overexpressing mice with Myh6-Cre mice to obtain a heart failure mouse model; The method for constructing Dnmt3L overexpressing mice includes: introducing Cas9-mRNA, donor vector and gRNA sequence shown in SEQ ID NO.1 into mouse zygotes, transplanting the zygotes into the fallopian tubes of surrogate recipient mice, and having them born by the surrogate recipient mice to obtain Dnmt3L overexpressing mice; The donor carrier contains "CAG promoter-loxP-3". SV40 pA-loxP-Kozak -Mouse Dnmt3L CDS-rBG pA” expression box.

3. The construction method according to claim 2, characterized in that, The construction method also includes a step of mouse genotype identification.

4. The construction method according to claim 3, characterized in that, The mouse genotype was identified using PCR.

5. The construction method according to claim 4, characterized in that, The primer sequences used for mouse genotyping are shown in SEQ ID NO.2-5.

6. The construction method according to claim 2, characterized in that, The methods for introduction include electroporation, calcium phosphate method, liposome method, DEAE dextran method, microinjection, viral infection, or liposome transfection.

7. The mouse model of heart failure obtained by the construction method according to any one of claims 2-6.

8. A method for inhibiting H2O2-induced cardiomyocyte apoptosis in vitro for non-therapeutic purposes, characterized in that, The method includes administering an inhibitor of Dnmt3L to cardiomyocytes; The inhibitor is selected from shRNA, and the sequence of the shRNA is shown in SEQ ID NO.7.

Images