Application of Kcnh4 in preparation of medicine for treating nerve axon injury related diseases
By interfering with the expression of Kcnh4, Kcnh4 was applied in the preparation of drugs for treating diseases related to nerve axon injury, promoting the growth of DRG and cortical neuron axons, solving the problem of limited axonal regeneration capacity in the central nervous system, and improving the effect of nerve injury repair.
Patent Information
- Application Number
- CN202511404749.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-29
- Publication Date
- 2025-12-12
AI Technical Summary
The axonal regeneration capacity of the central nervous system is extremely limited, making functional recovery difficult after spinal cord injury, brain injury and other diseases.
Kcnh4 is used in the preparation of drugs to treat diseases related to nerve axon injury. By interfering with the expression of Kcnh4, the growth of DRG and cortical neuron axons is promoted. Inhibitors such as small molecule compounds, siRNA, shRNA, ASO, CRISPR/Cas9 gene editing systems, or antibodies that specifically bind to and neutralize Kcnh4 protein are used.
It significantly promotes the growth of DRG and cortical neuron axons, enhances neuronal regeneration capacity, and provides an important molecular target for nerve injury repair.
Smart Images

Figure CN121102483A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biomedical technology, and particularly relates to application of Kcnh4 in preparation of a medicament for treating a disease related to nerve axon injury. BACKGROUND
[0002] Nerve injury is a functional or structural damage that occurs after the central nervous system (CNS) and peripheral nervous system (PNS) are affected by mechanical, chemical or biological factors, which can lead to severe neurological dysfunction or even permanent disability. The causes of nerve injury are diverse, including trauma, infection, inflammation, immune-mediated diseases, toxins and genetic diseases, etc. In the CNS, nerve injury usually manifests as neuronal death, axon rupture and loss of synaptic function, while the PNS shows stronger regenerative capacity, but its repair process is still limited by various factors. Although significant progress has been made in recent years in the field of nerve repair technology, completely restoring nerve function remains a great challenge, especially in the case of long nerve injury or severe trauma. Therefore, it is crucial to explore key regulatory molecular targets and regulatory mechanisms in nerve injury repair.
[0003] Axon regeneration is an important research direction in the field of neuroscience, which focuses on exploring how neurons restore their axon growth ability after injury and rebuild functional neural connections. Although axons in the PNS (peripheral nervous system) can achieve a certain degree of regeneration after injury, the axon regeneration capacity in the CNS (central nervous system) is extremely limited, which leads to difficulties in functional recovery after diseases such as spinal cord injury and brain injury. SUMMARY
[0004] The purpose of the present application is to solve the problem of extremely limited axon regeneration capacity of the central nervous system in the prior art.
[0005] In order to achieve the above purpose, the present application adopts the following technical solutions:
[0006] The application of Kcnh4 in the preparation of a medicament for treating a disease related to nerve axon injury, wherein the sequence of Kcnh4 is shown as SEQ ID NO: 01.
[0007] Preferably, the disease related to nerve axon injury includes peripheral and central nerve injury.
[0008] Preferably, the growth of DRG and cortical neuron axons is promoted by interfering with the expression of Kcnh4.
[0009] The present application also provides a medicament for treating a disease related to nerve axon injury, wherein the medicament comprises an inhibitor for inhibiting Kcnh4.
[0010] Preferably, the inhibitor is selected from one of a small molecule compound, an siRNA, an shRNA, an ASO, a CRISPR / Cas9 gene editing system, or an antibody that specifically binds to and neutralizes the Kcnh4 protein.
[0011] Preferably, the medicament further comprises a pharmaceutically acceptable carrier, diluent or excipient.
[0012] Preferably, the medicament achieves the purpose of treating nerve axon injury by inhibiting the expression of Kcnh4.
[0013] Compared with the prior art, the present application has the following beneficial effects:
[0014] In the present application, the expression changes of Kcnh4 in the dorsal root ganglion (DRG) tissue of SD rats at different time points after sciatic nerve injury were first detected. Then it was verified that interfering with Kcnh4 in vitro could significantly promote the growth of DRG and cortical neuron axons, indicating that Kcnh4 is an important molecular target for nerve injury repair. BRIEF DESCRIPTION OF DRAWINGS
[0015] Figure 1 The Kcnh4 expression changes in the DRG tissue of adult SD rats at different time points after sciatic nerve injury in an embodiment of the present application.
[0016] Figure 2 The display graph for verifying the effect of interfering with the expression of Kcnh4 on the growth of DRG neuron axons in vitro in an embodiment of the present application, wherein (A) after siRNA transfection of in vitro cultured DRG neurons for 48 hours, resuspension treatment was performed, and the sample was collected after 16 hours. The graph shows the Tuj1 immunofluorescence staining of DRG neurons after siNC, siKcnh4-1 and siKcnh4-2 transfection, and Tuj1 staining is used to observe the length of DRG nerve axons. (B) The statistical analysis result graph of the total length of the newly generated axons of DRG neurons after siNC, siKcnh4-1 and siKcnh4-2 transfection. (C) The statistical analysis result graph of the longest newly generated axons of DRG neurons after siNC, siKcnh4-1 and siKcnh4-2 transfection.
[0017] Figure 3The display graph for verifying the influence of interfering the expression of Kcnh4 on the growth of cortical neuron axon in an embodiment of the present application, wherein (A) after siRNA transfection of the fetal rat cortical neurons cultured in vitro for 48 hours, resuspension treatment was performed, and the sample was collected after 16 hours. The graph shows the Tuj1 immunofluorescence staining of the cortical neurons after siNC, siKcnh4-1 and siKcnh4-2 transfection, and the Tuj1 staining is used to observe the length of the cortical neuron axon. (B) The statistical analysis result graph of the total length of the newly generated axon of the cortical neurons after siNC, siKcnh4-1 and siKcnh4-2 transfection. (C) The statistical analysis result graph of the longest newly generated axon of the cortical neurons after siNC, siKcnh4-1 and siKcnh4-2 transfection. DETAILED DESCRIPTION
[0018] The present application will be further described in detail below in combination with specific examples.
[0019] The application of Kcnh4 in the preparation of a medicament for treating a disease related to nerve axon injury, wherein the sequence of Kcnh4 is shown in SEQ ID NO: 01, and the disease related to nerve axon injury includes peripheral and central nerve injury, and the growth of DRG and cortical neuron axon is promoted by interfering the expression of Kcnh4.
[0020] Based on the above application, the present application further provides a medicament for treating a disease related to nerve axon injury, wherein the medicament achieves the purpose of treating nerve axon injury by inhibiting the expression of Kcnh4.
[0021] The above content will be described in combination with specific examples as follows:
[0022] 1. Experimental materials and sources:
[0023]
[0024] 2. Detection of the expression of Kcnh4:
[0025] In this embodiment, the expression change of Kcnh4 in the dorsal root ganglion (DRG) tissue at different time points (0h, 1h, 3h, 12h, 24h, 4d, 7d) after the sciatic nerve clamp injury of the rat model was detected by qRT-PCR.
[0026] The preparation process of the sciatic nerve clamp injury model of the rat in this embodiment is as follows:
[0027] SD rats were selected for the experiment, 35 in each batch, all adult male rats, body weight range of 180-220 g. The rats were randomly divided into 7 groups, 5 in each group. Before the operation, the rats were first given intraperitoneal anesthesia, and then the fur on the left hind limb was disinfected. The skin was exposed using surgical scissors, and the muscle and basement membrane covering the sciatic nerve were bluntly separated using ophthalmic scissors. The proximal end of the sciatic nerve was clamped using a clamp injury forceps, the clamp injury area was 3 mm wide, and the clamp injury lasted for 30 seconds. After the clamp injury was completed, the sciatic nerve was recovered under the muscle, and finally the wound was sutured.
[0028] The DRG sample RNA extraction and qRT-PCR detection in this embodiment include the following steps:
[0029] DRG sample RNA extraction: After the preparation of the rat sciatic nerve crush model, the L4-L5 DRG tissue of the sciatic nerve crush side at 0 h, 1 h, 3 h, 12 h, 24 h, 4 d and 7 d after the operation was taken; the DRG tissue was placed in a 1.5 mL RNAase-free centrifuge tube, 500 μL Trizol was added, and a tissue homogenizer was used to crush the tissue; after complete crushing, 500 μL Trizol was added, and the tissue was lysed at room temperature for 15 min; 200 μL chloroform was added, vortexed or inverted for 15 s, and placed on ice for 10 min; centrifuged at 12000 rpm and 4°C for 15 min; the supernatant was carefully aspirated into a new 1.5 mL centrifuge tube, avoiding touching the middle layer to prevent protein contamination, and labeled; 500 μL isopropanol was added to the new centrifuge tube, and carefully inverted to mix; centrifuged at 12000 rpm and 4°C for 15 min, and a small amount of white precipitate was visible at the bottom of the tube after centrifugation; discard the supernatant, add 75% ethanol to wash the precipitate, and gently shake to float the precipitate in ethanol; centrifuged at 12000 rpm and 4°C for 15 min; discard the supernatant, dry the ethanol, and add 10 μL of 65°C DEPC water when the precipitate becomes transparent; the spectrophotometer was used to determine the RNA concentration and quality, and if the A260 / A280 value was in the range of 1.8-2.0, it could be used for subsequent experiments.
[0030] qRT-PCR detection: 1 μg of RNA was reverse transcribed to remove genomic DNA; the following mixture was prepared in an RNase-free centrifuge tube: RNase-free ddH2O to 16 μL, 4x gDNA wiper Mix 4 μL, template RNA 1 μg; gently mix with a pipette, incubate at 42°C for 2 minutes; add 5x HiScript III qRT SuperMix 4 μL, mix, centrifuge at low speed; perform reverse transcription reaction, 37°C for 30 minutes, 85°C for 30 seconds, after the reaction is completed, store at 4°C for a short time, store at -20°C for a long time. After the reverse transcription of the cDNA is completed, dilute 10 times and mix, calculate the amount needed, and prepare the mixture tube without cDNA according to the table: 2x AceQ qPCR SYBR Green Master Mix 5 μL, PCR Primer (F+R) (5 μM) 0.8 μL, sterile Milli-Q H2O 3.2 μL, template cDNA 1 μL. The reaction program is set according to the following table:
[0031] Stage1 95℃ 5 minutes,
[0032] Stage2 (40 cycles) 95℃ 30 seconds, 60℃ 30 seconds, 95℃ 15 seconds,
[0033] Stage3 60℃ 1 minute, 95℃ 15 seconds;
[0034] Each reaction sets 3 replicate wells, and in subsequent analysis, data with large errors, abnormal melting curves or amplification curves are removed, and Gapdh is used as an internal reference. 2 -∆∆Ct After processing the original numerical values, Graphpad Prism 8.0 software is used for statistical plotting.
[0035] qRT-PCR primer sequences:
[0036] Kcnh4: Forward (5'-3') CCCGGGACCTAACCTTCAAC
[0037] Reverse (5'-3') GGAGGAACCAAGAGTGTCGG
[0038] Gapdh: Forward (5'-3') GGAGAGTGTTTCCTCGTCCC
[0039] Reverse (5'-3') ATGAAGGGGTCGTTGATGGC
[0040] The results are as follows Figure 1As shown, the expression of Kcnh4 in DRG tissues showed an increasing trend after sciatic nerve injury, with significant differences at 24h, 4d, and 7d.
[0041] 3. Verify the effect of interfering with Kcnh4 expression on axonal growth of DRG neurons in vitro.
[0042] In this embodiment, siRNA interference technology was first used to inhibit target gene expression, and in vitro DRG neuron axonal function was screened. Two specific small interfering RNAs (siKcnh4-1 and siKcnh4-2) were constructed to inhibit target gene expression. Forty-eight hours after siRNA transfection into cultured DRG neurons, resuspension was performed, and immunofluorescence staining was conducted 16 hours later. Figure 2 ).
[0043] The process of culturing DRG neurons includes the following steps:
[0044] Prepare the dissection solution and pour it into a small dish. Add penicillin and streptomycin, then pre-cool on ice. Subsequently, anesthetize three rats intraperitoneally. Using surgical scissors, cut the skin from the tail along the spine towards the head and remove the entire spinal column. Open the lamina starting from the neck, and use microforceps to remove all DRG tissue and place it in the dissection solution. Discard the dissection solution and rinse the tissue twice with PBS. After discarding the PBS, add 2 mL of collagenase, and transfer the tissue and digestion solution to a 5 mL centrifuge tube. Thoroughly mince the tissue with microscissors and place it in a cell culture incubator for 90 minutes of digestion. Centrifuge to discard the collagenase, add 1 mL of trypsin digestion solution, and pipette for 1 minute until the tissue is evenly dispersed. Place in a cell culture incubator for 10 minutes of digestion, removing and pipetting evenly every 5 minutes before returning to the incubator. When the tissue has digested to the point where there are no obvious tissue fragments, add 3 mL of digestion stop solution to the centrifuge tube to terminate digestion. Pipettes the cells for 1 minute, strains through a sieve to remove excess tissue, and collects the cell suspension into a new 5 mL centrifuge tube. Centrifuge and discard the supernatant. Add 4 mL of preheated BSA solution to the centrifuge tube to resuspend the cells, centrifuge at 9000 rpm for 5 minutes, and aspirate any floating cells. Repeat this process once. Finally, add preheated neuronal culture medium, pipette the cells evenly, and seed them into 6-well plates. Mix the cells crosswise and incubate at 37°C with 5% CO2.
[0045] Neuron transfection:
[0046] Prepare the transfection reagent according to the following steps: Take 400 μL of Opti-MEM, add 100 nM siRNA, and then add an equal volume of RNA-iMAX. Incubate on ice for 15 minutes. Add the prepared transfection reagent to the culture system containing DRG neurons (the transfection reagent and DRG neurons are added simultaneously), and add culture medium to 2 mL. Replace with fresh culture medium 12-18 hours after transfection and continue culturing for 36 hours. Subsequently, digest the cells with trypsin, reseed them on small round glass slides, and verify axonal function.
[0047] siRNA sequence:
[0048] Kcnh4-1: GCAACTTTCTTCTGGCCAA
[0049] Kcnh4-2: GTGAAAGCACTGACTTACT
[0050] In vitro neuronal axon growth experiment:
[0051] Discard the cell culture medium and rinse the cells with pre-warmed 1×PBS; discard the 1×PBS and add pre-cooled 4% paraformaldehyde, fix on ice for 20 min; discard the formaldehyde and rinse with 1×PBS, washing 3 times at room temperature, 5 min each time; after washing, discard the PBS and add blocking buffer, 200 μl per well, incubate at room temperature for 40 min; discard the blocking buffer and gently add Anti-β-Tublin III antibody diluted with primary antibody dilution buffer, 200 μL per well, incubate overnight at 4°C; discard the primary antibody and rinse with 1×PBS, washing 3 times at room temperature, 5 min each time; discard the PBS and gently add Alexa fluor 647 goat anti-rabbit diluted with secondary antibody dilution buffer, 200 μL per well, incubate at room temperature for 2 h; discard the secondary antibody and rinse with 1×PBS, washing 3 times at room temperature, 5 min each time. min / time; after cleaning, remove the round glass slide from the hole, place the cell-containing side down on the glass slide with the mounting solution, and store it in a humidified box at 4°C.
[0052] Please see Figure 2 Interference with Kcnh4 expression significantly increased the overall length and longest process length of DRG regenerated axons in vitro, suggesting that Kcnh4 plays an important negative regulatory role in the axon regeneration process of DRG neurons.
[0053] 4. Verify the effect of interfering with Kcnh4 expression on axonal growth of cortical neurons.
[0054] In this embodiment, siRNA interference technology was used to inhibit target gene expression and screen cortical neuron axonal function. Two specific small interfering RNAs (siKcnh4-1 and siKcnh4-2) were constructed to inhibit target gene expression. Forty-eight hours after siRNA transfection into cultured cortical neurons, resuspension was performed, and immunofluorescence staining was conducted 16 hours later. Figure 3 ).
[0055] The process of isolating and culturing cortical neurons specifically includes the following steps:
[0056] Prepare the dissection solution and pour it into a small dish. Add penicillin and streptomycin, then pre-cool on ice. Subsequently, anesthetize pregnant SD mice intraperitoneally, remove the fetal mice, and detach the fetal membranes. Place the fetal mice in the dissection solution, decapitate them, and remove the brain and cortex. Discard the dissection solution and wash the cortical tissue twice with PBS. After discarding the PBS, add 2 mL of 0.25% trypsin for digestion, place in a cell culture incubator for 15 minutes, removing and agitating every 5 minutes before returning to the incubator. When the tissue has digested to the point where no obvious tissue fragments remain, add 3 mL of digestion stop solution to the centrifuge tube to terminate digestion. Pipette for 1 minute, pass through a sieve to filter out excess tissue, and collect the cell suspension into a new 5 mL centrifuge tube. Centrifuge and discard the supernatant. Add 4 mL of pre-warmed BSA solution to the centrifuge tube, resuspend the cells, centrifuge at 9000 rpm for 5 minutes, and discard any floating cells. Repeat this process once. Finally, add preheated neuronal culture medium, pipette the cells evenly, seed them into 6-well plates, mix the cells in a cross pattern, and place them in a 5% CO2, 37°C incubator.
[0057] In this embodiment, the neuronal siRNA transfection and in vitro neuronal axon growth experiments are performed using the same steps as in the embodiments described above.
[0058] Please see Figure 3 Interference with Kcnh4 expression significantly increased the overall length and longest process length of cortical neuron axons, suggesting that Kcnh4 plays an important negative regulatory role in the regeneration of cortical neuron axons.
[0059] In summary, this application investigated the expression changes of Kcnh4 in the dorsal root ganglion (DRG) tissue at different time points after sciatic nerve injury in SD rats through specific embodiments. Furthermore, the embodiments of this invention verified that in vitro interference with Kcnh4 significantly promoted the growth of axons in DRG and cortical neurons, indicating that Kcnh4 is an important molecular target for nerve injury repair.
Claims
1. The application of Kcnh4 in the preparation of drugs for treating diseases related to nerve axon injury, characterized in that: The sequence of Kcnh4 is shown in SEQ ID NO:
01.
2. The application of Kcnh4 according to claim 1 in the preparation of drugs for treating diseases related to nerve axon injury, characterized in that: The nerve axon injury-related diseases include peripheral and central nervous system injuries.
3. The application of Kcnh4 according to claim 2 in the preparation of drugs for treating diseases related to nerve axon injury, characterized in that: It promotes the growth of DRG and cortical neuron axons by interfering with Kcnh4 expression.
4. A drug for treating diseases related to nerve axon injury, characterized in that: The drug contains an inhibitor that inhibits Kcnh4.
5. A medicament for treating nerve axon injury-related diseases according to claim 4, characterized in that: The inhibitor is selected from one of the following: small molecule compounds, siRNA, shRNA, ASO, CRISPR / Cas9 gene editing system, or antibodies that specifically bind to and neutralize the Kcnh4 protein.
6. A medicament for treating nerve axon injury-related diseases according to claim 5, characterized in that: The drug may also include pharmaceutically acceptable carriers, diluents, or excipients.
7. A medicament for treating nerve axon injury-related diseases according to claim 4, characterized in that: The drug achieves its therapeutic effect on nerve axon injury by inhibiting the expression of Kcnh4.