Barley hvnac92 gene and application thereof in improving plant salt tolerance

By cloning and editing the barley HvNAC92 gene, the lack of research on the regulation of barley salt tolerance was addressed, significantly improving the salt tolerance of barley and other crops, and mitigating the impact of soil salinization on barley cultivation.

CN121109429BActive Publication Date: 2026-07-07HUNAN AGRI UNIV +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUNAN AGRI UNIV
Filing Date
2025-10-24
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

There is a lack of research on the regulation of barley salt tolerance in existing technologies, and soil salinization seriously affects barley planting and production, leading to a decline in quality. There is an urgent need to cultivate new barley varieties with strong salt tolerance for brewing.

Method used

We cloned and analyzed the NAC family gene HvNAC92, which responds to salt stress in barley, knocked out the gene using gene editing technology, and used the CRISPR/Cas9 system to improve the salt tolerance of barley, rice, maize and wheat.

Benefits of technology

It significantly enhanced the salt tolerance of barley, reduced the translocation of Na ions to the aboveground parts, increased the absorption of K ions, improved the salt tolerance of plants, and also improved the salt tolerance of other crops.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121109429B_ABST
    Figure CN121109429B_ABST
Patent Text Reader

Abstract

The application discloses a barley HvNAC92 gene and application thereof in improving plant salt tolerance, and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the HvNAC92 gene is shown as SEQ ID NO. 1. The application knocks out the HvNAC92 gene by CRISPR gene editing technology, and successfully obtains a functional loss barley mutant. Research shows that knocking out the gene significantly enhances the salt tolerance of the barley, and the growth and biomass of the mutant under salt stress conditions are significantly better than those of the wild-type barley. Ion content determination results show that knocking out the HvNAC92 gene can reduce the transportation of Na ions from the root system to the above-ground part, and increase the absorption of K ions, thereby improving the salt tolerance of the plant. In addition, by means of the gene editing technology, homologous genes of the HvNAC92 gene in crops such as rice, corn and wheat can be knocked out, so as to improve the salt tolerance of the plants.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the barley HvNAC92 gene and its application in improving plant salt tolerance. Background Technology

[0002] Soil salinization is a significant abiotic stress facing global agricultural productivity. Statistics from the Food and Agriculture Organization of the United Nations (FAO, 2021) show that approximately 424 million hectares of topsoil (0-30 cm) and 833 million hectares of subsoil (30-100 cm) worldwide are affected by salinization to varying degrees, accounting for 4.4% and 8.7% of total arable land, respectively. Human activities such as irrational irrigation, excessive fertilization, and industrial pollution have further accelerated the process of arable land salinization, seriously threatening food security and sustainable agricultural development (Munns and Tester, 2008). Developing salt-tolerant crop varieties is one of the most economical and effective ways to utilize saline-alkali land and increase crop yields.

[0003] Barley (Hordeum vulgare L.), the world's fourth largest cereal crop, serves as a food source, feed ingredient, and brewing ingredient. Its strong resilience makes it a pioneer crop in barren, arid, and saline-alkali regions. With the growth of beer consumption and the development of animal husbandry in my country, the demand for barley will continue to increase. However, soil salinization in my country's barley-growing areas not only affects barley cultivation and production but also leads to a decline in the quality of brewing barley. Therefore, there is an urgent need to develop new salt-tolerant brewing barley varieties.

[0004] Studies have shown that differences in salt tolerance among different species or different genotypes within the same species are often closely related to the transcriptional level and expression patterns of salt tolerance genes (families). Compared to single-function genes, upstream regulators, such as transcription factors, can simultaneously regulate multiple downstream target genes, thereby coordinating various physiological and biochemical processes to cope with salt stress. These genes have also become important candidate genes in plant salt tolerance genetic engineering, with significant application potential (Xiao et al., 2023). Analyzing the expression regulation mechanisms of salt tolerance functional genes has become a core component of research on the molecular mechanisms of plant salt tolerance.

[0005] The NAC family is one of the largest families of transcription factors unique to plants. Its name comes from the initials of the three first-discovered members: NAM (No Apical Meristem), ATAF1 / 2, and CUC2 (Cup-Shaped Cotyledon). This family of proteins contains a highly conserved N-terminal NAC domain (approximately 150 amino acids) responsible for binding DNA and forming dimers, as well as a highly variable C-terminal transcriptional regulatory domain, which determines their functional diversity. NAC transcription factors play a central regulatory role in plant growth and development (such as organogenesis and senescence) and in responding to various biotic and abiotic stresses (such as drought, salinity, and pests and diseases), acting as key "molecular switches" connecting stress signals to downstream gene expression.

[0006] Currently, research on the regulation of salt tolerance by barley NAC family genes is still very limited. Summary of the Invention

[0007] The purpose of this invention is to provide the barley HvNAC92 gene and its application in improving plant salt tolerance, so as to solve the problems existing in the prior art.

[0008] To achieve the above objectives, the present invention provides the following solution:

[0009] One of the technical solutions of the present invention is an HvNAC92 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0010] The second technical solution of the present invention is that the HvNAC92 protein encoded by the HvNAC92 gene has the amino acid sequence shown in SEQ ID NO.2.

[0011] The third technical solution of the present invention is the application of the HvNAC92 gene or the HvNAC92 protein in improving the salt tolerance of plants, wherein the plants include barley, rice, corn and wheat.

[0012] The fourth technical solution of the present invention is the application of the editing vector containing the HvNAC92 gene in improving the salt tolerance of plants, wherein the plants include barley, rice, corn and wheat.

[0013] The fifth technical solution of the present invention is the application of the HvNAC92 gene, HvNAC92 protein, or editing vector containing the HvNAC92 gene in salt-tolerant plant breeding, wherein the plants include barley, rice, corn, and wheat.

[0014] The sixth technical solution of the present invention is a method for improving the salt tolerance of plants, wherein an editing vector for the HvNAC92 gene is introduced into the plant to knock out the HvNAC92 gene, the nucleotide sequence of the HvNAC92 gene is shown in SEQ ID NO.1, and the plants include barley, rice, corn and wheat.

[0015] The seventh technical solution of the present invention is a method for breeding salt-tolerant plants, wherein an editing vector for the HvNAC92 gene is introduced into a plant to knock out the HvNAC92 gene, the nucleotide sequence of which is shown in SEQ ID NO.1, and the plant includes barley, rice, corn and wheat.

[0016] Based on the above technical solution, the present invention has the following technical effects:

[0017] 1. This invention is the first to clone and analyze the NAC family gene HvNAC92 in barley that responds to salt stress, and publishes its nucleotide sequence and amino acid sequence, which is of great significance for elucidating the molecular mechanism of barley salt tolerance regulation and breeding.

[0018] 2. This invention demonstrates through transgenic methods that the HvNAC92 gene is involved in regulating barley salt tolerance. Specifically, knocking out this gene using gene editing technology significantly improved the salt tolerance of barley, indicating that HvNAC92 is a negative regulatory factor.

[0019] 3. In crops such as rice, corn, and wheat, knocking out the homolog of the HvNAC92 gene can improve their salt tolerance. Attached Figure Description

[0020] Figure 1 The diagram shows the HvNAC92 gene clone and gene structure. In the diagram, (A) is an agarose gel electrophoresis image of the PCR fragment of the gene coding region sequence (CDS). In the figure, the first lane M represents the DL2000 DNA Marker, and the second lane L1 represents the HvNAC92 gene CDS sequence fragment; (B) is a schematic diagram of the HvNAC92 gene structure.

[0021] Figure 2 The expression levels of the HvNAC92 gene in the roots and shoots of barley plants under normal (0 mM NaCl) and salt stress (150 mM and 300 mM NaCl) conditions are shown in the figure. Gene expression levels are expressed as FPKM values, and different lowercase letters represent significant differences (p<0.05).

[0022] Figure 3This is a subcellular localization map of the HvNAC92 protein; in the map, GFP: GFP fluorescence; RFP: RFP fluorescence; Bright: bright field image; Merged: overlay image; HvNAC92-GFP: fusion protein of HvNAC92 and GFP; nRFP: nuclear localization marker.

[0023] Figure 4 To verify the transcriptional activation ability of the HvNAC92 protein.

[0024] Figure 5 Phenotypic differences between the HvNAC92 gene knockout mutant and the wild type under salt stress. (A) is a photograph of the plant phenotypes, showing the difference in salt tolerance between the mutant and wild types after 14 days of treatment with 200 mM NaCl at 14 days of seedling age; (B) gene editing type of the HvNAC92 gene knockout mutant; (C) comparison of root and aboveground dry weight between the wild type and mutant under control conditions; (D) comparison of root and aboveground dry weight between the wild type and mutant after salt treatment. In the figures, different lowercase letters represent significant differences (p < 0.05).

[0025] Figure 6 The differences in Na and K ion content between the HvNAC92 gene knockout mutant and the wild type under salt stress are shown. (A) represents Na ion concentration in the roots; (B) represents Na ion concentration in the shoots; (C) represents the total Na ion content of the plant; (D) represents the Na ion translocation rate from the roots to the shoots; (E) represents K ion concentration in the roots; (F) represents K ion concentration in the shoots; (G) represents the K / Na ratio in the roots; and (H) represents the K / Na ratio in the shoots. Detailed Implementation

[0026] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0027] This invention provides an HvNAC92 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0028] This invention also provides the HvNAC92 protein encoded by the HvNAC92 gene, the amino acid sequence of which is shown in SEQ ID NO.2.

[0029] This invention also provides the application of the HvNAC92 gene or the HvNAC92 protein in improving the salt tolerance of plants, including barley, rice, corn and wheat.

[0030] This invention also provides the application of an editing vector containing the HvNAC92 gene in improving salt tolerance in plants, including barley, rice, maize, and wheat.

[0031] This invention also provides the application of the HvNAC92 gene, HvNAC92 protein, or editing vector containing the HvNAC92 gene in salt-tolerant plant breeding, wherein the plants include barley, rice, corn, and wheat.

[0032] This invention also provides a method for improving the salt tolerance of plants by introducing an editing vector of the HvNAC92 gene into the plant to knock out the HvNAC92 gene. The nucleotide sequence of the HvNAC92 gene is shown in SEQ ID NO.1. The plants include barley, rice, corn and wheat.

[0033] This invention also provides a method for breeding salt-tolerant plants, which involves transferring an editing vector of the HvNAC92 gene into a plant to knock out the HvNAC92 gene. The nucleotide sequence of the HvNAC92 gene is shown in SEQ ID NO.1. The plant includes barley, rice, corn, and wheat.

[0034] This invention demonstrates, through subcellular localization and transcriptional activation capability verification experiments, that the protein encoded by the HvNAC92 gene is located in the cell nucleus and possesses transcriptional activation capability. Using CRISPR gene editing technology, the HvNAC92 gene was knocked out, successfully obtaining a barley mutant with loss of function. Studies show that knocking out this gene significantly enhances the salt tolerance of barley, and the mutant exhibits significantly better growth and biomass under salt stress conditions than wild-type barley. Ion content measurements indicate that knocking out the HvNAC92 gene reduces the transport of Na ions from the roots to the aboveground parts and increases the uptake of K ions, thereby improving the plant's salt tolerance. Furthermore, gene editing technology can be used to knock out homologous genes of the HvNAC92 gene in crops such as rice, maize, and wheat to improve the salt tolerance of these plants.

[0035] For obtaining the HvNAC92 gene knockout mutant line of this invention, please contact Dr. Kuang Liuhui of the College of Agriculture, Hunan Agricultural University, at Room 348, Building 3, Yuelushan Laboratory, Furong District, Changsha, Hunan Province, 410128, China.

[0036] Example 1

[0037] Cloning of the coding region (CDS) sequence of the barley HvNAC92 gene.

[0038] (a) Extraction of total RNA

[0039] Total RNA was extracted using an RNA extraction kit (RC411, Novizan, Nanjing). The extraction method was performed according to the kit's instructions, and the specific method is as follows:

[0040] (1) Weigh about 100 mg of barley Golden Promise root tissue, grind it with liquid nitrogen, and immediately add 600 μL Buffer EL. Vortex vigorously for 30 sec to ensure that the sample and lysis buffer are thoroughly mixed. Centrifuge at 12,000 rpm for 5 min and immediately proceed with subsequent operations.

[0041] (2) Take about 500 μL of the supernatant into FastPure gDNA-Filter Columns III, centrifuge at 12,000 rpm for 30 sec, discard FastPure gDNA-Filter Columns III, and collect the filtrate;

[0042] (3) Add 0.5 times the volume of filtrate (about 250 μL) of anhydrous ethanol to the collection tube and shake to mix for 15 seconds;

[0043] (4) Transfer the above mixture to FastPure RNA Columns V, centrifuge at 12,000 rpm for 30 sec, and discard the filtrate;

[0044] (5) Add 700 μL of Buffer RWA to FastPure RNA Columns V, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate;

[0045] (6) Add 500 μL of Buffer RWB to FastPure RNA Columns V, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate;

[0046] (7) Repeat step (6);

[0047] (8) Place the FastPure RNA Columns V back into the collection tube and centrifuge at 12,000 rpm for 2 min;

[0048] (9) Transfer FastPure RNA Columns V to a new RNase-free Collection Tubes 1.5mL centrifuge tube, add 30-100 μL of preheated RNase-free ddH2O at 65℃ to the center of the adsorption column membrane, let stand at room temperature for 5 min, and centrifuge at 12,000 rpm for 1 min.

[0049] (10) Determine the concentration of RNA. The concentration of RNA and the ratios of A260 / 280 and A260 / 230 were determined using a NanoDrop 2000 micro-spectrophotometer.

[0050] (11) Store at -80℃, or use directly for the following reverse transcription experiments.

[0051] (ii) Synthesis of first-strand cDNA

[0052] First-strand cDNA was synthesized using a reverse transcription kit (R412, Novizan, Nanjing). The synthesis method followed the kit instructions.

[0053] (1) Prepare the mixture shown in Table 1 in a 0.2 mL RNase-free centrifuge tube (where the total RNA is obtained from step (I); if the RNA is stored at -80℃, it must be placed on ice to thaw slowly).

[0054] Table 1 Mixture

[0055]

[0056] (2) Gently pipette and mix well, place in a PCR instrument and heat at 65°C for 5 min, then quickly place on ice to cool, and let stand on ice for 2 min to complete the denaturation and annealing reaction;

[0057] (3) Genomic DNA removal: Add 2 μL of 5×gDNA wiper Mix to the centrifuge tubes and mix gently by pipetting. Place the tubes in a PCR instrument at 42℃ for 2 min.

[0058] (4) Prepare the first-strand cDNA synthesis reaction solution according to Table 2;

[0059] Table 2 First-strand cDNA Synthesis Reaction Solution

[0060]

[0061] (5) Gently mix with a pipette: Perform the first-strand cDNA synthesis reaction on the PCR instrument according to the conditions in Table 3;

[0062] Table 3. First-strand cDNA synthesis reaction procedure

[0063]

[0064] (6) The synthesized reverse transcription product cDNA is used for subsequent PCR reactions or stored at -20℃ for later use.

[0065] (III) Obtaining CDS sequences

[0066] The full-length reference cDNA sequence of the barley HvNAC92 gene (HORVU.MOREX.r3.2HG0173400) was obtained from the Ensemble Plant database. Gene-specific primers pMD19-TF (SEQ ID NO.3: ATGGAGCACGGCGAGCAGGA) and pMD19-TR (SEQ ID NO.4: TTAGTAGCCCCACGGCGCGG) were designed, and PCR amplification was performed using the barley cDNA synthesized by reverse transcription in step (II) as a template with a high-fidelity enzyme (P510, Novizan, Nanjing).

[0067] The PCR amplification system is shown in Table 4 below (this system was used for all the double primer PCR reactions performed below).

[0068] Table 4 PCR amplification system

[0069]

[0070] In addition, the PCR reaction program was as follows: 98℃ pre-denaturation for 30 seconds, cycling parameters were 98℃ denaturation for 10 seconds, 58℃ annealing for 5 seconds, 72℃ extension for 20 seconds, for 35 cycles; and 72℃ complete extension for 1 min.

[0071] After the PCR reaction, 1% agarose gel electrophoresis was performed to detect the presence of bands of appropriate size. The results are as follows: Figure 1 As shown in Figure A, the results indicate that sea barley HmSTG2 The CDS strip size is around 1.0 kb, which is in line with expectations.

[0072] The product was then subjected to gel recovery (following the TaKaRa "MiniBEST Agarose Gel DNA Extraction Kit" procedure), vector ligation (4 μL of the gel-recovered product was ligated to the pMD19-T vector, following the instructions of the "pMD19-T Vector Cloning Kit"), transformation (the ligation product was transformed into E. coli competent cells DH5α and cultured upside down at 37°C for 14 h on LB agar plates containing ampicillin; single colonies were picked and cultured in LB liquid medium for 3 h), plasmid DNA was extracted by alkaline lysis, enzyme digestion identification (BamHI and XmaI double enzyme digestion identification), and sequencing (the plasmids that were correctly identified by enzyme digestion were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing).

[0073] After sequencing, sequence alignment was performed using SnapGene software to obtain the CDS sequence of the HvNAC92 gene, as shown in SEQ ID NO.1. The plasmid DNA of the correctly sequenced single clone pMD19-T-HvNAC92 was stored at -20℃ for subsequent functional verification experiments.

[0074]

[0075] Example 2

[0076] Nucleotide sequence annotation and protein amino acid sequence analysis of the barley HvNAC92 gene.

[0077] The cloned HvNAC92 gene CDS is 1053 bp in length. According to annotation information from the Ensembl Plant database, it contains 3 exons and 2 introns, as shown below. Figure 1 As shown in Figure B. The CDS sequence was translated using SnapGene software, revealing that the gene encodes 350 amino acids, with the amino acid sequence shown in SEQ ID NO.2, and a predicted molecular weight of approximately 37.85 kDa. Analysis of the functional and conserved domains of the HvNAC92 protein using the InterProScan database and analysis software revealed that the HvNAC92 protein contains a NAM domain (pfam02365) at positions 14-138 aa, labeled as Noapical meristem (NAM) protein.

[0078] SEQ ID NO.2: MEHGEQEQHAMELPPGFRFHPTDEELITHYLAKKVADARFAALAVSVADLNKCEPWDLPALARMGEKEWYFFCLKDRKYPTGLRTNRATESGYWKATGKDKDILRGKALVGMKKTLVFYTGRAPKGEKSGWVMHEYRLNAKLHAASTSRGSLPGSRAASSSSSKNEWVLCRVF KKSLVGVVSPAPASSAARKSGVGMIEEIGSTVAAVTPLPPLLDMSGSGASFDQAAHVTCFSNNALEAGQFFNPTATDQDQHGLATYSPLASFAQYGGQLHHGVSLSLVQLLESSGYHRGLADDMAPCGNQQQPAACRGEREKLSASQDTGLTSDVNPEISSSLGQKSFDHEPAPWGY*.

[0079] Example 3

[0080] Expression level of barley HvNAC92 gene under salt stress.

[0081] (1) The data used here were downloaded from NCBI, with the retrieval number PRJNA639318. The experimental procedure was as follows: Morex barley seedlings were cultured in 1 / 5 Hoagland nutrient solution (NS10205, Coollab, Beijing) until the three-leaf-one-heart stage. Then, NaCl was added to the nutrient solution at concentrations of 50 mM and 100 mM per day, respectively, to a final concentration of 150 mM and 300 mM NaCl. The control group (Control) did not receive any NaCl. After 4 days of treatment, roots and aboveground tissues were taken to extract RNA according to the method for extracting total RNA in Example 1. After passing the quality inspection, library construction and sequencing were performed.

[0082] (2) The reads obtained from sequencing were processed using the RNA-seq data analysis software HTSeq (https: / / htseq.readthedocs.io / en / ) to obtain the expression level of each gene (expressed as FPKM value, i.e., the number of fragments per kilobase length from a gene in one million fragments); the expression level of HvNAC92 was extracted and a bar chart was plotted. The results showed that the HvNAC92 gene was mainly expressed in the root and was significantly downregulated under salt stress (see...). Figure 2 ).

[0083] Example 4

[0084] To clarify the subcellular localization of the HvNAC92 protein, this invention constructed a transient expression vector, ZL035-HvNAC92-GFP, and transformed it into *Nicotiana benthamiana* for expression. The results showed that HvNAC92 is localized in the cell nucleus (see...). Figure 3 The specific experimental steps are as follows:

[0085] (I) Construction of expression vector and transformation with Agrobacterium

[0086] (1) Specific primers HvNAC92-ZL035-F (SEQ ID NO.5: ctatttacaattacagtcgacATGGAGCACGGCGAGCAG) and HvNAC92-ZL035-R (SEQ ID NO.6: catggatcctctagagtcgacGTAGCCCCACGGCGCGGG) were designed and PCR amplification was performed using pMD19-T-HvNAC92 plasmid as template with Novizan P510 high-fidelity enzyme. After electrophoresis, the PCR purified product of full-length CDS of HvNAC92 (with stop codon removed) was obtained by gel recovery.

[0087] (2) The empty vector ZL035-GFP was digested with SalⅠ restriction enzyme, and the linearized vector was obtained by gel recovery after electrophoresis.

[0088] (3) Homologous recombination reaction was carried out using the Seamless Cloning Kit (C116, Novizan, Nanjing); the reaction solution was prepared according to Table 5.

[0089] Table 5 Homologous Recombination Reaction Solution

[0090]

[0091] (4) Gently mix with a pipette and place in a PCR instrument at 50°C for 5 min; then cool to 4°C or immediately place on ice to cool.

[0092] (5) The recombinant product was transformed into Escherichia coli DH5α and cultured on LB plates containing ampicillin for 12-16 h. The correctly sequenced monoclonal plasmid was then transformed into Agrobacterium strain EHA105.

[0093] (II) Agrobacterium culture and tobacco injection

[0094] The successfully transformed Agrobacterium single clones were cultured overnight in 5 ml LB medium until the OD600 reached 1.0. After collecting the cells, they were resuspended in tobacco transformation buffer to OD600 = 0.8 and incubated at room temperature for 3 hours. An equal volume of Agrobacterium strain containing the tobacco nuclear localization marker (nRFP) was mixed and injected into tobacco leaves. The tobacco transformation buffer was prepared according to Table 6.

[0095] Table 6 Tobacco Conversion Buffer Formulation

[0096]

[0097] (III) Fluorescence microscopy observation

[0098] Tobacco was cultured in an incubator for 48 hours after injection, and then fluorescence signals were captured using a laser confocal microscope (Zeiss LSM 980). GFP fluorescence (GFP), RFP fluorescence (RFP), bright-field images, and merged images were obtained. The results showed that the HvNAC92 signal completely overlapped with the nuclear marker signal, indicating that the protein is localized in the nucleus (see...). Figure 3 ).

[0099] Example 5

[0100] The transcriptional activation capacity of the HvNAC92 protein was confirmed using auxotrophic yeast strains.

[0101] The specific steps are as follows:

[0102] (I) Construction of expression vectors and yeast transformation

[0103] (1) Using pMD19-T-HvNAC92 plasmid as a template, PCR amplification was performed using Novizan P510 high-fidelity enzyme. The primers used were HvNAC92-BD-F (SEQ ID NO.7: atggccatggaggccgaattcATGGAGCACGGCGAGCAG) and HvNAC92-BD-R (SEQ ID NO.8: tcgacggatccccgggaattcTTAGTAGCCCCACGGCGC). The PCR purified product was obtained by gel recovery after electrophoresis.

[0104] (2) The pGBKT7 empty vector plasmid was digested with EcoRI restriction enzyme and the linearized vector was obtained by gel recovery after electrophoresis.

[0105] (3) Homologous recombination reaction was carried out using a seamless cloning kit (C116, Novizan, Nanjing). The reaction solution was prepared according to Table 5 in Example 4.

[0106] (4) Gently mix with a pipette and place in a PCR instrument at 50°C for 5 min; then cool to 4°C or immediately place on ice to cool.

[0107] (5) The recombinant product was transformed into Escherichia coli DH5α and cultured on LB plates containing kanamycin for 12-16 h. Single clones were selected and plasmids were extracted using the alkaline lysis method. The plasmids of the correctly sequenced single clones were used to transform yeast.

[0108] (6) The above recombinant plasmid and empty vector plasmid were transformed into histidine (His) deficient expression yeast strain AH109 (CC317, Coolapk, Beijing) using the PEG / LiAc method. The operation steps were performed according to the instructions provided with the kit.

[0109] (II) Growth of recombinant yeast strains on auxotrophic media

[0110] Recombinant yeast and yeast strains transfected with the empty vector were cultured in SD liquid medium (without tryptophan Trp) to OD600 = 0.4. They were then plated on SD solid medium (Coollabo, Beijing) with tryptophan-deficient (-Trp), tryptophan-histidine double deficiency (-Trp / -His), and tryptophan-histidine-adenine triple deficiency (-Trp / -His / -Ade). The plates were then incubated at 30 °C for 3 days before photography. The results showed that the HvNAC92 recombinant yeast and the empty vector grew no differently on tryptophan-deficient plates, while only the HvNAC92 recombinant yeast could grow normally on the double-deficient and triple-deficient media, indicating that the HvNAC92 protein has transcriptional activation capabilities (see...). Figure 4 ).

[0111] Example 6

[0112] This invention uses the barley variety Golden Promise as a case study, and constructs a loss-of-function mutant of the HvNAC92 gene using CRISPR / Cas9 gene editing technology.

[0113] The specific steps are as follows:

[0114] (I) Construction of gene editing vectors

[0115] (1) The pUB-Cas9-TaU6-sgRNA empty vector plasmid was digested with BsaⅠ-HF®v2 restriction enzyme and linearized vector was obtained by gel recovery after electrophoresis.

[0116] (2) Design HvNAC92 gene target-specific primers HvNAC92-sgF (SEQ ID NO.9: cttgCAAGTACCCGACGGGGTTG) and HvNAC92-sgR (SEQ ID NO.10: aaacCAACCCCGTCGGGTACTTG). The single strands of the two primers were dissolved in 0.5×TE buffer and annealed to obtain a double-stranded product with a concentration of 10 pmol / μl. T4PNK (MO201V, NEB) was added and phosphorylated according to the manufacturer's instructions.

[0117] (3) Use T4 DNA ligase to perform the ligation reaction of linearized vector and phosphorylated product of double-stranded primer; prepare the reaction solution according to Table 7.

[0118] Table 7 Homologous Recombination Reaction Solution

[0119]

[0120] (4) Gently mix with a pipette and place in a PCR instrument at 16 °C for overnight reaction.

[0121] (5) The ligation product was transformed into Escherichia coli DH5α and cultured on LB plates containing kanamycin for 16 h. Single clones were selected and plasmids were extracted using the alkaline lysis method. The plasmids of the correctly sequenced single clones were introduced into Agrobacterium strain AGL1 using the freeze-thaw method. Positive single clones were selected for subsequent barley genetic transformation.

[0122] (II) Barley genetic transformation

[0123] (1) Embryo isolation and sterilization: Golden Promise embryos were used as explants for barley genetic transformation. The ears were harvested 2-3 weeks after flowering when the embryo diameter was 1.5-2.0 mm. Immature seeds were separated from the ears, the awns removed, taking care not to damage the seed coat, and placed in 50 ml centrifuge tubes (not exceeding the 35 ml mark). The tubes were surface-sterilized with 70% alcohol for 30 seconds, inverting and shaking occasionally, and then washed three times with sterile water. The seeds were then soaked in 50% (v / v) sodium hypochlorite solution, allowed to stand for 4 minutes, inverted and mixed occasionally for thorough sterilization, and then washed four times with sterile water. On sterile filter paper, the seeds were held with tweezers, ventral groove facing down, and the tips of the tweezers were inserted into the back of the embryo to secure it. On the immature embryo side, a second pair of curved, hooked tweezers was used to peel / tear away the central seed coat from the awned end, leaving the lateral seed coats intact until the immature embryo was visible. Using hooked forceps, gently press along the suture line of the plumule to remove the plumule, hypocotyl, and radicle, leaving only the scutellum (a disc with a central indentation; damage does not affect subsequent differentiation). Remove the scutellum by squeezing or pinching. After separation, place each embryo with its scutellum facing upwards in CI medium, gently pressing to ensure even and thorough contact with the medium. Place 80-100 embryos in each 9 cm culture dish and pre-culture at 24°C in the dark for 1-2 days (the dark culture time can be increased appropriately depending on the embryo differentiation, but should preferably not exceed one week).

[0124] (2) Agrobacterium infection and co-culture: 10 μL of Agrobacterium culture was added to 10 ml of sterile MG liquid medium and cultured at 28°C in the dark with shaking at 200 r / min until OD. 600 The concentration should be 1.8–2.0. Use a 100 μl pipette to draw up the bacterial culture and add it to each embryo. Once the bacterial culture completely coats the embryo, immediately aspirate any excess culture. Each plate can infect approximately 30–40 embryos, ensuring that any excess residual culture is removed. After processing one plate of embryos, tilt the plate to allow the culture to completely coat the embryos and to allow them to dry. After processing a maximum of three plates, gently transfer the embryos from the old plate to a new CI plate. Be careful not to remove excess culture medium; gently drag the embryos to remove any old medium. Seal the plate with sealing film and co-incubate at 24 °C for 2–3 days (depending on embryo quality and Agrobacterium growth).

[0125] (3) Selection Culture: After 3 days of co-culture, the embryos are transferred to fresh CI selection medium (CIS) and cultured in the dark at 23-24℃. Fresh CIS plates are replaced every 2 weeks, transferring the embryos and callus together. After 5-6 weeks of selection culture on CIS (depending on the embryonic development), the callus is transferred to transfer medium (T) with the appropriate antibiotics added (50 mg / L hygromycin and 160 mg / L terbinafine). Cultured at 24℃ under low light for 2-4 weeks. A thin sheet of paper (A4 printing paper) can be used to cover the medium. Green spots will appear at this time.

[0126] (4) Transgenic plant regeneration and rooting culture: The plants were then subcultured in B13M medium for 2-6 weeks (the B13M medium needed to be replaced after about 4 weeks of culture, as the seedlings were already quite large at this point). The seedlings were carefully inserted into the medium, with the surface layer broken with tweezers, keeping them upright and avoiding direct contact between the leaves and the medium to prevent vigorous growth from causing the roots to detach and dry out. Generally, 1-2 replacements were sufficient to obtain enough seedlings). When the above-ground leaves reached 2-3 cm, the seedlings were transferred to rooting medium R, with each 10 ml culture tube containing 2-3 ml of R medium. Once the root system began to develop and became strong, the T0 generation transgenic seedlings were obtained.

[0127] (5) The above-mentioned culture medium formulas for barley tissue culture and transformation are shown in Table 8.

[0128] Table 8. Culture medium formulations for barley tissue culture and genetic transformation

[0129]

[0130] (III) Identification of mutant plants

[0131] (1) DNA extraction and PCR amplification

[0132] Place two 3 mm grinding beads in a 2 mL centrifuge tube. Take approximately 50 mg of tender leaves from T0 generation seedlings, cut them into small pieces, and place them in the tube. Grind the sample using a grinder at 40 Hz for 60 s, twice. After grinding, add 400 μL of Edwards buffer (200 mM Tris-HCl pH 7.5, 250 mM NaCl, 25 mM EDTA, and 0.5% SDS); incubate at 65 °C for 10 min (or in an oven at 65 °C for 15 min), inverting the tube every 5 min to mix; centrifuge at 13,000 rpm for 5 min. Transfer 200 μL of the supernatant to a new 1.5 mL centrifuge tube, avoiding precipitate; add an equal volume of 200 μL of isopropanol, invert to mix, and incubate at -20 °C for 10 min; centrifuge at 13,000 rpm for 5 min. Discard the supernatant and air dry it in a clean bench; add 60-100 μL ddH2O, vortex to dissolve the DNA, and store at 4℃ for later use.

[0133] Using the extracted T0 generation seedling DNA as a template, PCR amplification of the target region sequence was performed using primers HvNAC92sg-seq-F (SEQ ID NO.11: TTCTCTGAATCTCCTGCCTAGC) and HvNAC92sg-seq-R (SEQ ID NO.12: GATCGATCACAAGCAAGATGCC). The PCR products were recovered by gel extraction for subsequent sequencing analysis.

[0134] (2) Mutant sequencing identification

[0135] In the constructed mutants, this invention selected two homozygous mutant lines: Hvnac92-1 and Hvnac92-2. Sequencing analysis revealed that Hvnac92-1 inserted two T bases at the target site in the HvNAC92 gene, while Hvnac92-2 inserted one T base. Figure 5 Both mutations (B) resulted in frameshift mutations, indicating that both lines were functional knockout mutants.

[0136] Example 7

[0137] In order to identify the salt tolerance of HvNAC92 gene knockout mutant plants, the T0 generation mutants obtained by the invention were first propagated for two consecutive generations in a growth chamber. The daily photoperiod and culture temperature in the growth chamber were set to 14 h of light (23℃) followed by 10 h of darkness (19℃). The salt tolerance of the barley mutant lines was evaluated in the T2 generation.

[0138] (1) Barley seed germination and pre-culture

[0139] Seeds of the same size and plumpness as the mutant strain and wild type were selected, sterilized with 3% hydrogen peroxide for 30 min, and soaked at 25℃ for 2 h. They were then transferred to moist filter paper and cultured in the dark at 25℃ until the sprouts reached 3-4 cm in length. The sprouts were then transferred to 1 / 5 Hoagland nutrient solution (NS10205, Coollabo, Beijing) for incubation under light. The incubator's daily photoperiod and temperature were set to 14 h of light (23℃) followed by 10 h of darkness (19℃), with the nutrient solution changed every three days.

[0140] (2) Growth of mutant and wild-type barley seedlings under normal conditions and salt stress treatment

[0141] After the seedlings reached the three-leaf-one-heart stage, NaCl was added to the nutrient solution at a concentration increasing by 100 mM daily until a final concentration of 200 mM NaCl was reached. The control group (Control) received no NaCl. After 14 days of treatment, photographs were taken and samples were collected to measure the dry weight of roots and aboveground parts. Results showed that under normal conditions, there was no significant difference in growth and dry weight between the HvNAC92 knockout mutant and the wild type. Under the 200 mM salt treatment, both mutant lines showed significantly stronger growth than the wild type, and their root and aboveground dry weights were significantly higher (see...). Figure 5 ).

[0142] (3) Na and K content in tissues of mutant and wild-type barley seedlings under salt stress treatment

[0143] The dried root and aerial samples were digested using concentrated nitric acid. The procedure was as follows: the sample was placed at the bottom of a 20 mL digestion tube, 3 mL of concentrated HNO3 was added, and the tube was placed in a constant temperature metal bath (DTU-2CN, TAITEC, Japan). The temperature was first raised to 80℃, and after the sample dissolved to a liquid state, the temperature was raised to 120℃ until the sample was completely dissolved to a liquid state (generally requiring 2-3 hours). The acid was removed by raising the temperature until 1-1.5 mL of liquid remained in the test tube. After cooling, the volume was adjusted to 20 mL with deionized water. Elemental content was determined using inductively coupled plasma mass spectrometry (iCAP-RQ, Thermo Fisher Scientific, USA). The results showed that under 200 mM salt treatment, the Na ion concentration in the aerial parts of the HvNAC92 knockout mutant line and the amount of Na ion transported from the roots to the aerial parts were significantly lower than those of the wild type, while the K ion concentration and K / Na ratio in the roots and aerial parts were significantly higher than those of the wild type (see [link to relevant documentation]). Figure 6 ).

[0144] The results above indicate that knocking out the HvNAC92 gene in barley reduces the transport of Na ions from the roots to the aboveground parts of the plant and the Na ion content in the aboveground parts, while increasing the absorption of K ions, thereby enhancing the plant's salt tolerance.

[0145] In summary, this invention cloned a barley NAC family gene, HvNAC92, that responds to salt stress. For the first time, it was discovered that the HvNAC92 gene is located in the cell nucleus and possesses transcriptional activation capabilities, playing a crucial role in maintaining low Na and high K ion concentrations within the plant to resist external salt stress. Through gene editing technology, homologous genes of the HvNAC92 gene can be knocked out in crops such as rice, corn, and wheat to improve the salt tolerance of these plants, thereby increasing their yield and quality, which has significant economic and social benefits.

[0146] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. The application of the HvNAC92 gene or HvNAC92 protein in improving plant salt tolerance, characterized in that, The plant in question is barley; The nucleotide sequence of the HvNAC92 gene is shown in SEQ ID NO.1; The amino acid sequence of the HvNAC92 protein is shown in SEQ ID NO.2; Knocking out the HvNAC92 gene improves plant salt tolerance; The HvNAC92 gene encodes the HvNAC92 protein.

2. The application of an editing vector containing the HvNAC92 gene in improving plant salt tolerance, characterized in that, The plant in question is barley; The nucleotide sequence of the HvNAC92 gene is shown in SEQ ID NO.1; The HvNAC92 gene was knocked out using an editing vector containing the HvNAC92 gene, thereby improving the salt tolerance of plants.

3. The application of the HvNAC92 gene, HvNAC92 protein, or editing vectors containing the HvNAC92 gene in salt-tolerant plant breeding, characterized in that... The plant in question is barley; The nucleotide sequence of the HvNAC92 gene is shown in SEQ ID NO.1; The amino acid sequence of the HvNAC92 protein is shown in SEQ ID NO.2; Knocking out the HvNAC92 gene improves plant salt tolerance; The HvNAC92 gene encodes the HvNAC92 protein.

4. A method for improving the salt tolerance of plants, characterized in that, An editing vector for the HvNAC92 gene was introduced into a plant to knock out the HvNAC92 gene, the nucleotide sequence of which is shown in SEQ ID NO.1, and the plant is barley.

5. A method for breeding salt-tolerant plants, characterized in that, An editing vector for the HvNAC92 gene was introduced into a plant to knock out the HvNAC92 gene, the nucleotide sequence of which is shown in SEQ ID NO.1, and the plant is barley.