Soybean low temperature transcription factor gene gmbr4 and application thereof

By cloning and overexpressing the soybean GmBZR4 gene in Arabidopsis thaliana, the problem of soybean sensitivity to low temperature stress was solved, and the low temperature tolerance during the seedling and germination stages was improved, providing an effective tool for soybean molecular breeding.

CN121109490BActive Publication Date: 2026-03-24HAINAN UNIVERSITY SANYA NANFAN RESEARCH INSTITUTE +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-12
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Soybeans are sensitive to low-temperature stress, and existing technologies lack clear low-temperature tolerant gene resources and molecular breeding targets, which leads to low-temperature injury affecting soybean yield and quality.

Method used

The GmBZR4 gene in the soybean variety Williams 82 was cloned and validated. The GmBZR4 gene was overexpressed in Arabidopsis thaliana using Agrobacterium-mediated transformation technology to improve its low temperature tolerance during the seedling and germination stages.

Benefits of technology

It significantly improved the low-temperature tolerance of Arabidopsis seedlings and germination stages, provided target gene resources for molecular breeding, and enabled the rapid breeding of new low-temperature tolerant varieties to mitigate the impact of low-temperature damage on crop yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121109490B_ABST
    Figure CN121109490B_ABST
Patent Text Reader

Abstract

The application discloses a soybean low-temperature-resistant transcription factor gene GmBZR4 and application thereof, and belongs to the technical field of plant genetic engineering and molecular breeding. GmBZR4 The nucleotide sequence of the gene is shown as SEQ ID NO. 1. GmBZR4 The application clones a gene in a soybean variety Williams 82, constructs an overexpression vector, and transforms the vector into Arabidopsis thaliana, and through low-temperature-resistant phenotype identification, it is proved that overexpression of the gene can significantly improve the low-temperature-resistant adaptability of Arabidopsis thaliana at the seedling stage and the germination stage. GmBZR4 The survival rate of the unacclimatized overexpression strain after treatment at-8 DEG C is up to 81% (7% for the wild type), and the germination speed is significantly faster than that of the wild type under a low-temperature environment. GmBZR4 The gene provided by the application can be used as a target gene resource and applied to the cultivation of low-temperature-resistant plant varieties, and especially provides key technical support for soybean low-temperature-resistant molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering and molecular breeding technology, and relates to soybean low-temperature tolerance transcription factor genes. GmBZR4 And its applications. Background Technology

[0002] Soybeans Glycine max Soybeans (L.) are a globally important food and economic crop, providing humans with approximately 44% of high-quality protein and 27% of edible oil, holding an irreplaceable position in agricultural production and the food industry. However, soybeans are a typical warm-season crop and are extremely sensitive to low-temperature stress; chilling injury has become a key environmental factor restricting the improvement of soybean yield and quality.

[0003] Studies have shown that low temperatures can significantly reduce the germination rate and germination potential of soybean seeds, inhibit seedling growth and the differentiation of new leaves and shoots. If the average temperature is below 15℃, soybean growth will be significantly slowed down; below 10℃, it can even lead to inhibited flowering and reduced pod formation, ultimately resulting in a yield reduction of 18.2% to 34.8%. Among these, soybeans are most sensitive to low temperatures in the early germination and seedling stages, and low temperature stress at this stage often has irreversible effects on the entire growth period.

[0004] Transcription factors are key regulators of gene expression. They can regulate plant responses to abiotic stresses by upregulating or downregulating the expression of downstream target genes by recognizing specific cis-acting elements in gene promoters.

[0005] The inventors cloned the product from the soybean variety Williams 82. GmBZR4 Genes, through homology comparison, were found in soybeans GmBZR4 Genes and genes regulating plant frost resistance in Arabidopsis AtBZR1 Both belong to the BZR family of transcription factors and share high homology. However, in soybean, there have been no clear research reports or functional verifications previously. GmBZR4 Whether genes have the function of regulating frost resistance in plants remains unknown. The vast genetic and physiological differences between species lead to a high degree of uncertainty regarding the function of homologous genes. The function of a gene in the model plant Arabidopsis thaliana may not be directly extrapolated to complex economic crops like soybean. Furthermore, the functions of genes in different plants... BZR4 Their functions are not entirely the same. For example: GmBZR4The subfamily gene GmBZL2 accumulates under brassinosteroid (BRs) treatment, affects the growth and development of plants and increases the number and weight of seeds, playing a key role in the yield of soybean seeds (Zhang, Y., Zhang, Y. J., Yang, B. J., Yu, X. X., Wang, D., Zu, S. H., Xue, H. W., & Lin, W. H. (2016). Functional characterization of GmBZL2 (AtBZR1 like gene) reveals the conserved BR signaling regulation in Glycine max. Scientific reports, 6, 31134. https: / / doi.org / 10.1038 / srep31134; Lu, X., Xiong, Q., Cheng, T., Li, Q. T., Liu, X. L., Bi, Y. D., Li, W., Zhang, W. K., Ma, B., Lai, Y. C., Du, W. G., Man, W. Q., Chen, S. Y., & Zhang, J. S. (2017). A PP2C-1 Allele Underlying a Quantitative Trait Locus Enhances Soybean 100-Seed Weight. Molecular plant, 10(5), 670-684. https: / / doi.org / 10.1016 / j.molp.2017.03.006). OsBZR4The gene positively regulates the degradation ability of rice to the pesticide isoproturon by regulating the expression of downstream metabolic genes, thereby reducing pesticide residues in grains. The gene is also a key regulatory factor for maintaining normal embryonic development in rice. It precisely regulates auxin homeostasis by inhibiting auxin synthesis and transport genes (YUC4 / PIN5b). The loss of function will lead to embryoless seeds (Su XN, Li CY, Liu XS, Zhang YP. Brassinosteroids Confer Resistance to Isoproturon through OsBZR4-Mediated Degradation Genes in Rice (Oryza sativa L.). J Agric Food Chem. 2024 Sep 18;72(37):20646-20657; Wang Z, Xu M, Liu Y, Zheng X, Hong Z, He M, Jin X, Tang J, Li X, Tian X, Qian Q, Bu Q. OsBZR4 regulates temperature-dependent embryogenesis in rice. Nat Commun. 2025 Jul 26;16(1):6893). Therefore, BZR4 Not only has the function of regulating plant frost resistance, but also the function of regulating plant frost resistance BZR4 There is no unique corresponding relationship. Based on this, the person skilled in the art cannot directly associate GmBZR4 The gene with the function of regulating plant frost resistance, further research is needed.

[0006] Meanwhile, the amino acid sequence of the primary structure of a protein is the basis of its spatial structure, and the spatial structure of a protein is the basis of its function. Whether proteins with high homology have similar spatial structures and similar functions mainly depends on the differences of amino acid residues that play a key role in maintaining their spatial structure and function, and whether these differences are sufficient to change their spatial conformation and corresponding biological function and activity. If some or even one key amino acid in the amino acid sequence of a protein changes, it will lead to great changes in the spatial structure and biological activity or function of the protein.A large number of existing literature reports show that a change of one base in a gene can cause a significant change in phenotype (Jiao Y, Wang Y, Xue D, Wang J, Yan M, Liu G, Dong G, Zeng D, Lu Z, Zhu X, Qian Q, Li J. Regulation of OsSPL14 by OsmiR156 defines ideal plant architecture in rice. Nat Genet. 2010 Jun; 42(6): 541-4; Peng LM, Chen XP, Sun J, Guo YJ, Li L, Mo L, Xie W, Li YJ, Yang TL, Li CC. Influence of ALDH2 Glu504Lys polymorphism on nitroglycerin response in chronic heart failure and involvement of Calcitonin Gene Related Peptide (CGRP). Int J Clin Pharmacol Ther. 2012 Oct; 50(10): 701-11; Kobayashi Y, Kuroda K, Kimura K, Southron-Francis JL, Furuzawa A, Kimura K, Iuchi S, Kobayashi M, Taylor GJ, Koyama H. Amino acid polymorphisms in strictly conserved domains of a P-type ATPase HMA5 are involved in the mechanism of copper tolerance variation in Arabidopsis. Plant Physiol. 2008 Oct; 148(2): 969-80).

[0007] In summary, in soybean BZR4 Whether the homologous genes have the function of regulating the frost resistance of plants needs to be researched. SUMMARY

[0008] In view of the problems of lack of low-temperature-resistant gene resources of soybean and lack of clear target in molecular breeding in the prior art, the purpose of the present application is to provide a low-temperature-resistant transcription factor gene of soybean GmBZR4The application discloses a soybean cold tolerance gene, determines its sequence characteristics and function, and discloses its application in cultivating low-temperature-resistant plants, so as to provide an effective tool for soybean low-temperature-resistant molecular breeding.

[0009] To achieve the above object, the application provides the following technical scheme.

[0010] In the first aspect of the application, leaves of soybean variety Williams 82 are used as materials to extract RNA and obtain cDNA by reverse transcription, and a homologous cloning primer is designed by taking the cDNA as a template, so that a gene coding region is obtained by PCR amplification. GmBZR4 The nucleotide sequence of the gene is shown as SEQ ID NO. 1. GmBZR4 The nucleotide sequence of the gene is shown as SEQ ID NO. 1.

[0011] The second aspect of the application provides an application of overexpression of the gene in improving low-temperature tolerance of Arabidopsis seedlings and germination stages. GmBZR4 The function verification process of the gene is as follows. GmBZR4

[0012] (1) Agrobacterium-mediated Arabidopsis transformation: positive Agrobacterium is inoculated into YEB liquid medium containing 50 μg / mL Kan and 25 μg / mL Rif, and is cultured at 28°C and 200 rpm on a shaker until OD600=0.8-1.0; the bacterial body is collected by centrifugation, and is resuspended in an infection liquid containing 5% sucrose, 0.02% Sillwett-77 active agent and 100 μmol / L acetyl-syringone to OD600=0.8; the Arabidopsis inflorescences in the budding stage are immersed in the infection liquid for 20 s, and are cultured in dark for 24 h, and then are cultured under normal light; after 7 days, the infection is repeated once, and the T0 generation seeds are collected and stored at low temperature.

[0013] (2) Positive plant screening: the T1 generation Arabidopsis seeds are screened by 10 mg / L phosphinothricin (PPT), and the surviving seedlings are transplanted, and then are identified by genome PCR using the gene amplification primer to obtain positive overexpression lines. GmBZR4

[0014] (3) Low-temperature-resistant phenotype identification:

[0015] Seedling stage identification: the 14-day-old overexpression lines (OE#1, OE#2, OE#3, OE#9 and OE#11) and wild-type (WT) Arabidopsis are divided into acclimatization groups (4°C acclimatization for 3 days) and non-acclimatization groups, and are treated at-8±1°C for 1 h (acclimatization group) and 0.5 h (non-acclimatization group) respectively, and then are cultured for 3 days to count the survival rates. The results show that the survival rates of the overexpression lines in the acclimatization group are 55%-100% (the WT is 53%), and the survival rates of the overexpression lines in the non-acclimatization group are 31%-81% (the WT is only 7%);

[0016] ​​Germination stage identification: after 4℃ vernalization, the T3 generation overexpression lines and WT Arabidopsis seeds are cultured at 4℃ to observe the germination, and it is found that the overexpression lines germinate earlier than WT, and are closer to full germination.

[0017] The third aspect of the present application provides the GmBZR4 application of the biological material related to the gene, and the application is any one of the following:

[0018] A1) the application in improving the low temperature tolerance of Arabidopsis seedling and germination stage;

[0019] A2) the application in preparing low temperature resistant Arabidopsis;

[0020] The biological material is any one of the following B1) to B3):

[0021] B1) an expression cassette containing a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO. 1;

[0022] B2) a recombinant vector containing a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO. 1;

[0023] B3) a recombinant microorganism containing a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO. 1, or a recombinant microorganism containing the expression cassette of E1, or a recombinant microorganism containing the recombinant vector of E2, and the microorganism is Agrobacterium.

[0024] The fourth aspect of the present application provides a method for cultivating low temperature resistant Arabidopsis, and the method comprises overexpressing the gene in Arabidopsis to obtain low temperature resistant Arabidopsis. GmBZR4

[0025] In the method, the overexpression of the gene in Arabidopsis is to increase the expression amount of the gene in Arabidopsis by transgenic technology. GmBZR4 GmBZR4 In the method, the overexpression of the gene in Arabidopsis is to increase the expression amount of the gene in Arabidopsis by transgenic technology.

[0026] In the method, the overexpression of the gene in Arabidopsis is to increase the expression amount of the gene in Arabidopsis by transgenic technology. GmBZR4

[0027] Advantages of the present application:

[0028] (1) The gene in soybean is first determined and cloned, the nucleotide sequence (SEQ ID) is determined, and the blank of low temperature resistant function research of BZR family gene in soybean is filled; GmBZR4

[0029] (2) After heterologous expression verification, GmBZR4 ​​​​Gene overexpression can significantly improve the low temperature tolerance of Arabidopsis seedlings and germination. Whether under low temperature acclimatization or non-acclimatization conditions, it can greatly improve the survival rate and germination efficiency of plants, proving that it has a clear low temperature tolerance regulation function.

[0030] (3) It provides target gene resources and technical methods that can be directly used for molecular breeding, and uses genetic engineering techniques to... GmBZR4 Gene transfer into crops such as soybeans can rapidly cultivate new low-temperature resistant varieties, effectively mitigating the impact of low-temperature damage on crop yields, and has extremely high agricultural application value. Attached Figure Description

[0031] Figure 1 For T1 generation GmBZR4 Genome identification diagram of transgenic Arabidopsis thaliana: (lanes 1-12 are...) GmBZR4 PCR reaction solution for transfecting T1 generation genomes of different Arabidopsis thaliana lines.

[0032] Figure 2 for GmBZR4 The low-temperature stress phenotype of transgenic Arabidopsis thaliana.

[0033] Figure 3 for GmBZR4 Calculation of survival rate of transgenic Arabidopsis thaliana under low temperature stress.

[0034] Figure 4 for GmBZR4 Low-temperature phenotype during the germination period of transgenic Arabidopsis thaliana.

[0035] Figure 5 for GmBZR4 Germination rate of transgenic Arabidopsis thaliana at 4℃. Detailed Implementation

[0036] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0037] Explanation of the sequence list:

[0038] SEQ ID NO.1:

[0039] ATGACTTCGGACGGAGCAACGTCGGCGGCGACTAACCGGAGGAAGCCGTCTTGGAGGGAGAGGGAGAACAACCGGAGGAGAGAGAGAAGAAGGAGAGCCATTTCGGCGAAGATATACTCCGGTCTTAGGGCGCAAGGGAACTACAATTTGCCCAAACACTGCGACAACAACGAAGTCTTGAAGGCTCTCTGCGCTGAAGCTGGTTGGGCCGTCGAAGAAGACGGCACCACCTATCGCAAGGGATGCAGGGCACCATATCCAGGTGATGGTGTAGGCACCTCCACCAGAAACACTCCTTTCTCATCACAAAATCCAAGTCCTCTTTCGTCGTCATTTCCGAGTCCAATTCCTTCATATCAAGTGAGCCCTTCCTCCTCCTCTTTCCCGAGCCCTTCTCGTTTGGATGCAAACAACCCTTCAAACCTGATTCCATATATTCGGCATGCGTTTCCTGCGTCTGTCCCTCCTTTAAGGATATCAAACAGCGCCCCTGTGACCCCACCCCTGTCCTCGCCAACTTCCAGAAACCCCAAACCAATTCCCACATGGGATTCCATTGCCAAAGCCTCCATGGCATCATCCTTCAACCACAGCCACCATCCTTTCTTTGCGGCTTCAGCACCGGCTAGCCCCACACACCGCCACCTTTATGCCCCACCCACTATTCCGGAGTGTGATGAGTCTGATACCTCCACTGTTGAGTCTGGTCAGTGGCTGAACTTCCAAGCATTTGCCCCTTCTGTTTCTCCTGTGCCTATCTCTCCCACCATGAATTTTATCAAACCTGTTGTGAGTCAGCAGCACAAGCACAACCTCAATCTCCCTGGTAATGGAATCCAAGAGATGAGAATTTCGGAGCCCGAATTTGCGATGCAGGTGAAGCCTTGGGTTGGGGAGAGGATTCATGAAGTGGGATTGGATGATTTGGAACTCACACTTGGAAGTGGGAAGACGCCTGCTTAG

[0040] SEQ ID NO. 2:

[0041] ACACGGGGGACTCTTGACCATGGTAATGACTTCGGACGGAG

[0042] SEQ ID NO.3:

[0043] GTCATCCTTGTAATCACTAGTAGCAGGCGTCTTCCCA

[0044] Example 1 GmBZR4 Functional identification of GmBZR4

[0045] 1.Gene cloning and construction of expression vector of GmBZR4 GmBZR4 The soybean variety Williams 82 leaf was selected as the gene cloning material, and the cDNA was used as the template to clone the GmBZR4 gene coding region (SEQ ID NO. 1). The gene coding region was connected to the overexpression vector pCAMBIA3301, and the homologous cloning primers (NcoI-F: SEQ ID NO. 2 and SpeI-R: SEQ ID NO. 3) were designed. The KOD high-fidelity PCR enzyme (TOYOBO, Shanghai Biotechnology Co., Ltd.) was used for gene amplification, and the PCR reaction system and program were consistent with the product instruction, and the annealing temperature of the gene was 56°C (Table 1).

[0046] Table 1. PCR running program for GmBZR4 gene cloning

[0047]

[0048] The plasmid of the expression vector pCAMBIA3301 was extracted, and the vector plasmid was double digested with endonucleases NcoI and SpeI. The gene amplification product with a linker and the enzyme-digested vector product were connected by homologous recombination, and the recombinant vector was transformed into E. coli DH5α competent cells. The recombinant vector pCAMBIA3301- verified correct by sequencing was transformed into Agrobacterium EHA105 competent cells, and the correct single clone was identified by bacterial liquid PCR for Agrobacterium-mediated Arabidopsis thaliana flower immersion transformation method.

[0049] GmBZR4 2.Heterologous expression of Arabidopsis thaliana

[0050] GmBZR4

[0051] Using Arabidopsis thaliana WT as the recipient, Arabidopsis was transformed using the traditional flower inoculation method. The specific process is as follows: First, the positive Agrobacterium tumefaciens culture was inoculated into 200 mL of YEB liquid medium containing 50 μg / mL Kan and 25 μg / mL LRif for expansion culture. The culture was incubated overnight at 28℃ and 200 rpm with shaking until the OD600 reached 0.8–1.0. The culture was then centrifuged at 5000 rpm for 10 min, and the supernatant was discarded. The bacterial cells were resuspended in Arabidopsis thaliana infection solution, and the OD600 was adjusted to approximately 0.8. (The infection solution consisted of 5% sucrose solution + 0...) 0.02% Sillwett-77 activator + 100 acetylsyrone (As); immerse suitable Arabidopsis thaliana inflorescences that have bolted and flowered in the infection solution for about 20 seconds, during which they can be gently shaken. After infection, culture in the dark for 24 hours, and then transfer to culture under normal light. Repeat the above infection steps after 7 days, for a total of 2 infections; culture normally and collect T0 generation seeds, dry and store at low temperature.

[0052] Glufosinate (PPT) (10 mg / L) was used to screen T1 generation Arabidopsis thaliana seeds from different lines. Surviving seedlings were transplanted, and after the seedlings grew, their genomes were identified by PCR using GmBZR4 gene amplification primers (primer 1). Different lines of GmBZR4-positive overexpressing Arabidopsis thaliana T1 generation were obtained. Figure 1 This can be used for subsequent low-temperature phenotype identification.

[0053] 3. GmBZR4 Identification of low-temperature tolerance phenotypes in Arabidopsis thaliana seedlings expressed heterologously

[0054] For the obtained transfer GmBZR4 Overexpression lines OE#1, OE#2, OE#3, OE#9, and OE#11, along with wild-type Arabidopsis thaliana (WT), were disinfected and vernalized at 4°C for 2 days. They were then seeded on 1 / 2 MS (0.8% agar) medium and cultured at 22°C. When the seedlings reached 14 days old, they were transferred to a 4°C incubator for 3 days of cold acclimation. Subsequently, the cold acclimated group (CA) was treated at -8±1°C for 1 hour, and the non-acclimated group (NA) was treated at -8±1°C for 0.5 hours. After the cold treatment, the Arabidopsis plants were placed in a normal temperature incubator (22°C) for 3 days to recover before low-temperature phenotype imaging. Figure 2The survival rates were statistically analyzed. The results showed that, compared to the control, the survival rates of strains OE#1, OE#2, and OE#3 treated with low temperature for 1 hour were 55%, 88%, and 79%, respectively; the survival rates of OE#9 and OE#11 were 100% and 77%, respectively; and the survival rate of the control strain WT was 53%. The survival rates of strains OE#1, OE#2, and OE#3 treated with low temperature for 0.5 hours were 32%, 81%, and 76%, respectively; the survival rates of OE#9 and OE#11 were 75% and 31%, respectively; and the survival rate of the control strain WT was 7%. Figure 3 The results showed that heterologous expression of GmBZR4 significantly improved the low-temperature tolerance of Arabidopsis thaliana.

[0055] 4. GmBZR4 Identification of low-temperature tolerance phenotype during germination of Arabidopsis thaliana expressed by heterologous expression

[0056] For the obtained transfer GmBZR4 Overexpression T3 generation lines OE#1, OE#6, OE#9, and OE#11 were sterilized with wild-type Arabidopsis thaliana WT, vernalized at 4℃ for 2 days, and then seeded on 1 / 2 MS (0.8% agar) medium and cultured at 4℃. Germination was observed and counted. The results showed that, compared with the control, the overexpression lines germinated earlier and approached full germination more quickly under low-temperature conditions (e.g., ...). Figure 4 , Figure 5 Research results GmBZR4 Heterologous expression significantly improved the low-temperature tolerance of Arabidopsis thaliana during germination.

[0057] In summary, this study preliminarily confirms... GmBZR4 Genes can positively regulate the cold tolerance of Arabidopsis thaliana. The results of this study provide a source of target genes that can be improved for breeding new cold-tolerant plant varieties through molecular breeding methods.

[0058] The present invention has been described in detail above. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0059] The term "protein" is used interchangeably herein to mean a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), wherein the amino acid residues are linked via covalent peptide bonds.

[0060] The term "conversion" refers to the method of introducing a heterologous DNA sequence into a host cell or organism.

[0061] The term "expression" refers to the transcription and / or translation of an endogenous gene or transgene in a plant cell.

[0062] Those skilled in the art will readily understand that the application can be practiced without those specific details which have been given to provide a thorough description of the application. Well-known methods have not been described in order to not unnecessarily obscure the application. The specific embodiments have been chosen for purposes of illustration and example so that others can better understand the application. Other embodiments can be used and / or can be derived from the application, which is intended to be protected not only by the specific embodiments disclosed herein, but by any equivalent means.

Claims

1. Overexpression GmBZR4 The application of genes in improving the cold tolerance of Arabidopsis thaliana is characterized by, GmBZR4 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The optimal periods for improving the low-temperature tolerance of Arabidopsis thaliana are the seedling stage and the germination stage.

3. Overexpression GmBZR4 The application of gene-related biomaterials is characterized by, The application is any one of the following: A1) Application in improving the low-temperature tolerance of Arabidopsis thaliana; A2) Application in the preparation of Arabidopsis thaliana with improved low-temperature resistance; The biomaterial is any one of B1) to B3) below: B1) An expression cassette containing a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO. 1; B2) Recombinant vectors containing nucleic acid molecules with nucleotide sequences as shown in SEQ ID NO. 1; B3) A recombinant microorganism containing a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO. 1, or a recombinant microorganism containing the expression cassette described in B1), or a recombinant microorganism containing the recombinant vector described in B2), wherein the microorganism is Agrobacterium; GmBZR4 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

4. The application according to claim 3, characterized in that, The optimal periods for improving the low-temperature tolerance of Arabidopsis thaliana are the seedling stage and the germination stage.

5. A method for cultivating cold-resistant plants, characterized in that, The method includes overexpression in plants GmBZR4 Genes were used to obtain plants with improved cold resistance, wherein the plant is Arabidopsis thaliana. GmBZR4 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

6. The method according to claim 5, characterized in that, The overexpression in plants GmBZR4 The gene was created using transgenic technology in Arabidopsis thaliana. GmBZR4 Gene expression levels increase.

7. The method according to claim 6, characterized in that, The use of transgenic technology to induce Arabidopsis thaliana GmBZR4 The increase in gene expression was achieved by introducing a plant expression vector that integrates the nucleic acid molecule shown in SEQ ID NO. 1 into the target plant.