Combined immune composition and application thereof in preparation of anti-AEP nano antibody

Abstract

The invention belongs to the technical field of biology, and particularly relates to an immune composition, the immune composition comprises nucleic acid and a delivery vector, the nucleic acid is encapsulated in the delivery vector, the nucleic acid is selected from a recombinant expression vector or mRNA for coding AEP protein, and the recombinant expression vector comprises a DNA fragment for coding AEP protein. The DNA-LNP preparation and the emulsified AEP protein are used for immunizing alpaca, the serum titer of 6.561 * 10 < 6 > can be achieved, and the immune effect is good. The specific combination mode can significantly improve the immune effect, and can be used for antibody library construction or antibody preparation.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a combined immune composition and its application in the preparation of anti-AEP nanobodies. Background Technology

[0002] Asparaginyl endopeptidase (AEP), also known as Legumain, is a cysteine ​​protease that specifically cleaves the asparagine (Asn) site in proteins. It belongs to the cysteine ​​protease family (C13 family) and exerts its catalytic function by relying on the active site of cysteine ​​residues. It is widely involved in protein processing, antigen presentation, and various pathophysiological processes.

[0003] AEP plays a crucial role in a variety of diseases, including cancer, neurodegenerative diseases (such as Alzheimer's disease), and immune-related diseases. Therefore, the development of highly specific antibodies against AEP not only facilitates in-depth research into its functional mechanisms in diseases but also provides an important tool for the diagnosis and treatment of AEP-targeted therapies.

[0004] However, current AEP immunization products exhibit insufficient serum activity and low titers after injection. Santa Cruz has prepared mouse anti-AEP monoclonal antibodies (e.g., Cat#sc-133234) by immunizing mice with human AEP / Legumain peptides; R&D companies have prepared goat anti-AEP polyclonal antibodies (e.g., Cat#AF2199) by immunizing goats with human AEP / Legumain peptides. Whether these immunization methods can induce anti-AEP antibodies in large animals such as alpacas is unknown; furthermore, these products can only serve as research reagents with relatively low antibody specificity requirements. A new AEP immunization product is needed to facilitate the development of highly specific AEP antibodies. Summary of the Invention

[0005] In view of the shortcomings of the prior art described above, the object of the present invention is to provide a combined immune composition and its application in the preparation of anti-AEP nanobodies.

[0006] To achieve the above-mentioned objectives and other related objectives, the present invention adopts the following technical solution:

[0007] A first aspect of the present invention provides an immune composition comprising a nucleic acid and a delivery vector, wherein the nucleic acid is encapsulated in the delivery vector, the nucleic acid being selected from a recombinant expression vector encoding an AEP protein or mRNA, and the recombinant expression vector comprising a DNA fragment encoding an AEP protein.

[0008] AEP plays a role in both neurodegenerative and autoimmune diseases. In the brains of Alzheimer's disease (AD) patients, AEP is abnormally activated, specifically cleaving the Asn368 site of the microtubule-associated protein Tau to generate truncated Tau fragments (such as Tau368). These fragments are more prone to misfolding and aggregation into neurofibrillary tangles (NFTs), disrupting microtubule stability and leading to impaired axonal transport and synaptic function loss in neurons. Tau368 levels are elevated in the cerebrospinal fluid of AD patients and are positively correlated with the degree of cognitive decline. AEP also cleaves the Asn103 site of α-synuclein to generate C-terminal fragments (such as α-syn1-103). These truncated α-synuclein fragments are more prone to aggregation into Lewy bodies, triggering dopaminergic neuronal death and thus Parkinson's disease (PD). Excessive activation of AEP leads to the abnormal release of autoantigens (such as collagen), triggering autoimmune responses such as rheumatoid arthritis (RA). AEP inhibitors can alleviate joint inflammation in RA model mice.

[0009] AEP is highly expressed in various tumors (such as breast cancer and colon cancer), driving tumor progression by promoting extracellular matrix degradation, immune escape, and angiogenesis, and is associated with tumor invasion and patient prognosis. Its main function is to participate in protein cleavage and processing in lysosomes and the tumor microenvironment, regulating processes such as extracellular matrix degradation, immune regulation, and tumor invasion and metastasis. AEP can promote tumor cell invasion and metastasis by degrading extracellular matrix proteins. Through its proteolytic activity, AEP affects the function of tumor-associated macrophages (TAMs) and other immune cells, thereby shaping an immunosuppressive tumor microenvironment. AEP may help tumor cells resist apoptosis by activating certain pro-survival signaling pathways (such as the PI3K / AKT or NF-κB pathway). It is highly expressed in various solid tumors, promoting cancer cell invasion, migration, and metastasis. It is considered a prognostic biomarker and potential therapeutic target for cancer treatment. Abnormal cell proliferation and migration are hallmarks of tumorigenesis and malignancy. Asparagine endopeptidase (AEP) has specific substrate cleavage capabilities and plays an oncogenic role in various cancers.

[0010] AEP cleaves a ubiquitous cytoskeletal regulatory protein, tTmod3-N and tTmod3-C, at the N-terminus of asparagine, enhancing cancer cell migration and proliferation, respectively, indicating that targeted AEP therapy is feasible. AEP is an enzyme that functions in various biological processes, primarily involved in protein degradation and metabolism, promoting tumor cell invasion and metastasis. AEP not only promotes tumor invasion and metastasis by cleaving extracellular matrix proteins such as fibronectin, but also directly regulates the immunosuppressive state of the tumor microenvironment by activating signaling pathways. The tumor microenvironment plays a crucial role in cancer development and progression, leading to a shift in cancer research and targeting methods. AEP promotes tumor growth and metastasis within the tumor microenvironment. Recent research has also found that AEP can cleave the immune checkpoint protein PD-L1, generating soluble PD-L1 fragments, inhibiting T cell activity, and helping tumors evade immune surveillance. AEP has been shown to be highly expressed in human solid tumors such as breast cancer, colon cancer, lung cancer, prostate cancer, ovarian cancer, lymphoma, and melanoma, promoting cancer cell invasion, migration, and metastasis. AEP has been proposed as a prognostic biomarker and therapeutic target for cancer treatment.

[0011] Furthermore, the recombinant expression vector is constructed by inserting a DNA fragment encoding the AEP protein into the multiple cloning site of the expression vector, and the expression vector is selected from one or more of bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, or mammalian cell viruses.

[0012] Optionally, the expression vector in this invention typically refers to various commercially available expression vectors well-known in the art. Optionally, it can be one or more of bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, or mammalian cell viruses. The mammalian cell viruses include adenoviruses or retroviruses. Specific expression vectors that can be used include, but are not limited to: pCMV series vectors such as pCMVp-NEO-BAN, pcDNA3(+) series expression vectors, pEGFP, pSV2, pVAX1, pGL3, pMir, pLenti-CMV expression vectors, etc.

[0013] Optionally, the nucleotide sequence of the DNA fragment encoding the AEP protein is shown in SEQ ID NO: 1;

[0014] Specifically:

[0015]

[0016] Preferably, the recombinant expression vector can be pcDNA3.1-T7-AGG-hLGMN (SEQ ID NO: 2).

[0017] The mRNA encoding the AEP protein can be prepared by in vitro transcription of a DNA fragment encoding the AEP protein.

[0018] Preferably, the delivery carrier is a lipid nanoparticle.

[0019] Lipid nanoparticles (LNPs) are a significant nucleic acid delivery system. Nucleic acid delivery systems are designed to protect active ingredients and guide nucleic acid delivery to specific sites. The crucial role of nucleic acid drugs in disease prevention and treatment is undeniable, but they may suffer from problems such as easy degradation and low transmembrane efficiency. To achieve their purpose, nucleic acids must enter target cells and express sufficient proteins. Therefore, using an efficient delivery system is necessary and crucial. LNP technology is used to deliver nucleic acid molecules such as antisense DNA, siRNA, and mRNA. Onpattro was the first siRNA drug approved by the US FDA, using lipid nanoparticles to encapsulate siRNA and efficiently deliver it to liver cells to exert its effect. LNP is the core delivery technology of Onpattro, used to protect siRNA from degradation in vivo and efficiently deliver it to target cells. Onpattro was the first approved LNP-siRNA drug, marking a successful combination of nucleic acid drugs and lipid nanoparticles. The success of COVID-19 vaccines is also a testament to the success of LNPs as a nucleic acid delivery system.

[0020] Furthermore, the lipid nanoparticles comprise cationic lipids, saturated phospholipids (DSPC), cholesterol, and polyethylene glycol-modified lipids.

[0021] The cationic lipid is an ionizable cationic lipid.

[0022] The combination of nucleic acid and delivery vector in the immune composition described in this invention can also be called LNP-DNA or DNA-LNP, or LNP-mRNA or mRNA-LNP, and its structure is as follows: Figure 1 As shown.

[0023] Ionizable cationic liposomes play a crucial role in cell penetration and release. Cholesterol, due to its hydrophobicity, helps provide rigidity, formulation stability, and supports controlled release. Phospholipids contribute to the overall structural stability of the formulation, as well as stability during production and long-term storage. Polyethylene glycol-modified lipids are another important component of LNPs, possessing multiple functions: 1) preventing nanoparticle aggregation during storage and in the blood; 2) their content thus influencing LNP particle size; 3) prolonging in vivo uptake time; and 4) enabling surface functionalization for coupling with ligands or other molecules. These four lipids interact and work together in LNPs, making them a highly efficient nucleic acid delivery system.

[0024] Preferably, the molar ratio of the four components of LNP is 32-50:10-15.5:22.5-38.5:1-1.5.

[0025] Optionally, the N / P ratio of the cationic lipid to the nucleic acid is (2-6):1. The N / P ratio refers to the ratio of the total number of moles of nitrogen atoms in the cationic lipid to the total number of moles of phosphorus atoms in the nucleic acid.

[0026] A second aspect of the present invention provides the use of the aforementioned immune composition together with other immune enhancers in the preparation of a combined immune composition, wherein the immune enhancers include AEP protein.

[0027] Preferably, the AEP protein is an emulsified AEP protein.

[0028] A third aspect of the present invention provides a combined immune composition comprising the aforementioned immune composition and further comprising an immune enhancer comprising AEP protein.

[0029] The AEP protein may be a human AEP protein or a recombinant AEP protein. The AEP protein's GenBank number is 5461. The AEP protein may be a commercially available product.

[0030] Preferably, the AEP protein is an emulsified AEP protein.

[0031] The emulsified AEP protein can be emulsified by mixing AEP protein with an adjuvant. The adjuvant can be Freund's complete adjuvant and / or Freund's incomplete adjuvant, aluminum adjuvant, MF59, AS03, white oil Span adjuvant, or SA206.

[0032] When using Freund's complete adjuvant and Freund's incomplete adjuvant, the volume ratio of the Freund's complete adjuvant or Freund's incomplete adjuvant to the antigen is 1:1 for emulsification.

[0033] The Freund's incomplete adjuvant comprises mineral oil and an emulsifier, while the Freund's complete adjuvant comprises mineral oil emulsifier and inactivated mycobacteria.

[0034] The mineral oil may be paraffin oil or vegetable oil.

[0035] The emulsifier may be lanolin or Tween 80.

[0036] A fourth aspect of the present invention provides an immunization method for producing animal antibodies, the immunization method comprising the following steps: administering the aforementioned immunization composition or the aforementioned combined immunization composition to a test animal.

[0037] The animals mentioned can be rabbits, mice, rats, sheep, camels, or sharks, etc. Camels can include camels, llamas, or alpacas.

[0038] Animal antibody production immunization methods are mainly used to induce polyclonal antibodies. This refers to a standardized experimental procedure that involves artificially immunizing experimental animals, stimulating their immune systems with antigens to produce specific antibodies, and then collecting peripheral mononuclear cells, extracting mRNA, and cloning antibody genes.

[0039] Antibodies are immunoglobulins produced by B cells in response to antigen stimulation. They specifically recognize and bind to antigens. This unique recognition ability allows antibodies to act against specific foreign substances (antigens). The structure of an antibody consists of paired heavy and light chain polypeptides, with a molecular weight of approximately 150 kDa. The heavy chain (H chain) is about 50 kDa, and the light chain (L chain) is about 25 kDa. These chains are linked by disulfide bonds, forming a tetramer structure resembling the letter "Y".

[0040] like Figure 2 As shown, at the N-terminus of the antibody, both the heavy and light chains have highly variable regions of approximately 110 amino acids, called the variable region (V region). In contrast, the carboxyl terminus (C-terminus) of the antibody is relatively stable with minimal variation; this part is called the constant region (C region). Within the variable regions, both the heavy chain (VH) and light chain (VL) have three regions with highly variable amino acid composition and sequence; these regions are called complementarity-determining regions (CDRs), namely CDR1, CDR2, and CDR3. Regions outside the CDRs are relatively less variable and are called backbone regions (FRs), including FR1, FR2, FR3, and FR4. It is the specific conformation formed in space by these CDR regions that enables the antibody to recognize and bind to antigens, thereby exerting an immune effect.

[0041] Optionally, the immune composition is administered 1-3 times. Specifically, when the aforementioned immune composition is administered, it is administered 1-3 times. When the aforementioned combined immune composition is administered, the immune composition in the combined immune composition is administered 1-3 times.

[0042] Preferably, when the immune composition is administered more than once, the interval between administrations of the immune composition is 2-4 weeks.

[0043] Preferably, when using the aforementioned combined immunization composition for immunization, the immunization composition in the combined immunization composition is applied first, followed by the application of the immune enhancer.

[0044] Optionally, the immune enhancer is administered 1-3 times. Preferably, when the immune enhancer is administered more than once, the interval between administrations is 2-4 weeks.

[0045] Optionally, the amount of the immune enhancer administered is 200-400 μg of antigen protein per dose.

[0046] The dosage of the immune composition is 1-2 mL of DNA-LNP per dose, with a DNA content of 200-400 μg per dose.

[0047] The animal antibody production immunization method is used for non-disease diagnosis and treatment purposes.

[0048] The fifth aspect of the present invention provides the use of the aforementioned immune composition or the aforementioned combined immune composition or the aforementioned animal antibody production immunization method in the preparation of anti-AEP antibodies.

[0049] Preferably, the AEP antibody is a nanobody.

[0050] A class of functional antibodies composed solely of heavy chains has been found in animals such as camels (camels and llamas) and sharks; these are called heavy chain antibodies (HCAbs). These HCAbs lack the first domain of the constant region (CH1). The variable region (VH) of a heavy chain antibody can be cloned to obtain a single variable domain, i.e., a single-domain heavy chain antibody. Single-domain heavy chain antibodies are also known as VHH antibodies, and due to their small molecular weight (approximately 12-15 kDa), they are also called nanobodies.

[0051] like Figure 3As shown, the VHH structure is similar to the heavy chain variable region (VH) of conventional antibodies, with significant sequence differences only in the second frame (FR2) and the third complementarity-determining region (CDR3). The difference between the VHH structure and the conventional antibody's heavy chain variable region (VH) at FR2 lies in amino acid substitutions, specifically the replacement of hydrophobic amino acids with hydrophilic amino acids, such as V37F, G44E, L45R, and W47G. V37F indicates that Val at position 37 of VH is replaced with Phe, G44E indicates that Gly at position 44 of VH is replaced with Glu, L45R indicates that Leu at position 45 of VH is replaced with Arg, and W47G indicates that Trp at position 47 of VH is replaced with Gly. These amino acid substitutions make the VHH's FR2 hydrophilic, enabling it to fold independently and maintain stability in the absence of a light chain. The CDR3 of the VHH antibody is longer than the VH domain of conventional antibodies, and the antigen-binding loop is also larger. The average length of the CDR3 in traditional VH antibodies is 12-14 amino acids, while that of VHH antibodies is 16-18 amino acids. The antigen-binding loop of VHH antibodies can form more novel structures, thus compensating for the lack of antigen-binding sites in VL. VHH antibodies possess specific antigen-binding ability and high affinity with only 3 CDRs, while traditional antibodies require 3 CDRs each for VH and LH to achieve antigen-binding ability.

[0052] Compared with traditional antibodies, nanobodies, although small in molecular weight, retain the complete antigen-binding ability of HCAbs, have simple structure, are easy to prepare and express; they have high stability and strong affinity; they have strong targeting and tissue penetration, and can effectively penetrate tumor tissue and the blood-brain barrier; because the genes encoding them have high homology with the human type III VH domain (VH3), nanobodies have low immunogenicity, are easy to humanize, and have great potential in the diagnosis and treatment of diseases.

[0053] Nanobodies, due to their unique advantages, have been investigated for use in clinical treatment and immunodiagnostics. Caprazizumab was the first FDA-authorized therapeutic VHH for the treatment of acquired thrombocytopenic purpura (aTTP). Ozalizumab and vobarlizumab are two other VHHs currently in clinical trials for rheumatoid arthritis. In recent years, a remarkable number of VHHs have also been developed to combat the SARS-CoV-2 spike protein. Therefore, numerous pharmaceutical companies are currently developing VHH antibodies. AbLynx has developed up to six VHH antibodies at different stages, all of which are bispecific VHH antibodies. VHH antibody production primarily stems from immunization of camel animals: the molecule of interest is injected into the animal, and the resulting VHH clone is then recovered. The specific sequence of the VHH targeting a given antigen must be determined (e.g., using next-generation sequencing), and the optimally appropriate clone needs to be expressed. Different approaches have been developed for this purpose, such as using phage display libraries or even plants. For a specific antigen, extensive experiments may be required to identify VHHs with relevant affinity.

[0054] Compared with the prior art, the combined immune composition of the present invention and its application in the preparation of anti-AEP nanobodies have the following beneficial effects:

[0055] AEP is overexpressed in neurological diseases and many tumors. Through its specific substrate cleavage function, AEP plays a role in neurodegenerative diseases and autoimmune diseases, especially in the carcinogenesis of various tumors. AEP has been shown to be highly expressed in human solid tumors such as breast cancer, colon cancer, lung cancer, prostate cancer, ovarian cancer, lymphoma, and melanoma, promoting cancer cell invasion, migration, and metastasis. Studies have shown that inhibiting AEP expression in tumor cells can effectively inhibit tumor cell migration; therefore, AEP has been proposed as a prognostic biomarker and therapeutic target for cancer treatment. Currently, cancer treatment research is in a critical stage of transition from traditional therapies to precision medicine and immunotherapy. The DNA-LNP preparation and emulsified AEP protein immunized alpaca of this invention can achieve a concentration of 6.561 × 10⁻⁶. 6 The serum titer is high, resulting in good immunization efficacy. This specific combination of methods (vector type, immunization sequence, and booster mode) significantly improves immunization efficacy and reduces the number of immunizations required, and can be used for antibody library construction or antibody preparation. Attached Figure Description

[0056] Figure 1These are the various components of LNP-DNA or LNP-mRNA described in this invention (wherein, non-protonated ionizable liquid refers to unprotonated ionizable lipids, protonated ionizable liquid refers to protonated ionizable lipids, DSPC refers to saturated phospholipids, Cholesterol refers to cholesterol, PEG-lipid refers to polyethylene glycol-modified lipids, and nucleic acid refers to a recombinant expression vector or mRNA encoding AEP protein).

[0057] Figure 2 This is a diagram of the antibody structure.

[0058] Figure 3 This is a comparison diagram of the functional regions of the VH domain of traditional antibodies and the VHH domain of nanobodies.

[0059] Figure 4 This is a schematic diagram of plasmid construction using SnapGene.

[0060] Figure 5 It is a large-scale plasmid extraction band identification.

[0061] Figure 6 It is a DNA-LNP particle size and potential diagram.

[0062] Figure 7 This is an agarose gel electrophoresis image (MK: Maker5000; Lane 1: DNA original plasmid; Lane 2: DNA-LNP);

[0063] Lane 3: DNA-LNP + 10% Triton.

[0064] Figure 8 The expression of AEP protein was verified by Western blotting.

[0065] Figure 9 The diagrams are: A. DNA-LNP 1st particle size and potential diagram; B. DNA-LNP 2nd particle size and potential diagram; C. DNA-LNP 3rd particle size and potential diagram. Figure 10 This is an agarose gel electrophoresis image (MK: Maker5000; Lane 1: DNA original plasmid; Lane 2: DNA-LNP; Lane 3: DNA-LNP + 10% Triton).

[0066] Figure 11 A. 7214hLGMN DNA-LNP secondary immunoimmunoassay serum titer detection; B. 7214hLGMN protein secondary immunoimmunoassay serum titer detection (serum dilution 1000-fold).

[0067] Figure 12This is an agarose gel electrophoresis image of total RNA.

[0068] Figure 13 The first round of nested PCR agarose gel electrophoresis.

[0069] Figure 14 This is the second round of nested PCR agarose gel electrophoresis.

[0070] Figure 15 A. Successful sequence alignment of point mutations at points 411 / 412 and 413 / 414; B. Successful sequence alignment of point mutations at points 367 / 368 and 369 / 370.

[0071] Figure 16 Colony PCR agarose gel electrophoresis images (MK: Maker10000) (A: phage library colony bands constructed using a double enzyme digestion system; B: phage library colony bands constructed using a single enzyme digestion system).

[0072] Figure 17 Amino acid multiple sequence alignment analysis and antibody variable region CDR annotation. Detailed Implementation

[0073] To make the inventive objectives, technical solutions, and beneficial effects of this invention clearer, the invention will be further described in detail below with reference to embodiments. Those skilled in the art can easily understand other advantages and effects of this invention from the content disclosed in this specification.

[0074] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention. Test methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the respective manufacturers.

[0075] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0076] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields.

[0077] Example 1

[0078] 1.1 Main instruments and consumables: The experimental instruments and consumables are shown in Table 1, and the experimental reagents are shown in Table 2.

[0079] Table 1 Experimental Instruments and Consumables

[0080]

[0081]

[0082] Table 2 Experimental Reagents

[0083]

[0084] 1.1.3 Preparation of the main solution

[0085] (1) Liquid LB medium is prepared as shown in Table 3.

[0086]

[0087] Dissolve completely in 400 mL of ultrapure water, then immediately autoclave at 134°C for 30 minutes and place in a clean bench for later use.

[0088] (2) Solid LB medium is prepared as shown in Table 4.

[0089] Dissolve completely in 100mL of ultrapure water, and immediately autoclave at 134℃ for 30min. When the temperature of the solid culture medium drops to about 60-70℃, add the corresponding antibiotic, mix well, and then pour into petri dishes in a clean bench for later use.

[0090] (3) The 50×TAE solution is prepared as shown in Table 5.

[0091]

[0092]

[0093] (4) 20mM sodium citrate buffer

[0094] Weigh 1268 mg of anhydrous citric acid and 1000 mg of sodium citrate dihydrate, add them to 400 mL of ultrapure water, and stir magnetically until dissolved. Adjust the pH to 4.0 with 1 M NaOH, then bring the volume to 500 mL. Filter the solution through a 0.22 μm filter membrane into a 50 mL centrifuge tube for later use.

[0095] (5) The preparation of LNP lipid stock solution is shown in Table 6.

[0096] (6) Preparation of dialysis solution: Weigh 12.11g of solid Tris and 20g of solid NaCl, add 4L of ultrapure water, stir magnetically until dissolved, slowly adjust the pH to 7.8 with hydrochloric acid, and then make up to 5L. Pre-cool in a refrigerator at 4℃ for later use.

[0097] (7) Preparation of 0.05% PBST: Use a pipette (cut off about 0.5cm from the tip with scissors) to slowly pipette 250μL of Tween 20 and add it to 500mL of 1×PBS. Mix well and store at 4℃ for later use.

[0098] (8) Preparation of 4% milk blocking solution: Weigh 0.4g of skim milk and dissolve it in 10mL of PBST.

[0099] (9) The 12% SDS-PAGE separating gel is prepared as shown in Table 7.

[0100] Table 7. Preparation of 12% SDS-PAGE separating gel

[0101] Component names 5mL 10mL 15mL 20mL 25mL 30mL 40mL 50mL <![CDATA[ddH2O]]> 1.6 3.3 4.9 6.6 8.2 9.9 13.2 16.5 30% Acrylamide 2.0 4.0 6.0 8.0 10.0 12.0 16.0 20.0 1.5M Tris-HCl (pH 8.8) 1.3 2.5 3.8 5.0 6.3 7.5 10.0 12.5 10% SDS 0.05 0.1 0.15 0.2 0.25 0.3 0.4 0.5 10% ammonium persulfate 0.05 0.1 0.15 0.2 0.25 0.3 0.4 0.5 TEMED 0.002 0.004 0.006 0.008 0.01 0.012 0.016 0.02

[0102] According to Table 7, which specifies the sample amounts of various components corresponding to different gel volumes for 12% SDS-PAGE separating gels, prepare 12% SDS-PAGE separating gels. Gently mix each component by pipetting 80-100 times. Then, slowly add the separating gel to the fixed gel casting plate, minimizing air bubble formation. Approximately 7.5 mL can be placed on each casting plate. Press the gel with 1 mL of isopropanol and allow it to solidify at room temperature for 30 minutes.

[0103] (10) The preparation of 5% SDS-PAGE stacking gel is shown in Table 8.

[0104] Table 8. Preparation of 5% SDS-PAGE Stacking Gel

[0105]

[0106] Prepare a 5% SDS-PAGE stacking gel according to the sample amounts of various components corresponding to different gel volumes in Table 8. After the separating gel solidifies, discard the top layer of isopropanol, gently rinse the separating gel 2-3 times with ultrapure water, absorb excess water with absorbent paper, gently blow with a pipette about 60 times, add 2-3 mL of stacking gel to the gel casting plate, trying to avoid generating air bubbles, insert the comb horizontally and slowly, and let it stand at room temperature for 1-3 hours. After the SDS-PAGE gel solidifies, remove the glass plate from the gel casting apparatus and store it in a refrigerator at 4°C overnight.

[0107] (11) The preparation of 2YT liquid culture medium is shown in Table 9.

[0108]

[0109] Add 1L of ultrapure water to dissolve completely, then immediately autoclave at 134℃ for 30 minutes.

[0110] (12) The preparation of 2YT solid culture medium is shown in Table 10.

[0111] Add 100mL of ultrapure water to completely dissolve the contents, and immediately autoclave at 134℃ for 30min. When the temperature of the solid culture medium drops to 60-70℃, add the corresponding antibiotic, mix well, and then pour the mixture into petri dishes in a clean bench for later use.

[0112] (13) Preparation of ampicillin sodium (Amp) and kanamycin sulfate (Kan)

[0113] Weigh 100 mg of ampicillin sodium and kanamycin sulfate, and dissolve them in 1 mL of sterile water.

[0114] (14) Preparation of PEG / NaCl: Weigh 100g PEG 6000 and 73g NaCl, add 500mL of ultrapure water and dissolve completely. Autoclave at 134℃ for 30min, and after the temperature drops to room temperature, store in a 4℃ refrigerator for later use.

[0115] 1.2 Experimental Methods

[0116] 1.2.1 Preliminary experiment of DNA-LNP immunization of alpacas: Since the immunization effect of DNA-LNP vaccine on healthy alpacas is unclear, and whether there is any toxicity that may affect the health of alpacas, we first prepared a small dose of pcDNA3.1 T7-AGG-hLGMN-LNP to transfect HeLa cells, and verified whether AEP protein was expressed by Western blotting experiment.

[0117] 1.2.1.1 DNA Preparation

[0118] (1) Plasmid transformation: E. coli DH5α competent cells were removed from a -80℃ freezer and thawed on ice for 5 min. 5 μL of plasmid pcDNA3.1-T7-AGG-hLGMN was added to a 1.5 mL centrifuge tube. 50 μL of the thawed E. coli competent cells were added to the tube, and the mixture was gently tapped at the bottom of the tube to mix. The tube was then placed on ice for at least 10 min, followed by heat shock at 42℃ for 90 s to open the cell membrane. The cells were then immediately removed and placed on ice for 3 min to shrink the cell membrane. 200 μL of antibiotic-free liquid LB medium was added to the 1.5 mL centrifuge tube, and the tube was incubated at 37℃ in a shaker at 250 rpm for 1 h. Place 5-6 sterilized glass beads into a solid LB agar plate containing ampicillin antibiotic. Add 50 μL of transformation product evenly to the glass beads, gently shake to spread the bacterial culture evenly across the entire LB agar plate, discard the glass beads, and invert the plate to incubate overnight at 37°C in a shaker for 12-16 hours. On the second day, observe the solid culture plate. If colonies appear and are round, pick a single colony into 5 mL of liquid LB medium containing 0.1% ampicillin antibiotic, and shake overnight at 250 rpm in a shaker at 37°C. Seal the solid culture medium with sealing film and store at 4°C. On the third day, add 2 mL of the above bacterial culture to 400 mL of liquid LB medium containing 0.1% ampicillin antibiotic, and shake overnight at 250 rpm in a shaker at 37°C. This will be used for subsequent plasmid extraction.

[0119] pcDNA3.1(+) was purchased from Thermo Fisher (Invitrogen).

[0120] The pcDNA3.1-T7-AGG-hLGMN sequence is shown in SEQ ID NO: 2.

[0121]

[0122] Specifically, the "GGG" terminus of the T7 promoter is mutated to "AGG" through a point mutation, and the following sequence is inserted between the NotI and XhoI restriction sites in the MCS region:

[0123] 5'UTR

[0124] (5'-GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCCGGCGCCGCCACC, SEQ IDNO: 3),

[0125] AEP encodes a nucleotide sequence (SEQ ID NO: 1);

[0126] 3'UTR

[0127] (5'-GCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTG CACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGC, SEQ ID NO: 4), poly-A tail (5'-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA, SEQ ID NO: 4) ID NO: 5).

[0128] (2) Plasmid extraction: The endotoxin-free plasmid extraction kit from TIANGEN was used.

[0129] The final plasmid DNA needs to be analyzed for concentration and purity using agarose gel electrophoresis and UV spectrophotometry. High-quality DNA typically has an OD260 / OD280 ratio between 1.8 and 2.0 and can be stored at -20°C.

[0130] 1.2.1.2 Preparation of DNA-LNPs: The LNPs used in this example are stable nanoparticles composed of ionizable cationic lipids, saturated phospholipids, cholesterol and polyethylene glycol-modified lipids, with the molar ratio of the four components being 50:10:38.5:1.5.

[0131] (1) Preparation of the aqueous phase:

[0132] According to the proportions of each component listed in Table 11 for the preparation of the aqueous phase, mix the nucleic acid (DNA) stock solution extracted from the plasmid with 20mM pH 4.0 sodium citrate buffer and let it stand at room temperature for later use.

[0133] Table 11 Preparation of Aqueous Phase

[0134]

[0135] (2) Preparation of the alcohol phase:

[0136] According to the proportions of each component listed in Table 12 for the preparation of the alcohol phase, mix each lipid stock solution and anhydrous ethanol evenly and leave at room temperature for later use.

[0137] Table 12 Preparation of the alcohol phase

[0138]

[0139] (3) The prepared alcohol phase and water phase are mixed in a ratio of 1:3 using the ethanol injection method to prepare DNA-LNP preparation.

[0140] (4) Transfer the mixed LNP to a 10kDa MWCO, 16mm dialysis bag, place it in pre-cooled dialysis solution, and dialyze overnight in a magnetic stirrer at 4°C and 100 rpm.

[0141] (5) Carefully remove the LNP liquid from the dialysis bag and transfer it to a 1.5 mL centrifuge tube. After filtration using a 0.22 μM filter membrane in a biosafety cabinet, the cells can be transfected.

[0142] 1.2.1.3 Transfection of DNA-LNP

[0143] HeLa cells were cultured to a healthy state and then seeded into 4-well cell culture plates at a density of 3.0 × 10⁶ cells per well. 5 HeLa cells were transfected when they reached 80% confluence. pcDNA3.1 T7-AGG-hLGMN-LNP was used to transfect HeLa cells. Two wells in a 4-well plate were transfected with 6 μg of DNA-LNP sequentially, with the remaining two wells serving as controls. After 24 hours of incubation, the culture medium in the 4-well plates was replaced with complete culture medium. Cells were harvested after 6 hours of expression.

[0144] 1.2.1.4 Western Blot experiment to observe the expression of DNA-LNP after transfection

[0145] (1) Preparation of Western Blot samples

[0146] Prepare cell lysis buffer. Take 1 mL of the prepared Lysis buffer (pH 7.4) from the -40°C freezer and thaw it. Add 10 μL each of protease inhibitor (K1007) and phosphatase inhibitor (K1015-A, K1015-B), vortex to mix, and keep on ice for later use.

[0147] Pre-cool the high-speed centrifuge to 4°C; label the 1.5mL centrifuge tubes accordingly; remove the 6-well cell culture plate, add an appropriate amount of trypsin for digestion, observe the complete digestion, add culture medium to stop digestion, collect the cell pellet and place it into the corresponding labeled 1.5mL centrifuge tubes. Resuspend the cell pellet in 1×PBS (sterile), centrifuge at 500rpm for 5min, and discard the supernatant. Add 100μL of prepared cell lysis buffer to each pellet, repeatedly and rapidly pipette the pellet, vortex for 30min, and place it back on ice to cool every 2-3min. The entire process must be performed on ice. Centrifuge at 13200rpm for 15min, resuspend the pellet in 2×loading buffer, store at -40°C, and add 5×loading buffer to the supernatant and mix well for use as a sample for Western blotting.

[0148] Preheat the dry thermostat (metal bath) to 100°C. Place the Western blot sample into the metal bath and denature it at 100°C for 10 minutes. The denatured protein solution will be a clear, transparent blue liquid.

[0149] (2) Western Blot Experiment: Prepare SDS-PAGE gels in advance according to 1.1. Assemble the SDS-PAGE gels in the Western blot electrophoresis system, fill the electrophoresis tank with 1×Running Buffer to soak the gels, and allow them to fully equilibrate for at least 30 minutes. Load 20 μL of sample into each well, and load 4 μL of protein markers, then use 1×Loading Buffer to bring the volume to the same as the sample wells. Electrophoresis at 80V for 30 minutes, observe the protein marker bands and their positions, adjust to 100V, and electrophoresis for 2 hours. Stop electrophoresis when the protein markers are close to the bottom.

[0150] Prepare the PVDF membrane: After cutting the membrane as needed, soak it in methanol for 30 seconds to activate it, and then soak it in ddH2O.

[0151] Transfer: Stack the positive and negative plates in sequence, connect the power supply, and run at 100V for 150 minutes.

[0152] Blocking: After the transfer was completed, wash three times with 1×TBST for 5 minutes each time, and then block with 5% milk blocking solution for 30 minutes.

[0153] Antibody incubation: Remove the sealed PVDF membrane, and seal the PVDF membrane and primary antibody into a bag using a sealing machine with disposable surgical gloves. Incubate overnight at 4°C on a shaker. Remove the PVDF membrane that has been incubated with the primary antibody overnight, and wash it three times with 1×TBST for 5 minutes each time. Incubate with the corresponding secondary antibody for 1 hour. Wash three times with 1×TBST for 5 minutes each time, and then soak in 1×TBST.

[0154] Development: Place the PVDF membrane on a developing plate, add an appropriate amount of ECL luminescent solution, and develop in a developing apparatus. Observe the desired protein bands to determine whether DNA-LNP can immunize healthy alpacas.

[0155] 1.2.2 DNA-LNP Preparation

[0156] (1) Preparation of aqueous phase: According to the proportion of each component listed in Table 13, mix the nucleic acid (DNA) stock solution extracted from plasmids and 20mM pH4.0 sodium citrate buffer evenly and place at room temperature for later use.

[0157] Table 13 Preparation of Aqueous Phase

[0158]

[0159] (2) Preparation of alcohol phase: According to the proportion of each component listed in Table 14, prepare each lipid mother liquor and anhydrous ethanol evenly and set aside for use.

[0160] Table 14 Preparation of the alcohol phase

[0161]

[0162] (3) The prepared alcohol phase and aqueous phase were mixed in a 1:3 ratio using microfluidic technology to prepare DNA-LNP vaccine. A total of three DNA-LNP preparations were carried out, namely DNA-LNP 1st, DNA-LNP 2nd and DNA-LNP 3rd.

[0163] (4) Transfer the mixed LNP to a 10kDa MWCO, 16mm dialysis bag, place it in pre-cooled dialysis solution, and dialyze overnight in a magnetic stirrer at 4°C and 100 rpm.

[0164] (5) Carefully remove the LNP liquid from the dialysis bag, transfer it to a 1.5 mL centrifuge tube, filter it through a 0.22 μM filter membrane, and store it in a 4 °C refrigerator for later use.

[0165] 1.2.3 Preparation of Recombinant Human Legumain Protein

[0166] 200 μg of AEP protein (Recombinant Human Legumain Protein) was emulsified with 1 mL of Freund's complete adjuvant or Freund's incomplete adjuvant (volume ratio 1:1) in an emulsifier. The emulsifier was set to 85 min / rpm for approximately 30 min. A drop of the successfully emulsified protein was dropped into still water, and the emulsification status was observed within 30 seconds.

[0167] 1.2.4 Immunizing alpacas

[0168] Before immunization, 5 mL of blood was collected from healthy, unimmunized alpacas to prepare negative serum, which was stored at -80°C for later use. The prepared DNA-LNP vaccine was administered intramuscularly to unimmunized healthy alpacas at a dose of 1 mL / injection, containing 200 μg of DNA, with an interval of 2 weeks between immunizations, for a total of three immunizations. One week after the second immunization, 5 mL of alpaca blood was collected to prepare serum, and the titer of the serum after the second immunization was determined by ELISA. Similarly, the prepared emulsified protein was injected into alpacas immunized with the DNA-LNP vaccine, with an antigen protein dose of 200 μg / injection, with an interval of 2 weeks between immunizations, for a total of three immunizations. One week after the second and third protein immunizations, 5 mL of alpaca blood was collected to prepare serum, and the titer of the serum after the second and third protein immunizations was determined by ELISA.

[0169] 1.2.5 Serum titer detection after immunization

[0170] (1) Preparation of serum

[0171] After collection, alpaca blood was placed overnight at 4°C. The refrigerated centrifuge was pre-cooled to 4°C, and the pre-cooled alpaca blood was centrifuged at 4000 rpm for 5 minutes. The supernatant, a pale yellow, transparent liquid, was collected into a 1.5 mL centrifuge tube, which is the serum. The prepared serum was stored at -80°C.

[0172] (2) ELISA assay to determine serum titer

[0173] Both immunized and negative sera were serially diluted 3-fold (1:1, 1:3, 1:9…). The titer and immunization level of the immunized serum were determined by comparing the results of immunized serum, negative serum, and serially diluted serum using an ELISA assay. The specific procedure for the ELISA assay was as follows: a. Recombinant Human Legumain Protein was coated onto an ELISA plate at a concentration of 0.5 μg / mL, 100 μL / well, and incubated overnight at 4°C.

[0174] Add 1×PBS to the wells for the negative control;

[0175] b. Wash the plate twice with 250 μL of the prepared 0.05% PBST per well; block the microplate with 4% milk blocking buffer at 37°C for 1 h.

[0176] c. Wash the plate twice with 250 μL of the prepared 0.05% PBST; add 100 μL of negative serum and immune serum diluted with 4% milk blocking buffer to the plate and incubate at 37°C for 1.5 h.

[0177] d. Wash the plate twice with 250 μL of the prepared 0.05% PBST; add 100 μL of the secondary antibody Goat Anti-llama Antibody diluted with 4% milk blocking buffer and react at 37°C for 50 min.

[0178] g. Wash the plate twice with 250 μL of the prepared 0.05% PBST solution per well; add TMB chromogenic solution and incubate at room temperature for 10 min.

[0179] h. After color development is complete, stop the color development with a stop solution and perform detection using an ELISA reader with the absorbance set to OD450.

[0180] 1.2.6 Isolation of peripheral blood cells

[0181] (1) One week after the alpaca is immunized, about 80 mL of blood is collected and diluted 3 times with 160 mL of 1×PBS (enzyme-free) to a final volume of 240 mL.

[0182] (2) Carefully add 14 mL of Ficoll to each 50 mL centrifuge tube, and slowly add 30 mL of diluted blood. Repeat this operation until all the diluted blood is used up.

[0183] (3) Place it in a centrifuge. Centrifuge settings: room temperature, 1800 rpm, 31 min, ↑19, ↓0.

[0184] (4) Aspirate the cloud layer and place it into a new 50mL centrifuge tube. Dilute the cloud layer with 1×PBS (enzyme-free) at a ratio of 1:1.

[0185] (5) Place it in a centrifuge. Centrifuge settings: room temperature, 1800 rpm, 5 min, ↑19, ↓9.

[0186] (6) Discard the supernatant, resuspend the precipitate with 1×PBS, and then place it in a centrifuge. Centrifuge settings: room temperature, 1500 rpm, 3 min, ↑19, ↓9.

[0187] (7) Discard the supernatant, resuspend the precipitate in 40 mL of 1×PBS, take 100 μL, dilute it 10 times, and count it using a hemocytometer.

[0188] (8) 1×10 8 Add 3 mL of Trizol reagent to the isolated peripheral blood cells, mix well and freeze at -80°C. Add RNA to the remaining peripheral blood cells and store at -80°C.

[0189] 1.2.7 Extraction of total RNA

[0190] (1) 1×10⁻⁶ cells frozen one day before thawing 8 Add 200 μL of chloroform to a sample of peripheral blood cells, mix slowly, and let stand at room temperature for 5 minutes.

[0191] (2) Place it in a centrifuge. Centrifuge settings: 4℃, 12000rpm, 15min.

[0192] (3) Aspirate the supernatant into a new 1.5 mL centrifuge tube and add 0.6 times the volume of isopropanol (pre-cooled at 4°C).

[0193] (4) After placing at -20℃ for 10 minutes, put it into a centrifuge. Centrifuge settings: 4℃, 12000rpm, 10 minutes.

[0194] (5) Discard the supernatant, resuspend the precipitate in 75% ethanol (pre-cooled at 4℃), and put it into a centrifuge. Centrifuge settings: 4℃, 7500rpm, 5min.

[0195] (6) Remove the supernatant as much as possible, let the precipitate air dry or blow dry until transparent, and add DEPC water to dissolve it to obtain total RNA.

[0196] (7) The total amount and integrity of total RNA were detected using an ultra-micro UV spectrophotometer and agarose gel electrophoresis.

[0197] 1.2.8 Reverse transcription: using the TaKaRa PrimeScript kit TM II. 1st Strand CDNASynthesiskit was used for reverse transcription.

[0198] (1) Prepare the following reaction mixture in a Microtube: 1 μL of oligo dT Primer (50 mM); 1 μL of template RNA; 1 μL of dNTPMixture (10 mM each); and 10 μL of RNase Free H2O.

[0199] (2) After reacting at 65℃ for 5 min, rapidly cool on ice for 3-5 min;

[0200] (3) Prepare the following reverse transcription reaction solution in the above Microtube tube, with a total volume of 20 μL: 10 μL of the above denaturing reaction solution; 4 μL of 5×PrimeScript II Buffer; 0.5 μL of RNase Inhibitor (40 U / μL); 1 μL of Prime Script II RTase (200 U / μL); and 4.5 μL of RNase Free H2O.

[0201] (4) Mix slowly and carry out reverse transcription under the following conditions: 50℃ for 30 min; 70℃ for 15 min.

[0202] (5) The concentration was determined using an ultra-micro UV spectrophotometer and stored at -80℃.

[0203] 1.2.9 Nested PCR

[0204] (1) First round of nested PCR

[0205] The reverse transcription product cDNA was used as a template for the first round of nested PCR. This round of PCR used CALL001-TISA.

[0206] (5'-GTCCTGGCTGCTCTTCTACAAGG, SEQ ID NO:6) and CALL002

[0207] Using (5'-GGTACGTGCTGTTGAACTGTTCC, SEQ ID NO:7) as primers, the PCR reaction system is shown in Table 15 below:

[0208]

[0209]

[0210] The PCR amplification steps are shown in Table 16.

[0211] The first nested PCR product was analyzed by agarose gel electrophoresis to determine the success of the PCR and to obtain the target band. The specific experimental procedures are as follows:

[0212] To prepare a 1% agarose gel: Weigh 0.5 g of agarose into an Erlenmeyer flask using an analytical balance, add 50 mL of 1×TAE solution, heat in a microwave oven until the agarose powder is completely melted, cool to 60-70°C at room temperature, add 5 μL of nucleic acid gel dye, and gently shake to mix the solution, avoiding the formation of bubbles. Pour the mixture into the gel slot with the sample comb inserted. After 2 hours, remove the sample comb, and the agarose gel can be placed in an electrophoresis tank for electrophoresis.

[0213] Sample loading: The PCR product was mixed with 10× DNA loading buffer at a volume ratio of 1:9. After thorough mixing, 30 μL of the mixture was added to each well. The agarose gel electrophoresis apparatus was run at 100 V for 1 hour. After gel running, the agarose gel was removed and placed in a gel imaging system for development. The experimental results were then observed and analyzed.

[0214] (2) Glue recycling

[0215] Cut the desired strip from the adhesive and incubate at -20°C overnight. Preheat the water bath to 65°C, remove moisture from the frozen adhesive, and weigh it.

[0216] Add twice the volume of Buffer QG by weight of the gel, heat at 65℃ for 30 min, vortexing every 2-3 min. After the gel dissolves, add an equal volume of isopropanol to Buffer QG and let stand for 10 min. Add the resulting liquid to the adsorption column, let stand for 10 min, centrifuge at 13000 rpm for 1 min, and repeat until all liquid is used. Add 500 μL of Buffer QG to the adsorption column, let stand for 2-3 min, and centrifuge at 13000 rpm for 1 min. Add 700 μL of Buffer PE to the adsorption column, let stand for 2-5 min, and centrifuge at 13000 rpm for 1 min. Centrifuge an empty tube at 13000 rpm for 2 min, open the cap to evaporate the ethanol, add 30-50 μL of 65℃ Ultrasound water, let stand for 5 min, centrifuge at 13000 rpm for 2 min, and determine the concentration of the plasmid solution (purified product) collected in the centrifuge tube. Store at -20℃.

[0217] (3) Second round of nested PCR

[0218] The purified product from the first nested PCR was recovered using a gel extraction kit and used as a template for the second nested PCR. The second round of nested PCR used either double-enzyme digestion primers or single-enzyme digestion primers to introduce two restriction enzyme sites (NotI (5'-GCGGCCGC, SEQ ID NO:8) and SfiI (5'-GGCCNNNNNGGCC, SEQ ID NO:9) or a single restriction enzyme site (BsmBI (5'-CGTCTC, SEQ ID NO:10)) into the VHH gene sequence. The primer sequences for the second round of nested PCR are shown in Table 19 below.

[0219] The PCR primer sequences for introducing the NotI / SfiI sites of the dual enzymes are shown in Table 17:

[0220] Table 17 Primers for the second nested PCR double enzyme digestion

[0221]

[0222] Introducing the PCR primer sequences for the BsmBI restriction sites described in Table 18:

[0223] Table 18 Primers for the second nested PCR single enzyme digestion

[0224]

[0225] S, R, T, M, W are degenerate bases.

[0226] The double-digested primers and the five single-digested primers were used to form six primer pairs: primers 91 and 92 were paired with primers 93, 94, and 95 to form three primer pairs, and primers 391 and 392 were paired with primers 393, 394, and 395 to form six primer pairs (391 and 393, 391 and 394, 391 and 395, 392 and 393, 392 and 394, 392 and 395). The second nested PCR reaction system is shown in Table 19. The PCR amplification steps are shown in Table 20.

[0227]

[0228] The second nested PCR product VHH-NotI-SfiI or VHH-BsmBI with double or single restriction sites was recovered using a gel recovery kit in step (2).

[0229] 1.2.10 Phage Library Construction

[0230] 1.2.10.1 Construction of phage library using double enzyme digestion system

[0231] (1) Preparation of double restriction sites for phage vectors: Phages with NotI / SfiI restriction sites in the pHEN vector series were used as vectors (purchased from Onogene Company) and amplified by plasmid large-scale extraction (the pHEN vector sequence can be pHEN1, pHEN2, pHEN3 or pHEN4. pHEN1 was used in this example).

[0232] (2) Double enzyme digestion reaction

[0233] The second-round nested PCR products VHH-NotI-SfiI and pHEN1-NotI-SfiI of the double digestion system were digested with NotI and SfiI, respectively.

[0234] Table 21 Double Enzyme Digestion Reaction System

[0235] reagents Dosage 10×LigaseBuffer 5μL Template DNA (5 μg) 5μL NotI 1μL SfiI 2μL Ultrapurewater to 50μL

[0236] The reaction system shown in Table 21 was incubated at 37°C for 16 h, and then reacted at 65°C for 20 min to inactivate the enzyme. Complete enzyme digestion was detected by agarose gel electrophoresis. The double-digested products were recovered and quantified using a gel recovery kit.

[0237] (1) T4 ligase ligates the double-digested PCR product with the phage vector.

[0238] According to the T4 ligase instructions, the amount of phage vector pHEN1-NotI-SfiI was set at 1 μg, and ligation was performed overnight at 16°C using different molar ratios as shown in Table 22. A negative control and a positive control were also set up. During ligation, the ligation fragment VHH-NotI-SfiI was not added to the reaction system, and the ligation vectors were pHEN1-NotI-SfiI and pHEN1-SfiI, respectively.

[0239] Table 22 Ligation reaction systems with different molar ratios of carrier and fragment

[0240] reagents 1:3 1:6 1:9 VHH-NotI-SfiI 333ng 666ng 999ng pHEN1-NotI-SfiI 1μg 1μg 1μg 10×LigaseBuffer 5μL 5μL 5μL T4 DNA Ligase 2μL 2μL 2μL Ultrapurewater to 50μL

[0241] The formula for calculating the linkage reaction is as follows:

[0242]

[0243] After mixing the above reagents, the mixture was incubated in a water bath at 16°C for 16 hours, followed by an inactivation of the ligase at 65°C for 10 minutes. The ligation product was precipitated with ethanol and dissolved in ultrapure water. 1 μL of the product was used for electroporation each time.

[0244] The electroconversion method should be performed according to the TG1 Electroporation-Competent Cell manual, as follows:

[0245] (1) Preheating SOC medium: First, prepare 10 mL of SOC medium for each tube of competent cells to be used and preheat it at 37°C for 1-2 hours to ensure that it reaches the appropriate temperature.

[0246] (2) Prepare the electrocution cup: Remove the 0.1cm electrocution cup and its lid from the storage solution, and place it upside down on clean absorbent paper for 5 minutes to drain. After standing upright for 5 minutes to allow the ethanol to evaporate completely, immediately insert the electrocution cup into ice, ensuring the ice surface is compacted and the top of the electrocution cup is about 0.5cm away from the ice surface to close the lid. Let the electrocution cup stand in the ice for 5 minutes to ensure it cools down sufficiently.

[0247] (3) Preparation of competent cells and ligation products: Remove TG1 electroporated competent cells from the -80℃ freezer and immerse them in ice for 5 minutes to thaw. After the cells have thawed, add the ligation products to the competent cells and gently tap the bottom of the centrifuge tube to mix, being careful to avoid generating air bubbles. Immediately after mixing, reinsert the centrifuge tube into the ice.

[0248] (4) Transfer to electroporation cup: Using a 200 μL pipette tip with approximately 0.5 cm of tip removed, quickly and carefully transfer the competent cell-DNA mixture into the electroporation cup, avoiding the formation of air bubbles. Gently agitate the electroporation cup to keep the liquid level. Replace the lid of the electroporation cup and reinsert it into the ice.

[0249] (5) Set the electroporation apparatus parameters and perform electroporation: Start the electroporation apparatus and set the capacitor C to 25μF, the resistor PC to 200Ω, and the voltage V to 1.8kV. Remove the electroporation cup from the ice and gently wipe the surface with absorbent paper to remove any water stains. Place the electroporation cup in the electroporation tank and perform the electroporation operation. After electroporation, remove the electroporation cup and place it at room temperature. Open the cup lid and quickly add 0.9mL of preheated SOC medium within 15 seconds. Use a 1mL pipette tip to aspirate the bottom of the electroporation cup 2-3 times to mix thoroughly. Then transfer the mixture to a 50mL centrifuge tube and add SOC medium to the centrifuge tube until it reaches 10mL. Place the centrifuge tube in a 37℃ shaker and incubate at 225rpm / min for 120min.

[0250] (6) Plate spreading: After resuscitation, collect the bacterial cells by centrifugation at 5000 rpm / min for 1 min. After resuspending the bacterial cells, take 100 to 200 μL of bacterial suspension and spread it evenly on SOC plates containing the corresponding antibiotic (due to the large bacterial volume, if all cells need to be spread, please use 2-5 culture dishes with a diameter of 15 cm). Invert the plates and incubate them overnight at 37℃ for 13-17 h.

[0251] 1.2.10.2 Modification of single enzyme restriction sites on phage vectors

[0252] Because the library construction process using double-digested phagemid vectors involves multiple gel recoveries of the phagemid vector and the second-round nested PCR products, and the gel recovery efficiency is low, significant losses occur during library construction, resulting in low ligation yields and small library sizes for the constructed phage antibody library. In this study, a BsmBI (5'-CGTCTC) restriction enzyme site was introduced near the coding region of the pelB secretion signal peptide gene in the pHEN1 phagemid through a base mutation, while the remaining BsmBI restriction sites in the phagemid vector were removed through base mutations. The specific vector modification operations are as follows:

[0253] (1) As Figure 4As shown, primers were designed using SnapGene near the coding region of the pelB secretory signal peptide gene to perform point mutations on the pHEN1 phage, introducing a BsmBI enzyme recognition site. Furthermore, the BsmBI restriction site inherent on the pHEN1 phage was identified and mutated by 1-2 bases, i.e., CGTCTC was mutated to GGCGTC, ensuring that the pHEN1 phage vector only contains the BsmBI enzyme recognition site within the coding region of the pelB secretory signal peptide gene.

[0254] The primer sequences for point mutations are shown in Table 23:

[0255] Table 23 Primer sequences for single enzyme digestion vector modification

[0256]

[0257]

[0258] Using pHEN1 phage particles as a template for PCR, PCR was first performed using 413 / 414 primers. The PCR reaction system is shown in Table 24. The PCR amplification steps are shown in Table 25.

[0259]

[0260] 1 μL of DPNI digestive enzyme was added to the PCR product and incubated at 37°C for 1 hour to digest methylated pHEN1 (the template remaining after PCR). The PCR product digested with DPNI enzyme was then transformed into a plasmid. 3-5 single colonies were selected and plasmids were extracted using a plasmid miniprep kit and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Successfully sequenced plasmids were used as templates for the next base mutation. When performing PCR using primer pairs 367-nBmsBI Rev1 / 368-nBmsBI For1 and 369-nBmsBI Rev2 / 370-nBmsBIFor2, 3 μL of LDMSO solution was added to the reaction system, and the annealing temperature in the PCR reaction settings was adjusted to 63°C.

[0261] 1.2.10.3 Construction of bacterial libraries using single enzyme digestion systems

[0262] VHH-BsmBI and pHEN1-BsmBI were ligated simultaneously using BsmBI and electronic ligase at mass ratios of 1:1, 2:1, and 3:1. Taking a 2:1 fragment-to-vector mass ratio as an example, the ligation system is shown in Table 26. The ligation reaction was performed using a PCR instrument under the conditions shown in Table 27.

[0263]

[0264] Take 1 μL of the cleavage-ligation product and perform electrotransformation on E. coli TG1 electrocompetent cells from Weidi Biotechnology. Refer to the TG1 Electroroporation-Competent Cell manual for the procedure as follows:

[0265] (1) Preheat SOC medium: Prepare 10 mL of SOC medium for each tube of competent cells to be used and preheat it at 37°C for 1-2 h to ensure that it reaches the appropriate temperature.

[0266] (2) Prepare the electrocution cup: Remove the 0.1cm electrocution cup and its lid from the storage solution, and place it upside down on clean absorbent paper for 5 minutes to drain. Then, place it upright for 5 minutes to allow the ethanol to evaporate completely. Immediately insert the electrocution cup into ice, ensuring the ice surface is compacted, with the top of the cup approximately 0.5cm above the ice surface to allow the lid to close. Let the electrocution cup remain in the ice for 5 minutes to ensure it cools sufficiently.

[0267] (3) Preparation of competent cells and ligation products: Remove TG1 electroporated competent cells from the -80℃ freezer and immerse them in ice for 5 minutes to thaw. After the cells have thawed, add the ligation products to the competent cells and gently tap the bottom of the centrifuge tube to mix, being careful to avoid generating air bubbles. Immediately after mixing, reinsert the centrifuge tube into the ice.

[0268] (4) Transfer to electroporation cup: Using a 200 μL pipette tip with approximately 0.5 cm of tip removed, quickly and carefully transfer the competent cell-DNA mixture into the electroporation cup, avoiding the formation of air bubbles. Gently agitate the electroporation cup to keep the liquid level. Replace the lid of the electroporation cup and reinsert it into the ice.

[0269] (5) Set the electroporation apparatus parameters and perform electroporation: Start the electroporation apparatus and set the capacitor C to 25μF, the resistor PC to 200Ω, and the voltage V to 1.8kV. Remove the electroporation cup from the ice and gently wipe the surface with absorbent paper to remove any water stains. Place the electroporation cup in the electroporation tank and perform the electroporation operation. After electroporation, remove the electroporation cup and place it at room temperature. Open the cup lid and quickly add 0.9mL of preheated SOC medium within 15 seconds. Use a 1mL pipette tip to aspirate the bottom of the electroporation cup 2-3 times to mix thoroughly. Then transfer the mixture to a 50mL centrifuge tube and add SOC medium to the centrifuge tube until it reaches 10mL. Place the centrifuge tube in a 37℃ shaker and incubate at 225rpm / min for 120min.

[0270] (6) Plate spreading: After resuscitation, collect the bacterial cells by centrifugation at 5000 rpm / min for one minute. After resuspending the bacterial cells, take 100-200 μL of bacterial suspension and spread it evenly on SOC plates containing the corresponding antibiotic (due to the large bacterial volume, if all cells need to be spread, please use 2-5 culture dishes with a diameter of 15 cm). Invert the plates and incubate them overnight at 37℃ for 13-17 h.

[0271] 1.2.11 Phage Library Amplification

[0272] 1.2.11.1 Amplification of Helper Phages

[0273] (1) Inoculation and culture: Inoculate TG1 bacterial solution into liquid culture medium at a ratio of 1:100, and then culture at 37℃ with full shaking for 13-15h to ensure full growth of bacterial cells.

[0274] (2) Spreading the helper phage: The purchased helper phage stock solution M13K07 needs to be spread evenly on a solid culture medium containing kanamycin using glass beads so that the phage can be evenly distributed and grow.

[0275] (3) Preparation and pouring of top agar: Next, prepare a semi-solid culture medium containing 0.7% agar powder as the top agar. After cooling to 50°C (it can be kept warm in a 50°C water bath), take 4 mL of top agar and mix it thoroughly with 0.5 mL of fresh TG1 bacteria that have been cultured overnight. Then, pour the mixed top agar onto the kanamycin solid medium that has been coated with helper phages.

[0276] (4) Incubation and observation: Incubate the culture medium with the top layer of agar at 37℃ for 10-14 h. During the incubation process, observe the plate against the light to look for round, semi-transparent phage plaques about the size of a 200 μL pipette tip against a hazy background. Use an inoculation needle or pipette tip to collect a single phage plaque and inoculate it into 2×YT medium containing kanamycin (70 μg / mL). Then, incubate with full shaking on a constant temperature shaker at 37℃ and 225 rpm / min for 12-16 h.

[0277] (5) Harvesting and Storage: After culturing, centrifuge the phage culture at 4°C and 8000 rpm / min for 15 min. Carefully collect the supernatant and filter it using a 0.45 μm filter membrane. The filtered phage solution can be aliquoted into sterile tubes and stored in a 4°C refrigerator for at least six months.

[0278] 1.2.11.2 Titer determination of auxiliary bacteriophage strains

[0279] (1) Preparation of plates and culture medium: Prepare 5-6 2×YT solid culture plates without any antibiotics and preheat them in a 37℃ incubator. At the same time, prepare a top agar containing 0.7% agar, cool it to 50℃ and store it at a constant temperature of 50℃.

[0280] (2) Dilution of phage solution: The phage solution prepared above was serially diluted with 2×YT medium to a dilution of 10-1. -5 10 -7 10 -9 10 -11 10 -13 .

[0281] (3) Mixing bacterial culture and phage: Take the overnight cultured TG1 bacterial culture (OD660 approximately 1), dispense 500 μL into sterile small test tubes, and label the corresponding dilution. Then, add the diluted phage solution (100 μL) to each corresponding standard dilution test tube and mix thoroughly.

[0282] (4) Pouring and incubation: Add 5 mL of surface agar to each test tube and immediately pour the mixture onto a prepared plate. Then, incubate the plates overnight at 37°C.

[0283] (5) Calculate the titer: After incubation, count the number of empty plaques on the plate and multiply by the corresponding dilution factor to obtain the phage titer. Generally, the titer can reach 10. 11 -10 12 One phage forming unit (pfu / mL).

[0284] 1.2.12 Phage Library Quality Evaluation – Colony PCR Identification of Phage Antibody Library

[0285] Counting plates with colony counts ranging from 100 to 1000 were selected. Twenty colonies were randomly picked from both double-digested and single-digested phage antibody library counting plates for colony PCR to identify cloning efficiency. Several clones were then randomly selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0286] Single colonies were picked and incubated in 200 μL of 2YT liquid medium containing 0.1% ampicillin at 37°C and 250 rpm for 1 h. The bacterial culture was used as the DNA template for colony PCR, with 96-M13-R and 97-pHEN-R as primers. The reaction system is shown in Table 28 below. The PCR amplification steps are shown in Table 29.

[0287]

[0288] The primer sequences for bacterial culture PCR are: 96-M13-R: 5'-AGCGGATAACAATTTCACACAGGA (SEQ ID NO:29), 97-pHEN-R: 5'-GCCCCATTCAGATCCTCTTC (SEQ ID NO:30).

[0289] The position of the PCR products in the colonies was observed by 1% agarose gel electrophoresis to determine the cloning efficiency.

[0290] 1.3 Experimental Results

[0291] 1.3.1 Results of plasmid uptake

[0292] The plasmid pcDNA3.1-T7-AGG-hLGMN was extracted using the TIANGEN endotoxin-free plasmid large-scale extraction kit and identified by agarose gel electrophoresis. Figure 5 As shown. The concentration of the extracted plasmid pcDNA3.1-T7-AGG-hLGMN was determined using an ultra-micro UV-Vis spectrophotometer, and the concentration was found to be 2108.5 ng / μL, with A260 / A280 = 1.98. A total of 4.2 mg of plasmid was extracted.

[0293] 1.3.2 Characterization of DNA-LNP formulation for preliminary immunization of alpacas

[0294] (1) Measurement of particle size, zeta potential and PDI

[0295] The average particle size, zeta potential, and particle size distribution index (PDI) of low-density polymeric nipples (LNPs) have a significant impact on their stability, delivery efficiency, and in vivo behavior. Characterizing particle size and potential allows for a comprehensive assessment of the physicochemical properties of LNPs and their influence on delivery performance.

[0296] The particle size, zeta potential, and particle size distribution index of pcDNA3.1-T7-AGG-hLGMN-LNP prepared by the ethanol injection method are as follows: Figure 6 As shown in the figure. The average particle size of the DNA-LNP prepared in the preliminary experiment was 160.7 nm, the Zeta potential was between -2 and +2 mV, which is basically electroneutrally neutral, the PDI was <0.2, and the homogeneity was good.

[0297] (2) DNA-LNP encapsulation effect detection

[0298] We typically use raw DNA plasmids, LNP-encapsulated DNA, and DNA-LNPs with 10% Triton demulsifier as samples for agarose gel electrophoresis, and assess the encapsulation of LNPs using 1% agarose gel electrophoresis. Compared to raw DNA plasmids and demulsified DNA-LNPs, a small amount of free DNA was detected in lane 2 (the undemulsified lane), indicating that the DNA-LNP encapsulation effect is better. Figure 7 )

[0299] 1.3.3 Western Blot experiment to observe the expression of DNA-LNP after transfection

[0300] AEP protein expression was verified in HeLa cells transfected with DNA-LNP using Western blotting. Figure 8 HeLa cells transfected with DNA-LNP expressed significantly more AEP protein than wild-type HeLa cells, suggesting that immunizing alpacas with DNA-LNP may produce AEP-related antibodies.

[0301] 1.3.4 Formulation Characterization of DNA-LNP

[0302] The DNA-LNP preparation was characterized by pre-experimental immunization of alpacas, and Western blot analysis confirmed that DNA-LNP transfection of HeLa cells could produce AEP protein. Further preparation of DNA-LNP for alpaca immunization can be carried out.

[0303] DNA-LNPs prepared using microfluidics have the following particle size, zeta potential, and particle size distribution index: Figure 9 As shown, the average particle sizes of DNA-LNPs prepared three times using microfluidic methods were 139.8 nm, 73.2 nm, and 103.3 nm, respectively. The PDI was <0.2, indicating good uniformity. The Zeta potential was between -2 and +2 mV, which is basically electroneutrally neutral.

[0304] The encapsulation effect of DNA-LNPs prepared by microfluidic method was detected by agarose gel electrophoresis. For example... Figure 10 As shown, by comparing the bands in the three lanes, the band of DNA-LNP in lane 2 is significantly less than that of the original DNA plasmid and the DNA-LNP with added demulsifier, indicating that there is much less free DNA in lane 2 than in the other two lanes, which shows that the encapsulation effect of DNA-LNPs is good.

[0305] 1.3.5 Serum titer detection after alpaca immunization

[0306] Healthy, unimmunized alpacas (number 7214) were immunized three times using a DNA-LNP preparation. Following the second DNA-LNP immunization, 5 mL of alpaca blood was collected to prepare serum, and the immunization effect was assessed using an ELISA test. The serum was diluted to 2.7 × 10⁻⁶. 3 At that time, the LNP secondary immunoimmune serum titer was close to that of the negative serum, therefore the LNP secondary immunoimmune serum titer was 9 × 10⁻⁶. 3 ( Figure 11 A). One week after the third immunization with the DNA-LNP preparation, a booster immunization was administered using emulsified Recombinant Human Legumain Protein. One week after the second immunization with AEP protein, the immunogenicity was also assessed using an ELISA test. Serum was diluted to 6.561 × 10⁻⁶. 6 When the OD450 value (protein) / OD450 value (negative) > 2, the serum titer of AEP protein in the second immunization can be considered to be 6.561 × 10⁻⁶. 6 ( Figure 11 B).

[0307] 1.3.6 Extraction and Analysis of Total RNA

[0308] One week after the third protein immunization, 80 mL of blood was collected to extract peripheral blood cells (PBMCs). The cells were counted using a hemocytometer, and 2 × 10⁶ cells were extracted from the alpaca's peripheral blood cells. 8 One mononuclear cell. The OD260 / OD280 ratio of the extracted total RNA was determined to be 2.11 by ultra-micro UV spectrophotometry, indicating that the extracted total RNA was free of significant protein or other organic contamination. Approximately 77 μg of total RNA was extracted. Agarose gel electrophoresis results showed ( Figure 12 The 28sRNA and 18sRNA bands were clear, with the 28sRNA band being about twice as bright as the 18sRNA band, indicating that the total RNA molecules were intact and undegraded.

[0309] 1.3.7 First Round of Nested PCR

[0310] cDNA obtained by reverse transcription of total RNA was used as a template for the first round of nested PCR. CALL001 and CALL002 were used as primers to amplify the variable region (VH) of the heavy chain antibody. The first round of nested PCR yielded bands of 500bp-1000bp. Figure 13 The target product in the first round of amplification is in the range of 750bp-1000bp.

[0311] 1.3.8 Second round of nested PCR

[0312] The products from the first round of nested PCR were recovered using a gel extraction kit and used as templates for the second round of nested PCR. For the double digestion system, NotI (GCGGCCGC) and SfiI (GGCCNNNNNGGCC) restriction enzyme sites were introduced as primers, while for the single digestion system, BsmBI was introduced as a single enzyme site. The bands obtained from the second round of nested PCR for the double digestion system and the single digestion system were as follows: Figure 14 Both A and B have PCR product bands of around 500bp.

[0313] 1.3.9 Determination of titers in double-enzyme-digested bacterial libraries

[0314] Remove the serially diluted solid culture plates and count the phages. Phage libraries constructed using double-enzyme digestion systems with different molar ratios of vector and fragment all had titers less than 10. 5 A low phage library size indicates insufficient diversity, which may affect the chances of screening for high-affinity antibodies. Typically, a phage library size is less than 10. 6 It is impossible to effectively screen out specific and diverse nanobodies.

[0315] 1.3.10 Modification of single enzyme restriction sites on phage vectors

[0316] The pHENI-BsmBI phage particle vector point mutation sequencing results were compared with the DNA sequence on SnapeGene. Figure 15 A and B are sequence alignments of four sites on the phage vector, respectively. The alignment results show that the modification of introducing single enzyme cleavage sites on the phage vector was successful.

[0317] 1.3.11 Determination of titers in single-enzyme digested bacterial libraries

[0318] After removing the serially diluted solid culture plates and counting them, the titer of the phage library constructed using the single enzyme digestion system reached 10. 10 The cfu / mL concentration can serve as an effective phage library for screening high-affinity nanobodies.

[0319] 1.3.12 Auxiliary phage titer determination

[0320] The number of empty plaques on the solid culture plate was calculated and multiplied by the dilution factor to obtain the helper phage titer of 1.4 × 10⁻⁶. 13 pfu / mL.

[0321] 1.3.13 Colony PCR

[0322] After library construction using both double-enzyme digestion and single-enzyme digestion systems, 20 colonies were randomly selected for colony PCR. The PCR products were verified by agarose gel electrophoresis. Figure 16A. The phage library constructed using the double enzyme digestion system had 8 colony bands around 500 bp, with an insertion rate of approximately 40% for the VHH gene. In contrast, the phage library constructed using the single enzyme digestion system had 18 colony bands around 500 bp. Figure 16 B) The insertion rate of the VHH gene is approximately 90%. The insertion rate of the VHH gene in the double enzyme digestion system is much lower than that in the single enzyme digestion system.

[0323] Four colonies from 18 phage libraries constructed using a single enzyme digestion system were randomly selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were deduced into amino acid sequences using the Novopro website, and antibody sequence numbers and CDR region annotations were performed. Amino acid multiple sequence alignment was performed using SnapGene. The gene sequences of all four colonies were found to encode the variable region (VHH) of the heavy chain antibody. Figure 17 ).

[0324] We prepared a DNA-LNP vaccine and transfected it into HeLa cells, verifying that DNA-LNP could successfully induce AEP protein expression. Subsequently, we immunized alpacas with the DNA-LNP vaccine, and the serum titer of the immunized alpacas was detected by ELISA as 9 × 10⁻⁶. 3 This indicates that immunization is effective, but not sufficient to achieve our immunization goals. We understand that emulsified proteins can enhance immunogenicity, provide sustained-release effects, and promote antigen presentation. Therefore, we used emulsified AEP protein to enhance immunization in alpacas. ELISA experiments detected high-titer antibodies against AEP protein in the serum of immunized alpacas. We isolated mononuclear cells from the peripheral blood of immunized alpacas, extracted total RNA, and amplified the variable region (VHH) of the heavy chain antibody using reverse transcription and nested PCR, successfully constructing a phage antibody library.

[0325] Example 2

[0326] Referring to sections 1.2.1.2-1.2.5 of Example 1, this example uses different formulations for DNA-LNP preparation and immunizes the test animals. Unlike Example 1, this example consists of two groups, each using the following parameters:

[0327] Group 1: The molar ratio of the four components of LNP was 32:15.5:22.5:1; in the final DNA-LNP, the N / P ratio of cationic lipids to nucleic acids was 2; when immunizing alpacas, the injection volume of DNA-LNP was 2 ml / time, the DNA content was 400 μg / time, and the number of immunizations was 1; the injection volume of AEP antigen protein was 400 μg / time, and the number of immunizations was 1. The final test results for this group showed a yield of 1.2 × 10⁻⁶. 5 Serum titer.

[0328] Group 2: The molar ratio of the four components of LNP was 40:12:30:1.2; in the final DNA-LNP, the N / P ratio of cationic lipids to the expression vector was 6; when immunizing alpacas, the injection volume of DNA-LNP was 2 ml / time, the DNA content was 400 μg / time, and the number of immunizations was 3; no AEP antigen injection was performed. The final test results for this group showed a yield of 5.1 × 10⁻⁶. 4 Serum titer.

[0329] In phage antibody library construction, the choice of restriction endonuclease directly affects the library's quality, diversity, and experimental efficiency. The lower the frequency of the enzyme recognition site in the VHH gene, the smaller its impact on library construction. The frequency of a restriction site in a random DNA sequence can be calculated using equation (2-2), where n is the number of base pairs at the recognition site. The recognition site for NotI is GCGGCCGC, and n is 8 in the formula, so the frequency of NotI in a random DNA sequence can be calculated to be 1.53 × 10⁻⁶. -5 The VHH gene is approximately 360 bp, from which the theoretical frequency of NotI in the VHH gene can be calculated to be 5.5 × 10⁻⁶. -3 Similarly, the theoretical frequency of SfiI in the VHH gene is 5.5 × 10⁻⁶. -3 The theoretical frequency of NotI / SfiI in the VHH gene is 3 × 10⁻⁶. -5 The NotI and SfiI restriction enzyme sites have extremely low frequencies in the VHH gene, with each site having a frequency far less than 1%, making NotI / SfiI a reliable tool for VHH cloning and library construction. The theoretical frequency of BsmBI (CGTCTC) in the VHH gene is 8.8 × 10⁻⁶. -2 The recognition sites are rare in the VHH gene, with an estimated frequency of less than 0.1 sites per gene under random conditions. This low frequency makes BsmBI a practical choice for VHH cloning because endogenous sites are scarce and unlikely to disrupt experimental workflows. In practice, the incidence of these sites is even lower due to biological limitations.

[0330]

[0331] Multiple experiments revealed that during the construction of phage antibody libraries using double-enzyme digestion vectors, significant DNA loss occurred due to repeated gel recovery, resulting in low library size. This low library size may affect the chances of screening for high-affinity antibodies and hinder the effective screening of specific and diverse nanobodies. This chapter addresses this issue by introducing a single BsmBI restriction site into the phage vector pHENI through point mutation, and simultaneously introducing a single BsmBI restriction site into the VHH gene sequence, thus constructing a phage antibody library using a single-enzyme digestion system.

[0332] Experiments showed that the phage library nanobody gene fragments constructed using the single-enzyme digestion system had a higher insertion rate and larger library size, reaching 10. 10 The cfu / mL result indicates that the optimized single-enzyme digestion system is more suitable for phage library construction than the double-enzyme digestion system.

[0333] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. An immune composition, characterized in that, The immune composition comprises nucleic acid and a delivery vector, wherein the nucleic acid is encapsulated in the delivery vector, and the nucleic acid is selected from a recombinant expression vector or mRNA encoding the AEP protein, wherein the recombinant expression vector contains a DNA fragment encoding the AEP protein.

2. The immune composition according to claim 1, characterized in that, It also includes one or more of the following features: (1) The recombinant expression vector is constructed by inserting a DNA fragment encoding the AEP protein into the multiple cloning site of the expression vector, and the expression vector is selected from one or more of bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses or mammalian cell viruses; (2) The nucleotide sequence of the DNA fragment encoding the AEP protein is shown in SEQ ID NO: 1; (3) The delivery carrier is lipid nanoparticles; (4) The nucleotide sequence of the recombinant expression vector is shown in SEQ ID NO:

2.

3. The immune composition according to claim 2, characterized in that, In feature (3), the lipid nanoparticles are composed of cationic lipids, saturated phospholipids, cholesterol and polyethylene glycol-modified lipids; preferably, the N / P ratio of the cationic lipids to the expression vector is (2-6):

1.

4. Use of the immune composition of claim 1 together with other immune enhancers in the preparation of a combined immune composition, wherein the immune enhancers include AEP protein.

5. A combined immunization composition, characterized in that, The combined immune composition includes the immune composition according to any one of claims 1-3, and further includes an immune enhancer, said immune enhancer including AEP protein.

6. The combined immunization composition according to claim 5, characterized in that, The AEP protein is an emulsified AEP protein.

7. An immunization method for producing animal antibodies, characterized in that, The immunization method includes the following steps: administering to a test animal the immunization composition of any one of claims 1-3 or the combined immunization composition of any one of claims 5-6.

8. The method for producing and immunizing animal antibodies as described in claim 7, characterized in that, It also includes one or more of the following features: (1) The immune composition is administered 1-3 times; (2) When immunizing with the combined immunizing composition according to any one of claims 5-6, the immunizing composition in the combined immunizing composition is applied first, followed by the application of the immunizing enhancer.

9. The method for producing and immunizing animal antibodies as described in claim 8, characterized in that, The immune enhancer is administered 1-3 times.

10. The use of the immune composition according to any one of claims 1-3, the combined immune composition according to any one of claims 5-6, or the animal antibody production immune method according to any one of claims 7-9 in the preparation of anti-AEP antibodies.

Images