MOG-IgG detection method based on specific MOG subtype combined stably transfected cells

Abstract

The invention discloses an MOG-IgG (Metal Organic Glycol-Immunoglobulin G) detection method based on a specific MOG subtype combined stably transfected cell. Two protein subtypes of MOG-alpha1 and MOG-beta1 are mixed and expressed in a 293T cell according to a ratio of 3: 1 to obtain a 293T-MOG-alpha1 + beta1 monoclonal stably transfected cell, and then a cytology-based determination (CBA) method is constructed on the basis of the monoclonal stably transfected cell and is used for detecting MOG-IgG. When the method is used for clinical serum MOG-IgG detection, the specificity is high, the sensitivity is high, the experimental result repeatability is good, the stably transfected cell strain can be stably subcultured, the consistency and the stability of the detection result are ensured, the detection efficiency is improved, and the occurrence probability of false positive and false negative is reduced.

Description

Technical Field

[0001] This invention belongs to the field of antibody detection technology, specifically relating to a method for detecting MOG-IgG based on stable transgenic cells with specific MOG subtype combinations. Background Technology

[0002] Oligodendrocyte glycoprotein (MOG) is a protein specifically expressed on the surface of oligodendrocytes, the outermost layer of myelin sheath, and accounts for approximately 0.05% of total myelin proteins. Autoimmune antibodies against MOG are a significant cause of neuromyelitis optica spectrum disorders (NMOSD). MOG-IgG positive optic neuritis is second only to AQP4-IgG positive optic neuritis, accounting for approximately 20-30% of all NMOSD cases. The clinical manifestations, treatment regimens, and prognosis of MOG-IgG positive optic neuritis differ from other types of optic neuritis. Therefore, accurate and efficient detection of serum MOG-IgG in patients is crucial for the correct diagnosis and treatment of optic neuritis.

[0003] MOG-IgG was initially detected using enzyme-linked immunosorbent assay (ELISA) or Western blotting. However, these methods are only suitable for detecting unfolded and / or denatured proteins and cannot distinguish specific antibodies sensitive to different conformations of MOG proteins, leading to false negatives. Cell-based assays (CBA), which overexpress MOG proteins in specific immortalized cell lines to simulate MOG antigens with spatial epitopes under physiological conditions, and visualize MOG-IgG in patient serum through antigen-antibody immune reactions combined with fluorescent secondary antibodies, can identify specific IgGs generated against different spatial structures of MOGs, improving the detection rate of diseases. Currently, it has become the most reliable detection method for diagnosing MOG-IgG positive optic neuritis and MOGAD (MOG antibody-related disease). However, current CBA diagnostic methods only use a single MOG protein subtype (MOG-α1 or MOG-β1), which cannot simulate the coexistence of multiple MOG protein subtypes under normal physiological conditions, thus posing a risk of low sensitivity and missed diagnoses. Summary of the Invention

[0004] The purpose of this invention is to provide a method for detecting MOG-IgG based on stable transgenic cells with a specific combination of MOG subtypes. This invention utilizes the two most prevalent full-length MOG protein subtypes, MOG-α1 and MOG-β1, and simulates normal physiological conditions by mixing and expressing these two subtypes in a certain proportion. Based on this, a novel CBA (Cellular Absorption Regulatory) method for detecting MOG antibodies is established. This method effectively overcomes the shortcomings of existing techniques and improves the specificity and sensitivity of the CBA method for detecting MOG-IgG in patient serum.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] In a first aspect, the present invention provides a method for preparing a stable cell line for detecting MOG antibodies, comprising the following steps:

[0007] (1) Construct plasmids that overexpress two isotypes, MOG-α1 and MOG-β1;

[0008] (2) The plasmid from step (1) is packaged into lentivirus to obtain viral particles that overexpress two subtypes, MOG-α1 and MOG-β1.

[0009] (3) 293T cells were simultaneously infected with viral particles overexpressing MOG-α1 and MOG-β1 subtypes and then sorted by cell flow cytometry to obtain stable 293T cells co-expressing the combination of MOG-α1 and MOG-β1 subtypes.

[0010] (4) 293T stable cells co-expressing MOG-α1 and MOG-β1 subtype combinations were sorted by cell flow cytometry to obtain monoclonal cells. After the monoclonal cells were expanded and cultured, they were screened by the cell-based MOG-IgG detection method to obtain monoclonal cells with the best specificity and sensitivity. The monoclonal cells were expanded and cultured and cryopreserved to obtain a monoclonal stable cell line for detecting MOG antibodies.

[0011] Step (1) specifically involves designing MOG-specific PCR primers to amplify the cDNA of MOG-α1 and MOG-β1 from the MOG gene plasmid, and then ligating the cDNA into the pLenti-CAG-T2A-GFP plasmid vector for transformation, amplification, and extraction to obtain the pLenti-CAG-MOG-α1-T2A-GFP and pLenti-CAG-MOG-β1-T2A-GFP plasmids.

[0012] Furthermore, the forward primer sequence of the MOG-α1 specific PCR primer is as follows:

[0013] CCGCTCGAGATGGCAAGCTTATCAAGA;

[0014] The MOG-α1 reverse primer sequence is: CTAGCTAGCTCCGAAGGGATTTCGTAGCTC;

[0015] The forward primer sequence of the MOG-β1 specific PCR primer is the same as that of the MOG-α1 forward primer;

[0016] The MOG-β1 reverse primer sequence is: GATGCTAGCTCCGCCAGAGAGGGCTTCCAG.

[0017] Furthermore, in step (3), the viral particles overexpressing MOG-α1 and MOG-β1 subtypes are simultaneously used to infect 293T cells at a ratio of 3:1.

[0018] Secondly, the present invention also provides a monoclonal stable cell line for detecting MOG antibodies prepared according to the above preparation method.

[0019] Thirdly, the present invention also provides the application of the above-mentioned monoclonal stable cell line in the preparation of materials for detecting MOG antibodies.

[0020] Furthermore, the material includes cell-crawling sheets.

[0021] The preparation steps of the cell crawling slide are as follows: monoclonal stable cell line and wild-type 293T cells are seeded into the cell crawling slide at the same cell volume. When the cell confluence reaches 60-80%, the culture medium is removed, 4% paraformaldehyde is added for fixation, and the cells are washed with PBS to obtain the cell crawling slide.

[0022] Fourthly, the present invention also provides a method for detecting MOG-IgG based on stable transgenic cells with specific MOG subtype combinations, comprising the following steps:

[0023] (1) Inoculate the above-mentioned monoclonal stable cell line and wild-type 293T cells into cell crawling slides at the same cell volume. When the cell confluence reaches 60-80%, remove the culture medium and add 4% paraformaldehyde for fixation at room temperature.

[0024] (2) Wash the cells with PBS and block them at room temperature with goat serum blocking solution;

[0025] (3) Remove the blocking solution, add clinical serum diluted with PBS, and incubate overnight;

[0026] (4) Wash cells with PBST, add anti-human IgG-ALEXA FLUOR 568 fluorescent secondary antibody, and incubate at room temperature in the dark;

[0027] (5) Wash cells with PBST, mount with mounting medium containing Dapi, examine and photograph under a fluorescence microscope.

[0028] In the above detection method, the fixed time in step (1) is 20 minutes; the sealing time in step (2) is 1 hour; the overnight incubation in step (3) is overnight incubation at 4°C; and the room temperature incubation in step (4) is incubation at room temperature in the dark for 1 hour.

[0029] This invention constructs a cell-based assay (CBA) for detecting MOG-IgG by expressing two major full-length protein isoforms, MOG-α1 and MOG-β1, in a specific ratio in stable cells. This innovative method has the following significant advantages:

[0030] 1. Improved detection sensitivity and specificity: Traditional CBA methods use only a single MOG protein isoform, which cannot fully simulate the coexistence of multiple MOG protein isoforms under normal physiological conditions, leading to potential missed diagnoses in some cases. This invention, by simultaneously expressing two isoforms, can more comprehensively simulate the MOG antigen conformation under physiological conditions, thereby significantly improving the detection sensitivity and specificity for MOG-IgG.

[0031] 2. Reduced false negative rate: Because MOG-IgG may generate specific antibodies against MOG antigenic epitopes with different spatial structures, traditional methods fail to adequately mimic these conformations, leading to false negative results. This invention, by combining two subtypes, can more comprehensively identify specific antibodies against different conformations, thereby effectively reducing the false negative rate.

[0032] 3. Enhanced technology versatility and stability: This invention employs stable cell transfection technology, enabling large-scale, standardized preparation of detection materials under laboratory conditions, ensuring the consistency and stability of test results. This not only improves detection efficiency but also reduces the probability of false positives and false negatives.

[0033] 4. MOG-IgG is a heterogeneous group of antibodies capable of recognizing various three-dimensional conformational epitopes of MOG. However, the longest subtype, MOG10, may have insufficient exposure of some epitopes due to conformational differences, posing a risk of missed detection. Experimental comparisons show that co-expression of MOG-α1 and β1 at a 3:1 ratio is significantly superior to any MOG-α1+MOG10 combination in terms of specificity, sensitivity, and background cleanliness: even at low antigen expression levels, it can still capture MOG-IgG with high specificity and sensitivity, and the background is clean with clear positive signals. Conversely, with increasing MOG10 ratios, sensitivity decreases and non-specific background increases, making results difficult to interpret. Therefore, MOG-α1+β1 = 3:1 has been determined as the optimal antigen expression scheme for MOG-IgG serum antibody detection, possessing both high reliability and practical value. Attached Figure Description

[0034] Figure 1 This is a schematic diagram of MOG-IgG serum staining of 293T-MOG-α1 stable cells as described in an embodiment of the present invention.

[0035] Figure 2 This is a schematic diagram of MOG-IgG serum staining of 293T-MOG-β1 stable cells as described in an embodiment of the present invention.

[0036] Figure 3 This is a schematic diagram of staining stable cells of 293T-MOG-α1+β1 combination with MOG-IgG serum and lentivirus infection ratio of 1:1, as described in the embodiments of the present invention.

[0037] Figure 4 This is a schematic diagram of staining stable cells of 293T-MOG-α1+β1 combination with MOG-IgG serum and lentivirus infection ratio of 1:2, as described in the embodiments of the present invention.

[0038] Figure 5 This is a schematic diagram of staining stable cells of 293T-MOG-α1+β1 combination with MOG-IgG serum and lentivirus infection ratio of 1:3, as described in the embodiments of the present invention.

[0039] Figure 6 This is a schematic diagram of staining stable cells of the 293T-MOG-α1+β1 combination with MOG-IgG serum and lentivirus infection ratio of 2:1, as described in the embodiments of the present invention.

[0040] Figure 7 This is a schematic diagram of staining stable cells of 293T-MOG-α1+β1 combination with MOG-IgG serum and lentivirus infection ratio of 3:1, as described in the embodiments of the present invention.

[0041] Figure 8 This is a schematic diagram of staining of monoclonal stable cells selected from 293T-MOG-α1+β1 combination stable cells with a lentivirus infection ratio of 3:1 to MOG-IgG serum as described in the embodiments of the present invention.

[0042] Figure 9 This is a schematic diagram of staining MOG-IgG positive serum with MOG-α1+β1 in a 3:1 ratio of transiently transfected 293T cells as described in the embodiments of the present invention.

[0043] Figure 10 This is a schematic diagram of staining MOG-IgG positive serum with 293T cells transfected at a ratio of 1:1 (MOG-α1+MOG10) as described in the embodiments of the present invention.

[0044] Figure 11 This is a schematic diagram of staining MOG-IgG positive serum on 293T cells transiently transfected at a ratio of 1:2 with MOG-α1+MOG10 as described in the embodiments of the present invention.

[0045] Figure 12 This is a schematic diagram of staining MOG-IgG positive serum on 293T cells transiently transfected at a ratio of 1:3 with MOG-α1+MOG10 as described in the embodiments of the present invention.

[0046] Figure 13This is a statistical chart showing the antibody binding rate of MOG-IgG positive serum to 293T cells transiently transfected with pLenti-CAG-MOG-T2A-GFP plasmid, as described in the embodiments of the present invention. Detailed Implementation

[0047] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0048] Example 1: Construction of MOG-α1, MOG-β1 and MOG10 plasmids

[0049] (1) Design specific PCR primers for different MOG subtypes. Using commercially available MOG-α1 (Addgene, #126463) and MOG-β1 (Addgene, #160978) plasmids as templates, amplify the cDNA fragments of MOG-α1 and MOG-β1. The MOG-α1 and MOG-β1 specific PCR primers are shown in Table 1.

[0050] (2) The PUC57-MOG10 plasmid (synthesized by Beijing Qingke Biotechnology Co., Ltd.) was digested with enzymes to obtain the cDNA of MOG10. The sequence of MOG10 is (SEQ ID NO.1):

[0051] CTCGAGATGGCAAGCTTATCAAGACCCTCTCTGCCCAGCTGCCTCTGCTCCTTCCTCCTC

[0052] CTCCTCCTCCTCCAAGTGTCTTCCAGCTATGCAGGGCAGTTCAGAGTGATAGGACCAAG

[0053] ACACCCTATCCGGGCTCTGGTCGGGGATGAAGTGGAATTGCCATGTCGCATATCTCCTGG

[0054] GAAGAACGCTACAGGCATGGAGGTGGGGTGGTACCGCCCCCCCTTCTCTAGGGTGGTTC

[0055] ATCTCTACAGAAATGGCAAGGACCAAGATGGAGACCAGGCACCTGAATATCGGGGCCG

[0056] GACAGAGCTGCTGAAAGATGCTATTGGTGAGGGAAAGGTGACTCTCAGGATCCGGAAT

[0057] GTAAGGTTCTCAGATGAAGGAGGTTTCACCTGCTTCTTCCGAGATCATTCTTACCAGAG

[0058] GAGGCAGCAATGGAATTGAAAGTAGAAGATCCTTTCTACTGGGTGAGCCCTGGAGTGCT

[0059] GGTTCTCCTCGCGGTGCTGCCTGTGCTCCTCCTGCAGATCACTGTTGGCCTCATCTTCCT

[0060] CTGCCTGCAGTACAGACTGAGAGGAAAACTTCGAGCAGAGATAGAGAATCTCCACCGG

[0061] ACTTTTGATCCCCACTTTCTGAGGGTGCCCTGCTGGAAGATAACCCTGTTTGTAATTGTG

[0062] CCGGTTCTTGGACCCTTGGTTGCCTTGATCATCTGCTACAACTGGCTACATCGAAGACTA

[0063] GCAGGGCAATTCCTTGAAGAGCTACGTAAGTTCTCTTCTCTCTGTTATAAGCAGAGAATA

[0064] AAAAGCCAGGAAAGGGAGACAGAAGCAACAAGAGGAAGAGGCGGGCTATTGAGGGAT

[0065] CACATTCCCAGAGGAAAGGAGGAGCTGGAGAGCCTGGGTGGAGGGAAGACTCCTCCTGGGAGGGCTAGC.

[0066] (3) The amplified cDNA fragments of MOG-α1 and MOG-β1 and the cDNA fragment of MOG10 were cloned and ligated into the pLenti-CAG-T2A-GFP lentiviral plasmid vector.

[0067] (4) The constructed plasmids were then transformed, subjected to bacterial PCR, sequenced, and cultured, and then amplified and extracted to obtain pLenti-CAG-MOG-α1-T2A-GFP, pLenti-CAG-MOG-β1-T2A-GFP and pLenti-CAG-MOG10-T2A-GFP plasmids.

[0068] The construction steps of plasmid pLenti-CAG-T2A-GFP are as follows:

[0069] ① Design specific PCR primers for T2A-GFP. Using the CAG-Z-IRES-EGFP plasmid (Source: Jolien Perneel, et al. Increased TMEM106B levels lead to lysosomal dysfunction which affects synaptic signaling and neuronal health[J]. Mol Neurodegener. 2025 Apr23; 20(1):45.) as a template, perform two PCR amplifications to obtain the T2A-GFP cDNA fragment. The specific primers for the first and second PCR of T2A-GFP are shown in Table 1.

[0070] ② The amplified T2A-GFP cDNA fragment and CAG-Z-IRES-EGFP plasmid were digested with EcoRI and NotI restriction endonucleases, respectively, followed by agarose gel electrophoresis, gel recovery, ligation, transformation, bacterial PCR, sequencing, and shaking for amplification and extraction to obtain the pLenti-CAG-T2A-GFP vector plasmid.

[0071] Table 1 Primer Information

[0072]

[0073]

[0074] Example 2: Lentiviral packaging overexpressing the MOG gene

[0075] (1) 293T cells were seeded into 6-well plates, with approximately 1 × 10⁶ cells per well. 6 Each cell.

[0076] (2) When the cell confluence reaches 70-80%, the same mass of MOG-α1 and MOG-β1 plasmids (pLenti-CAG-MOG-α1-T2A-GFP and pLenti-CAG-MOG-β1-T2A-GFP) obtained in Example 1 are transfected into 293T cells with the same mass as the viral packaging system plasmids psPAX2 and PMD2.G, respectively, at a mass ratio of 4:3:1, i.e., MOG plasmid:psPAX2:PMD2.G = 4:3:1; the transfection reagent is Thermo Fisher Scientific's TurboFect transfection reagent.

[0077] (3) 8–12 hours after transfection, remove the cell supernatant and replace it with normal culture medium. 48 hours later, harvest the cell culture medium supernatant containing virus particles. The supernatant is filtered through a 0.22 μm filter to obtain virus particles, i.e., lentivirus packaging that overexpresses the MOG gene.

[0078] Example 3: Construction of stable cell lines overexpressing MOG-α1 and MOG-β1 isoforms

[0079] (1) 293T cells were seeded into 6-well plates, with approximately 1 × 10⁶ cells per well. 6 Each cell.

[0080] (2) When the cell fusion rate reaches 30-40%, the seeded 293T cells are infected with the virus particles overexpressing MOG-α1 and MOG-β1 subtypes obtained in Example 2, using an infection reagent. The infection reagent here is polybrene (polybrene, i.e. hexamethylene bromide), a cationic polymer that can enhance the infection efficiency of the virus.

[0081] (3) 48 hours after infection, the expression of GFP green fluorescent cells was observed under a fluorescence microscope. The cells were digested and resuspended with flow cytometry sorting buffer. GFP green fluorescent cells were sorted by flow cytometry. The sorted green fluorescent cells were the stable cell lines overexpressing 293T-MOG-α1 and 293T-MOG-β1. All of them were cryopreserved for seed preservation.

[0082] Example 4: MOG-IgG detection method based on 293T-MOG-α1 and 293T-MOG-β1 stable transgenic cells

[0083] (1) Simultaneously revive the cryopreserved stable cell lines overexpressing 293T-MOG-α1 and 293T-MOG-β1 in Example 3.

[0084] (2) Once the cell count is sufficient, mix the cells with wild-type 293T cells at a 1:1 ratio, resulting in a total inoculation volume of 3 × 10⁻⁶ cells. 4 Cells were seeded per well on a 12mm cell slide in a 24-well plate. The slide was pretreated with poly-L-lysine before seeding. The culture medium and dosage of each component for seeding stable cell lines overexpressing 293T-MOG-α1 and 293T-MOG-β1 were as follows: DMEM medium + 10% fetal bovine serum + 1000U penicillin + 1000mg / L streptomycin.

[0085] (3) When the cell fusion reaches 70% to 80%, remove the culture medium, wash the cells once with PBS, add 500 μL of 4% paraformaldehyde, and fix at room temperature for 20 minutes.

[0086] (4) After the cells are fixed, wash the cells twice with PBS, take out the cell slides and place them on a wet dish. Immediately add about 50 μL of goat serum blocking solution to the cell slides and block at room temperature for 1 hour.

[0087] (5) Remove the blocking solution, dilute the clinical MOG-IgG serum with PBS to the highest detection dilution titer for clinical reporting results identification, add 50 μL to the slide, and incubate overnight at 4°C.

[0088] (6) Wash cells three times with PBST, add 50 μL of 1:1000 diluted anti-human IgG-ALEXA FLUOR568 fluorescent secondary antibody to each smear, and incubate at room temperature in the dark for 1 hour.

[0089] (7) Wash cells with PBST 3 times.

[0090] (8) Add mounting medium containing Dapi, mount the slide, and examine and photograph it under a fluorescence microscope.

[0091] (9) The staining results of MOG-IgG serum on 293T-MOG-α1 stable cells are as follows: Figure 1 As shown, the staining results of MOG-IgG serum on 293T-MOG-β1 stable cells are as follows: Figure 2 As shown; blue represents Dapi-stained cell nuclei, green represents overexpressed MOG-α1 or MOG-β1 antigen proteins, and red represents anti-human IgG-ALEXA FLUOR 568 fluorescent secondary antibody.

[0092] like Figure 1 and Figure 2 As shown, the binding of MOG-IgG serum antibody to overexpressed MOG-α1 or MOG-β1 antigen protein was not significant, and some overexpressed MOG-α1 or MOG-β1 antigen proteins failed to bind to MOG-IgG serum antibody, indicating poor binding specificity. At the same time, excessive non-specific binding resulted in high background color, making it difficult to distinguish positive results.

[0093] Example 5: Construction of a stable cell line co-expressing 293T-MOG-α1+β1

[0094] (1) 293T cells were seeded into 6-well plates, with approximately 1 × 10⁶ cells per well. 6 Each cell.

[0095] (2) When the cell fusion reaches 30-40%, 293T cells are infected with the virus particles overexpressing MOG-α1 and MOG-β1 subtypes obtained in Example 2 at different ratios of 1:1, 1:2, 1:3, 2:1 and 3:1, respectively, using an infection reagent; the infection reagent here is polybrene (polybrene, i.e. hexammonium bromide).

[0096] (3) 48 hours after infection, the expression of GFP green fluorescent cells was observed under a fluorescence microscope. The cells were digested and resuspended with flow cytometry sorting buffer. GFP green fluorescent cells were sorted by flow cytometry. The sorted green fluorescent cells were the 293T stable cell line co-expressing different ratios of MOG-α1 and MOG-β1 subtypes. The cells were then cryopreserved.

[0097] Example 6: MOG-IgG detection method based on stable cell line co-expressing 293T-MOG-α1+β1

[0098] (1) Simultaneously revive the 293T stable cell lines that co-express different ratios of MOG-α1 and MOG-β1 subtypes frozen in Example 5.

[0099] (2) After the number of cells is sufficient, staining is performed according to the cell-based MOG-IgG detection procedure in Example 4.

[0100] (3) The staining results of MOG-IgG serum on lentivirus-infected stable cells of 293T-MOG-α1+β1 combination at a 1:1 ratio are as follows: Figure 3 As shown; the staining results of MOG-IgG serum on 293T-MOG-α1+β1 cells with a lentiviral infection ratio of 1:2 are as follows. Figure 4 As shown; the staining results of MOG-IgG serum on 293T-MOG-α1+β1 cells with a lentiviral infection ratio of 1:3 are as follows. Figure 5 As shown; the staining results of MOG-IgG serum on 293T-MOG-α1+β1 cells with a lentiviral infection ratio of 2:1 are as follows. Figure 6 As shown; the staining results of MOG-IgG serum on 293T-MOG-α1+β1 cells with a lentiviral infection ratio of 3:1 are as follows. Figure 7 As shown; blue represents Dapi-stained cell nuclei, green represents overexpressed MOG-α1 or MOG-β1 antigen proteins, and red represents anti-human IgG-ALEXAFLUOR 568 fluorescent secondary antibody.

[0101] (4) The results are as follows:

[0102] like Figure 3As shown, the MOG-IgG serum antibody binds significantly to the overexpressed MOG-α1+β1 (1:1) antigen protein. A small portion of the overexpressed MOG-α1+β1 antigen protein does not bind to the MOG-IgG serum antibody, indicating that its binding specificity is relatively poor. Furthermore, non-specific binding results in a high background color, making it difficult to distinguish positive results.

[0103] like Figure 4 As shown, MOG-IgG serum antibody binds significantly to the overexpressed MOG-α1+β1 (1:2) antigen protein. A small number of stable cells with low levels of MOG-α1+β1 antigen protein overexpression bind weakly to MOG-IgG serum antibody, indicating that its binding specificity is relatively good. However, non-specific binding results in a high background color, which can distinguish positive results.

[0104] like Figure 5 As shown, MOG-IgG serum antibody binds significantly to the overexpressed MOG-α1+β1 (1:3) antigen protein. Stable cells with low levels of MOG-α1+β1 antigen protein overexpression can also bind to MOG-IgG serum antibody, indicating that its binding specificity and sensitivity are good. However, non-specific binding leads to a higher background color, which can distinguish positive results.

[0105] like Figure 6 As shown, MOG-IgG serum antibody binds significantly to the overexpressed MOG-α1+β1 (2:1) antigen protein. Stable cells with low levels of MOG-α1+β1 antigen protein overexpression can also bind to MOG-IgG serum antibody, indicating that its binding specificity and sensitivity are good. A small amount of non-specific binding results in some background color, which can distinguish positive results.

[0106] like Figure 7 As shown, MOG-IgG serum antibody binds significantly to the overexpressed MOG-α1+β1 (3:1) antigen protein, indicating good binding specificity; a small amount of MOG-α1+β1 with low overexpression of antigen protein can also bind to MOG-IgG serum antibody, indicating good binding sensitivity; a very small amount of non-specific binding has almost no background color, making it easy to distinguish positive results.

[0107] In summary, the most specific stable cell line determined by cell-based MOG-IgG detection method is the 293T-MOG-α1+β1 combination of lentivirus infection ratio of 3:1.

[0108] Example 7: Screening for 293T-MOG-α1+β1 monoclonal stable cells

[0109] (1) Resuscitate the 293T-MOG-α1+β1 combination stable cell line with a lentivirus infection ratio of 3:1 in Example 5.

[0110] (2) After the cells have been stably passaged 1-2 times, the cells are digested and resuspended with flow cytometry sorting buffer. The monoclonal cells are then sorted by flow cytometry into 96-well plates for expanded culture.

[0111] (3) Select monoclonal cells with the best specificity and sensitivity according to the steps of the cell-based MOG-IgG detection method in Example 4, and then expand and cryopreserve them.

[0112] (4) After the number of cells is sufficient, staining is performed according to the cell-based MOG-IgG detection procedure in Example 4.

[0113] (5) The staining results of monoclonal stable cells selected from the 293T-MOG-α1+β1 combination stable cell line with a lentiviral infection ratio of 3:1 using MOG-IgG serum are as follows: Figure 8 As shown; blue represents Dapi-stained cell nuclei, green represents overexpressed MOG-α1 or MOG-β1 antigen proteins, and red represents anti-human IgG-ALEXAFLUOR 568 fluorescent secondary antibody.

[0114] like Figure 8 As shown, the MOG-IgG serum antibody binds significantly to the overexpressed MOG-α1+β1 antigen protein, indicating good binding specificity; there is almost no non-specific binding, no background color, and positive results are easily distinguishable.

[0115] Example 8: MOG-IgG detection method based on transiently transfected 293T cells with specific MOG subtype combinations

[0116] (1) 293T cells were seeded onto 12 mm cell spread sheets, with a total cell volume of 4 × 10⁻⁶ cells. 4One sample per well per slide. Once the cell confluence reaches 40-50%, the obtained pLenti-CAG-MOG-α1-T2A-GFP, pLenti-CAG-MOG-β1-T2A-GFP, or pLenti-CAG-MOG10-T2A-GFP plasmids are instantaneously transfected into 293T cells, either alone or in combination with MOG-α1 and β1 at a mass ratio of 3:1 for pLenti-CAG-MOG-α1-T2A-GFP and pLenti-CAG-MOG-β1-T2A-GFP, or in combination with MOG-α1 and MOG10 at a mass ratio of 1:1 to 3 for pLenti-CAG-MOG-α1-T2A-GFP and pLenti-CAG-MOG10-T2A-GFP. The cells are then cultured in a 37°C, 5% CO2 cell culture incubator for 24 hours.

[0117] (2) After the cells have been cultured for about 24 hours and GFP green fluorescence is observed under a fluorescence microscope, the culture medium is removed, the cells are washed once with PBS, and then 4% paraformaldehyde is added and fixed at room temperature for 20 minutes.

[0118] (3) After the cells were fixed, the cells were washed twice with PBS, the cell slides were removed and placed on a wet dish, and goat serum blocking solution was immediately added to the cell slides and blocked at room temperature for 1 hour.

[0119] (4) Remove the blocking solution, dilute the clinical serum sample with PBS to the highest detection titer for clinical reporting results identification, add it to the slide, and incubate overnight at 4°C.

[0120] (5) Wash cells three times with PBST, add diluted anti-human IgG-ALEXAFLUOR 568 fluorescent secondary antibody, and incubate at room temperature in the dark for 1 hour.

[0121] (6) Wash cells three times with PBST;

[0122] (7) Add mounting medium containing Dapi, mount the slide, and examine and photograph it under a fluorescence microscope.

[0123] (8) The results are as follows:

[0124] The staining results of MOG-IgG serum on transiently transfected 293T cells at a ratio of 3:1 to MOG-α1+β1 are as follows: Figure 9 As shown in the results, the MOG-IgG serum antibody binds significantly to the overexpressed MOG-α1+β1 antigen protein, indicating good binding specificity. A small number of transiently transfected MOG-α1+β1 cells with low levels of overexpressed antigen protein can also bind to the MOG-IgG serum antibody, indicating good binding sensitivity. A small amount of non-specific binding has almost no background color, making it easy to distinguish positive results.

[0125] The staining results of MOG-IgG serum on transiently transfected 293T cells at MOG-α1+MOG10 ratios of 1:1, 1:2, and 1:3 are as follows: Figure 10-12 As shown, the results indicate that MOG-IgG serum antibodies can bind to the overexpressed MOG-α1+MOG10 combination antigen protein, indicating that they have binding specificity. However, MOG-α1+MOG10 combination transiently transfected cells with lower levels of overexpressed antigen protein bind weakly or not at all to MOG-IgG serum antibodies, indicating poor binding sensitivity. Furthermore, the higher the proportion of MOG10 in the MOG-α1+MOG10 combination, the worse the binding sensitivity. Non-specific binding results in a certain background color, making it difficult to distinguish positive results.

[0126] The above results indicate that the MOG-α1+β1 = 3:1 co-transformation combination is significantly superior to various ratios of MOG-α1+MOG10 in terms of specificity, sensitivity, and background cleanliness. Specifically, the MOG-α1+β1 = 3:1 combination not only binds to MOG-IgG serum antibodies with high specificity, but also maintains a good binding signal even in cells with low antigen expression levels, demonstrating higher detection sensitivity; at the same time, the background is clean, with minimal non-specific staining, and the positive signal is clear and easily distinguishable. In contrast, while the MOG-α1+MOG10 combinations (1:1, 1:2, 1:3) possess some specificity, their sensitivity decreases significantly with increasing MOG10 ratio, and they exhibit significant non-specific background interference, making it difficult to accurately interpret positive results. Therefore, the MOG-α1+β1 = 3:1 combination is the optimal antigen expression scheme for MOG-IgG serum antibody detection, exhibiting higher reliability and practical value in diagnostic and research applications.

[0127] Example 10: Immunofluorescence antigen-antibody binding specificity analysis

[0128] ImageJ software was used to measure the fluorescence intensity of the red and green channels in the immunofluorescence results. The measured data were imported into GraphPad Prism software to calculate the antibody binding rate. The horizontal axis of the graph represents the fluorescence intensity of the green channel, indicating the antigen protein overexpressed by either the MOG-α1+β1 combination or the MOG-α1+MOG10 combination in transiently transfected 293T cells; the vertical axis represents the fluorescence intensity of the red channel, indicating the binding of MOG-IgG serum antibodies to the antigen protein. Each point represents one cell, and all points were plotted as a linear regression line. The slope of the linear regression line, k, represents the antibody binding rate of the cells, used to evaluate the antigen-antibody binding specificity. The results showed that the MOG-α1+β1 = 3:1 combination overexpressing the antigen protein had the largest slope and the best antigen binding specificity; the MOG-α1+MOG10 = 1:1 combination overexpressing the antigen protein had the second largest slope and the worst antigen binding specificity; and the MOG-α1+MOG10 = 1:3 combination overexpressing the antigen protein had the smallest slope and the worst antigen binding specificity. Figure 13 ).

[0129] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for preparing a stable cell line for detecting MOG antibodies, characterized in that, Includes the following steps: (1) Construct plasmids that overexpress two isotypes, MOG-α1 and MOG-β1; (2) The plasmid from step (1) is packaged into lentivirus to obtain viral particles that overexpress two subtypes, MOG-α1 and MOG-β1. (3) 293T cells were simultaneously infected with viral particles overexpressing MOG-α1 and MOG-β1 subtypes and then sorted by cell flow cytometry to obtain stable 293T cells co-expressing the combination of MOG-α1 and MOG-β1 subtypes. (4) 293T stable cells co-expressing MOG-α1 and MOG-β1 subtype combinations were sorted by cell flow cytometry to obtain monoclonal cells. After the monoclonal cells were expanded and cultured, they were screened by the cell-based MOG-IgG detection method to obtain monoclonal cells with the best specificity and sensitivity. The monoclonal cells were expanded and cultured and cryopreserved to obtain a monoclonal stable cell line for detecting MOG antibodies.

2. The preparation method according to claim 1, characterized in that, Step (1) specifically involves designing MOG-specific PCR primers to amplify the cDNA of MOG-α1 and MOG-β1 from the MOG gene plasmid, and then ligating the cDNA into the pLenti-CAG-T2A-GFP plasmid vector for transformation, amplification, and extraction to obtain the pLenti-CAG-MOG-α1-T2A-GFP and pLenti-CAG-MOG-β1-T2A-GFP plasmids.

3. The preparation method according to claim 2, characterized in that, The forward primer sequence of the MOG-α1 specific PCR primer is: CCGCTCGAGATGGCAAGCTTATCAAGA, and the reverse primer sequence is: CTAGCTAGCTCCGAAGGGATTTCGTAGCTC; the forward primer sequence of the MOG-β1 specific PCR primer is the same as that of the MOG-α1 forward primer; the MOG-β1 reverse primer sequence is: GATGCTAGCTCCGCCAGAGAGGGCTTCCAG.

4. The preparation method according to claim 1, characterized in that, In step (3), the viral particles overexpressing MOG-α1 and MOG-β1 subtypes are used to simultaneously infect 293T cells at a ratio of 3:

1.

5. The monoclonal stable cell line for detecting MOG antibodies prepared by the preparation method according to any one of claims 1-4.

6. The use of the monoclonal stable cell line according to claim 5 in the preparation of materials for detecting MOG antibodies.

7. The application according to claim 6, characterized in that, The material includes cell spreaders.

8. The application according to claim 7, characterized in that, The preparation steps of the cell crawling slide are as follows: monoclonal stable cell line and wild-type 293T cells are seeded into the cell crawling slide at the same cell volume. When the cell confluence reaches 60-80%, the culture medium is removed, 4% paraformaldehyde is added for fixation, and the cells are washed with PBS to obtain the cell crawling slide.

9. A method for detecting MOG-IgG based on stable transgenic cells with specific MOG subtype combinations, characterized in that, Includes the following steps: (1) The monoclonal stable cell line described in claim 5 and wild-type 293T cells were seeded into cell slides at the same cell volume. When the cell confluence reached 60-80%, the culture medium was removed and 4% paraformaldehyde was added for fixation at room temperature. (2) Wash the cells with PBS and block them at room temperature with goat serum blocking solution; (3) Remove the blocking solution, add clinical serum diluted with PBS, and incubate overnight; (4) Wash cells with PBST, add anti-human IgG-ALEXA FLUOR 568 fluorescent secondary antibody, and incubate at room temperature in the dark; (5) Wash cells with PBST, mount with mounting medium containing Dapi, examine and photograph under a fluorescence microscope.

10. The detection method according to claim 9, characterized in that, The fixed time in step (1) is 20 minutes; the closed time in step (2) is 1 hour; the overnight incubation in step (3) is overnight incubation at 4°C; the room temperature incubation in step (4) is 1 hour incubation in the dark.

Images