Random combinatorial library, establishment method thereof and application of random combinatorial library in screening H9 subtype avian influenza virus nano antibody

Abstract

The invention belongs to the technical field of nano antibody libraries, and particularly relates to a random combinatorial library, an establishment method thereof and application of the random combinatorial library in screening of H9 subtype avian influenza virus nano antibodies. The library is obtained by connecting a fragment containing a CDR1 region, a fragment containing a CDR2 region and a fragment containing a CDR3 region which are respectively amplified by three pairs of PCR amplification primers, and the sequences of the three pairs of PCR amplification primers are respectively SEQ ID NO: 1-SEQ ID NO: 6. The positive rate of the library is 95.8%, and the capacity of the library is 2.7 * 10 < 9 >. In the library, the positive rate of the nano antibody capable of being combined with the H9 subtype avian influenza virus is 60%. According to the invention, the blank of the random combinatorial library aiming at the H9 subtype avian influenza virus nano antibody is filled, and a new way and strategy are provided for the establishment of the random combinatorial library aiming at the H9 subtype avian influenza virus nano antibody.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of nanobody library, and particularly relates to a random combination library, a method for establishing the same and use of the random combination library in screening of nanobodies against H9 subtype avian influenza virus. BACKGROUND

[0002] H9N2 subtype avian influenza virus is a low pathogenic avian influenza virus. At present, H9 subtype avian influenza has a high prevalence rate in China. Compared with H5 and H7 HPAIV, H9 LPAIV can be clinically latent infection, and when the external environment changes dramatically or is subjected to secondary infection, it can cause large-scale death of poultry. In addition to poultry, H9 LPAIV can naturally infect mammals such as pigs, ferrets, guinea pigs and humans, and research shows that when H9 and H7N9, H5N1 and H5N6 subtypes are mixedly infected, they can provide internal genes for HPAIV, accelerate the evolution of the virus, and produce new strains with epidemic potential, making it more difficult to prevent and control influenza, and seriously endangering the health and safety of the public. In recent years, although H9 subtype avian influenza vaccine has been widely used, the outbreak and prevalence of the disease have been significantly reduced, but the disease has shown new epidemic characteristics, such as virus production, immune escape and mixed infection, making the prevention and control of H9 subtype avian influenza more complex, directly and indirectly causing huge economic losses, and facing new challenges in prevention and control. Therefore, it has become an urgent scientific and practical problem to seek prevention and control of H9 subtype avian influenza. More attention should be paid to the fact that there is a lack of specific prevention and control products for atypical symptoms in immunized poultry in clinical practice. Therefore, it is urgent to develop safe, efficient, inexpensive and easy-to-standardize biological therapeutic agents.

[0003] A nanobody is an antibody fragment composed of only a single heavy chain antibody variable region (VHH), and the domain of the nanobody contains four conserved framework regions (FR) and three hypervariable complementarity-determining regions (CDR). The nanobody only exhibits a minimal functional antigen binding activity region. Due to the characteristics of the nanobody, such as small relative molecular mass, strong specificity, high affinity, high stability, good solubility, strong tissue penetration, low production cost, modular form, weak immunogenicity and the like, the nanobody has become a hotspot in the field of developing new biological therapeutic agents.

[0004] At present, the libraries of nanobodies mainly include natural libraries, immune libraries and randomly synthesized libraries, each of which is suitable for different antigens and has different advantages and disadvantages. However, there is no report on a random combination library of nanobodies against H9 subtype avian influenza virus. SUMMARY

[0005] Therefore, in order to fill the blank of the random combination library for the nanobody against the H9 subtype avian influenza virus, the present application provides a random combination library and a method for establishing the same and use of the same in screening the nanobody against the H9 subtype avian influenza virus

[0006] The technical solution adopted by the present application to solve the technical problems is as follows:

[0007] The random combination library of the present application is obtained by connecting the fragments containing the CDR1 region, the fragments containing the CDR2 region and the fragments containing the CDR3 region amplified by three pairs of PCR amplification primers, and the sequences of the three pairs of PCR amplification primers are SEQ ID NO:1-SEQ ID NO:6, respectively.

[0008] Preferably, the positive rate of the library is 95.8%.

[0009] Preferably, the library capacity of the library is 2.7x10 9 .

[0010] Preferably, in the library, the positive rate of the nanobody capable of combining with the H9 subtype avian influenza virus is 60%.

[0011] The method for establishing the random combination library of the present application comprises the following steps:

[0012] The fragments containing the CDR1 region, the fragments containing the CDR2 region and the fragments containing the CDR3 region are amplified by PCR using the llama peripheral blood lymphocyte cDNA as the template and using primer 1-primer 6, and each of the recovered fragments is not a single band or a single sequence, but is combined by multiple sequences, and the length of each fragment is 120bp-160bp. The recovered fragments are connected by a homologous recombinase, and then are subjected to digestion treatment with restriction endonuclease Sac I and Spe I, and then are connected using T4 ligase and are transformed into E. coli TG1 competent cells. The next day, single colonies are picked for bacterial liquid PCR identification, and the library is successfully established.

[0013] The fragments containing the CDR1 region, the fragments containing the CDR2 region and the fragments containing the CDR3 region are amplified by PCR using the llama peripheral blood lymphocyte cDNA as the template and using primer 1-primer 6, and each of the recovered fragments is not a single band or a single sequence, but is combined by multiple sequences, and the length of each fragment is 120bp-160bp. The recovered fragments are connected by a homologous recombinase, and then are subjected to digestion treatment with restriction endonuclease Sac I and Spe I, and then are connected using T4 ligase and are transformed into E. coli TG1 competent cells. The next day, single colonies are picked for bacterial liquid PCR identification, and the library is successfully established.

[0014] Specifically, the sequences amplified using primer 1-primer 6 based on SEQ ID NO:7 are named A1 / B1 / C1, corresponding to SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, respectively.

[0015] Specifically, the sequences amplified based on SEQ ID NO: 8 using primer 1-primer 6 are named A2 / B2 / C2, corresponding to SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, respectively.

[0016] Specifically, the sequences amplified based on SEQ ID NO: 9 using primer 1-primer 6 are named A3 / B3 / C3, corresponding to SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, respectively.

[0017] Specifically, the sequences amplified based on SEQ ID NO: 10 using primer 1-primer 6 are named A4 / B4 / C4, corresponding to SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, respectively.

[0018] Specifically, the sequences amplified based on SEQ ID NO: 11 using primer 1-primer 6 are named A5 / B5 / C5, corresponding to SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, respectively.

[0019] Specifically, the PCR reaction information is as follows:

[0020] Segment 1:

[0021] Reaction system: 1 μL of primer 1 / primer 2, 10 μL of ApexHF HS DNA polymerase, 10 μL of ddH2O, 2 μL of template; the template is a cDNA fragment of peripheral blood lymphocytes of alpaca;

[0022] Reaction condition: 94°C pre-denaturation for 10 min, 94°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 30 s, 35 cycles, 72°C re-extension for 10 min;

[0023] Segment 2:

[0024] Reaction system: 1 μL of primer 3 / primer 4, 10 μL of ApexHF HS DNA polymerase, 10 μL of ddH2O, 2 μL of template; the template is a mixed product fragment after segment 1 amplification;

[0025] Reaction condition: 94°C pre-denaturation for 10 min, 94°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 30 s, 35 cycles, 72°C re-extension for 10 min;

[0026] Segment 3:

[0027] Reaction system: 1 μL of primer 5 / 1 μL of primer 6, 10 μL of Apex HF HS DNA polymerase, 10 μL of ddH2O, 2 μL of template; the template is the mixed product segment after segment 2 amplification;

[0028] Reaction condition: 94 ℃ pre-denaturation for 10 min, 94 ℃ denaturation for 30 s, 56 ℃ annealing for 30 s, 72 ℃ extension for 30 s, 35 cycles, and 72 ℃ re-extension for 10 min.

[0029] The application provides a use of a random combination library in screening of a nanobody against an H9 subtype avian influenza virus.

[0030] The application has the following beneficial effects:

[0031] The application successfully establishes a random combination library of nanobodies against an H9 subtype avian influenza virus, fills a blank of the random combination library of nanobodies against the H9 subtype avian influenza virus, and provides a new approach and strategy for establishing the random combination library of nanobodies against the H9 subtype avian influenza virus.

[0032] Compared with a positive rate of 70.8% (17 / 24) of a common library, the application improves the positive rate and diversity of the random combination library of nanobodies against the H9 subtype avian influenza virus.

[0033] Compared with a library capacity of 9.6*10 8 The application improves the library capacity of the random combination library of nanobodies against the H9 subtype avian influenza virus.

[0034] Compared with a positive rate of 40% (20 / 50) of a common library, the application improves the positive rate of nanobodies capable of combining with the H9 subtype avian influenza virus in the random combination library of nanobodies against the H9 subtype avian influenza virus. BRIEF DESCRIPTION OF DRAWINGS

[0035] Figure 1 is a schematic diagram of a VHH region composed of a conservative framework region FR and a hypervariable complementarity determining region CDR in the order of FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0036] Figure 2 is an identification result of the random combination library of nanobodies against the H9 subtype avian influenza virus established by the application and a common library.

[0037] Figure 3 is a library capacity result of the random combination library of nanobodies against the H9 subtype avian influenza virus established by the application and a common library.

[0038] Figure 4The specificity nanobody identification results of the random combination library and the common library of nanobody against H9 subtype avian influenza virus established by the application. DETAILED DESCRIPTION

[0039] The technical solutions of the application will be described clearly and completely in the following combined with the specific embodiments of the application. Obviously, the described specific embodiments are only a part of the specific embodiments of the application, instead of all the specific embodiments. Based on the specific embodiments in the application, all the other specific embodiments obtained by the person skilled in the art without making creative efforts are within the protection scope of the application.

[0040] I. Test materials

[0041] The H9 subtype avian influenza inactivated vaccine HP strain was purchased from Jiangsu Yangzhou Weike Biological Engineering Co., Ltd. of China National Pharmaceutical Group;

[0042] The 2-year-old male alpacas were purchased from Jiangsu Dengyuanhe Biological Technology Co., Ltd.;

[0043] The camel peripheral blood lymphocyte separation medium was purchased from Beijing Solabio Technology Co., Ltd.;

[0044] The RNA extraction kit and reverse transcription kit were purchased from Nanjing Novozyme Biological Technology Co., Ltd.;

[0045] The pComb3Xss plasmid was purchased from Nanjing Wingsnow Biological Technology Co., Ltd.;

[0046] The restriction endonucleases SacI and SpeI were purchased from Baodai Medical Biological Technology (Beijing) Co., Ltd.;

[0047] The T4 ligase was purchased from Baodai Medical Biological Technology (Beijing) Co., Ltd.;

[0048] The E. coli TG1 competence was purchased from Shanghai Weidi Biological Technology Co., Ltd.;

[0049] The homologous recombinase was purchased from Novozyme Co., Ltd.;

[0050] The phage display plasmid pComb3XSS was purchased from Nanjing Wingsnow Biological Technology Co., Ltd.

[0051] II. Establishment of a VHH phage library of immunized alpaca

[0052] 1. Inject 2-year-old male alpacas with H9 subtype avian influenza inactivated vaccine HP strain by subcutaneous injection in the neck, with an injection volume of 2 mL per animal. Reinoculate the animals once on the 14th, 28th, 42nd, and 56th days after immunization. Collect the peripheral blood of the alpacas on the 63rd day. First, separate the peripheral blood lymphocytes of the alpacas using a camel peripheral blood lymphocyte separation medium. Then, extract the RNA and reverse transcribe it into cDNA using an RNA extraction kit and a reverse transcription kit, thereby obtaining the peripheral blood lymphocyte cDNA of the alpacas. Amplify the heavy chain antibody variable region VHH sequence of the alpaca antibodies through two rounds of nested PCR.

[0053] The primer sequence information for the two rounds of nested PCR amplification is as follows:

[0054] The first round of PCR amplification primers are as follows:

[0055] CALL-1: GTCCTGGCTGCTCTTCTACAAGG;

[0056] CALL-2: GGTACGTGCTGTTGAACTGTTCC;

[0057] The second round of PCR amplification primers are as follows

[0058] VHH-F: GAGCTCATGGATGTGCAGCTGGT;

[0059] VHH-R: ACTAGTTGAGGAGACGGTGACCT.

[0060] The two rounds of nested PCR amplification primers described above are synthesized by Beijing Chengke Biotechnology Co., Ltd.

[0061] 2. Digest the obtained VHH sequence and pComb3Xss plasmid with restriction enzymes Sac I and Spe I, then link them using T4 ligase and transform them into 10 E. coli TG1 competent cells. The next day, pick 20 single colonies for bacterial liquid PCR. The results show that 20 single colonies are positive, and after sequencing identification, the sequences of the 20 single colonies are all different, indicating that the positive rate of the VHH phage library of the immunized alpaca is 100% (20 / 20), and the diversity is relatively rich (20 / 20). The VHH phage library of the immunized alpaca is successfully established, and according to the plate count and dilution ratio, the library capacity of the VHH phage library of the immunized alpaca is estimated to be 4.8 x 10 8

[0062] III. Design of PCR amplification primers for the complementarity determining region (CDR) of the H9 subtype avian influenza virus nanobody

[0063] ​Randomly select 20 VHH sequences from the VHH phage library of the immunized alpaca, and design three pairs of PCR amplification primers according to the 20 VHH sequence information, which are primers for the complementarity determining region (CDR) in the H9 subtype avian influenza virus nanobody (Table 1).

[0064] Table 1 Three pairs of PCR amplification primers

[0065] Name Sequence Primer 1 gagctcatatggatgtgcagctgca Primer 2 tcacgctccttccctgg Primer 3 gggaaggagcgtgagt Primer 4 tgtctctggagatggtgaa Primer 5 ctccagagacaacgccaag Primer 6 actagtgatgaggagacggtgacct

[0066] In the present application, the sequence of primer 1 is gagctcatatggatgtgcagctgca, which is supplemented with the start codon atg after the Sac I enzyme cutting sequence, and pComb3XSS is a prokaryotic expression vector, which can start reading based on the first start codon atg of the subsequent inserted fragment, so as not to cause misplacement, and can be correctly expressed in the correct reading frame.

[0067] Four, PCR amplification of the complementarity determining region (CDR) in the H9 subtype avian influenza virus nanobody

[0068] The method described in the present application is a general strategy, which mainly designs primers based on the conserved FR1, FR2, FR3 and FR4 of the nucleotide sequence encoding the nanobody sequence of the alpaca source, designs primer 1 based on FR1, designs primer 2 and primer 3 based on FR2, designs primer 4 and primer 5 based on FR3, and designs primer 6 based on FR4. The purpose is to use the peripheral blood lymphocyte cDNA of the alpaca containing the nanobody sequence information as a template to perform PCR amplification according to the method described in the present application, the template is not a single sequence, and the method described in the present application is not based on error-prone PCR to amplify the library capacity.

[0069] In the above three pairs of PCR amplification primers, primer 1 (SEQ ID NO: 1) and primer 2 (SEQ ID NO: 2) are used to amplify the fragment containing the CDR1 region, and the sequence of primer 1 contains Sac I and Spe I enzyme cutting sites; primer 3 (SEQ ID NO: 3) and primer 4 (SEQ ID NO: 4) are used to amplify the fragment containing the CDR2 region; primer 5 (SEQ ID NO: 5) and primer 6 (SEQ ID NO: 6) are used to amplify the fragment containing the CDR3 region, and the sequence of primer 6 contains Sac I and Spe I enzyme cutting sites.

[0070] Using the peripheral blood lymphocyte cDNA of the alpaca as a template, the fragments containing the CDR1 region, the fragments containing the CDR2 region and the fragments containing the CDR3 region are amplified by PCR using primer 1 to primer 6, respectively. Each recovered fragment is not a single band or a single sequence, but a combination of multiple sequences, and each fragment has a length of 120bp-160bp.

[0071] Referring to Figure 1 , 4 FRs (FR1, FR2, FR3, FR4) and 3 CDRs (CDR1, CDR2, CDR3) are arranged in the order of FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0072] The PCR amplification reaction information is as follows:

[0073] Segment 1:

[0074] The reaction system was 1 μL of primer 1 / 1 μL of primer 2, 10 μL of ApexHF HS DNA polymerase, 10 μL of ddH2O, and 2 μL of template; the template was a cDNA fragment obtained by original reverse transcription (cDNA fragment of peripheral blood lymphocytes of alpaca).

[0075] The reaction condition was 10 min of pre-denaturation at 94℃, 30 s of denaturation at 94℃, 30 s of annealing at 56℃, 30 s of extension at 72℃, 35 cycles, and 10 min of re-extension at 72℃.

[0076] Segment 2:

[0077] The reaction system was 1 μL of primer 3 / 1 μL of primer 4, 10 μL of ApexHF HS DNA polymerase, 10 μL of ddH2O, and 2 μL of template; the template was a mixed product fragment after segment 1 amplification.

[0078] The reaction condition was 10 min of pre-denaturation at 94℃, 30 s of denaturation at 94℃, 30 s of annealing at 56℃, 30 s of extension at 72℃, 35 cycles, and 10 min of re-extension at 72℃.

[0079] Segment 3:

[0080] The reaction system was 1 μL of primer 5 / 1 μL of primer 6, 10 μL of ApexHF HS DNA polymerase, 10 μL of ddH2O, and 2 μL of template; the template was a mixed product fragment after segment 2 amplification.

[0081] The reaction condition was 10 min of pre-denaturation at 94℃, 30 s of denaturation at 94℃, 30 s of annealing at 56℃, 30 s of extension at 72℃, 35 cycles, and 10 min of re-extension at 72℃.

[0082] The following examples illustrate that the cDNA shown in SEQ ID NO: 7-SEQ ID NO: 11 is used as a demonstration amplification template sequence, and the above three pairs of PCR amplification primers are used to amplify the fragments containing CDR1 region, the fragments containing CDR2 region and the fragments containing CDR3 region, respectively. Each of the recovered fragments is not a single band or a single sequence, but a combination of multiple sequences, and each fragment has a length of about 120bp-160bp.

[0083] Specifically, the sequences amplified based on SEQ ID NO: 7 using primer 1-primer 6 are named as A1 / B1 / C1 (SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14), respectively.

[0084] Specifically, the sequences amplified based on SEQ ID NO: 8 using primer 1-primer 6 are named as A2 / B2 / C2 (SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17), respectively.

[0085] Specifically, the sequences amplified based on SEQ ID NO: 9 using primer 1-primer 6 are named as A3 / B3 / C3 (SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20), respectively.

[0086] Specifically, the sequences amplified based on SEQ ID NO: 10 using primer 1-primer 6 are named as A4 / B4 / C4 (SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23), respectively.

[0087] Specifically, the sequences amplified based on SEQ ID NO: 11 using primer 1-primer 6 are named as A5 / B5 / C5 (SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26), respectively.

[0088] In the present application, primer 2 and primer 3, primer 4 and primer 5 recombine with each other in the overlap extension process, based on which, the above-mentioned CDR1, CDR2 and CDR3 of the amplification template sequence of SEQ ID NO: 7-SEQ ID NO: 11 are paired with each other, and theoretically, 125 different nucleotide sequence information can be obtained from the complete random recombination sequencing results of A1 / B1 / C1-A5 / B5 / C5 segments. Therefore, by taking SEQ ID NO: 7-SEQ ID NO: 11 as templates and performing amplification according to the method of the present application, the sequences of SEQ ID NO: 27-SEQ ID NO: 36 are obtained by sequencing after being cleaved and linked to the pComb3XSS vector, and there is no repeated sequence, so it is feasible to obtain a large capacity library volume by performing amplification according to the method of the present application.

[0089] V. Establishing a random combination library of nanobodies against H9 subtype avian influenza virus

[0090] The above-mentioned recovered fragments (i.e. the fragments containing CDR1 region, the fragments containing CDR2 region and the fragments containing CDR3 region amplified by PCR using primer 1-primer 6 with the cDNA of the peripheral blood lymphocytes of the alpaca as a template) are connected by a homologous recombination enzyme, then are subjected to digestion treatment with restriction endonucleases Sac I and Spe I, and then are connected with the phage display plasmid pComb3XSS using T4 ligase and are transformed into E. coli TG1 competent cells. The next day, 24 single colonies are picked and subjected to bacterial liquid PCR identification. See Figure 2 The 24 picked single colonies are all positive, and sequencing identification shows that the sequences of the 24 single colonies are all different, which indicates that the positive rate of the random combination library is about 95.8% (23 / 24), and the diversity is relatively rich (23 / 23), and the random combination library of nanobodies against H9 subtype avian influenza virus is successfully established. See Figure 3 According to the plate count and dilution ratio, it can be deduced that the library capacity of the random combination library of nanobodies against H9 subtype avian influenza virus is 2.7×10 9 .

[0091] Compared with the positive rate of 70.8% (17 / 24) of the common library, the present application improves the positive rate and diversity of the random combination library of nanobodies against H9 subtype avian influenza virus.

[0092] Compared with the library capacity of 9.6×10 8 , the present application improves the library capacity of the random combination library of nanobodies against H9 subtype avian influenza virus.

[0093] VI. Screening and identification process of nanobodies against H9 subtype avian influenza virus

[0094] After coating the H9 subtype avian influenza inactivated vaccine HP strain on the enzyme label plate, the VHH sequence capable of binding with the H9 subtype avian influenza virus is screened from the random combination library of nanobodies against the H9 subtype avian influenza virus by using the antibody library solid-phase screening technology.

[0095] The ELISA detection result is shown in Figure 4 The results show that the positive rate of the nanobodies capable of binding with the H9 subtype avian influenza virus in the random combination library of nanobodies against the H9 subtype avian influenza virus is 60% (30 / 50). Compared with the positive rate of 40% (20 / 50) of the common library, the positive rate of the nanobodies capable of binding with the H9 subtype avian influenza virus in the random combination library of nanobodies against the H9 subtype avian influenza virus is improved.

[0096] From the above experiments and results, it can be known that the random combination library of nanobodies against the H9 subtype avian influenza virus is successfully established, the positive rate of the random combination library is 95.8% (23 / 24), and the library capacity is 2.7×10 9 Compared with the common library, the positive rate and the library capacity of the random combination library are higher.

[0097] The positive rate of the nanobodies capable of binding with the H9 subtype avian influenza virus in the random combination library of nanobodies against the H9 subtype avian influenza virus established by the application is 60% (30 / 50), and the random combination library has more specific nanobodies compared with the common library.

[0098] Finally, it should be noted that: the above specific embodiments are only used to illustrate the technical solutions of the application, and not to limit them; although the application has been described in detail with reference to the foregoing specific embodiments, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacement to part of the technical features, but these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the application.

Claims

1. A randomly combined library, characterized in that, The library was obtained by ligating fragments containing the CDR1 region, the CDR2 region, and the CDR3 region, which were amplified by three pairs of PCR amplification primers, respectively. The sequences of the three pairs of PCR amplification primers are SEQ ID NO:1-SEQ ID NO:6, respectively.

2. The random combination library according to claim 1, characterized in that, The positive rate of the library was 95.8%.

3. The random combination library according to claim 1, characterized in that, The library has a capacity of 2.7 × 10⁻⁶. 9 indivual.

4. The random combination library according to claim 1, characterized in that, The library showed a positivity rate of 60% for nanobodies that could bind to the H9 subtype avian influenza virus.

5. The method for establishing a randomly combined library as described in claim 1, characterized in that, Includes the following steps: Using alpaca peripheral blood lymphocyte cDNA as a template, fragments containing the CDR1 region, CDR2 region, and CDR3 region were amplified by PCR using primers 1-6. Each recovered fragment was not a single band or a single sequence, but a combination of multiple sequences, with each fragment being 120-160 bp in length. The recovered fragments were ligated using homologous recombinase, then digested with the phage display plasmid pComb3XSS using restriction endonucleases Sac I and Spe I, followed by ligation with T4 ligase and transformation into E. coli TG1 competent cells. Single colonies were picked the next day for colony PCR identification, successfully establishing the library.

6. The method for establishing a randomly combined library according to claim 5, characterized in that, Using the cDNA shown in SEQ ID NO:7-SEQ ID NO:11 as the demonstration amplification template sequence, the fragments containing the CDR1 region, the fragments containing the CDR2 region, and the fragments containing the CDR3 region were amplified by PCR using primers 1-6, respectively. Based on SEQ ID NO:7, the amplified sequences using primers 1-6 were named A1 / B1 / C1, corresponding to SEQ ID NO:12, SEQ ID NO:13, and SEQ ID NO:14, respectively. Based on SEQ ID NO:8, the amplified sequences using primers 1 to 6 are named A2 / B2 / C2, corresponding to SEQ ID NO:15, SEQ ID NO:16, and SEQ ID NO:17, respectively. Based on SEQ ID NO:9, the amplified sequences using primers 1 to 6 were named A3 / B3 / C3, corresponding to SEQ ID NO:18, SEQ ID NO:19, and SEQ ID NO:20, respectively. Based on SEQ ID NO:10, the amplified sequences using primers 1 to 6 are named A4 / B4 / C4, corresponding to SEQ ID NO:21, SEQ ID NO:22, and SEQ ID NO:23, respectively. Based on SEQ ID NO:11, the amplified sequences using primers 1 to 6 were named A5 / B5 / C5, corresponding to SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:26, respectively.

7. The method for establishing a randomly combined library according to claim 5, characterized in that, The PCR amplification reaction information is as follows: Segment 1: Reaction system: 1 μL each of primer 1 and primer 2, 10 μL of ApexHF HSDNA polymerase, 10 μL of ddH2O, and 2 μL of template; the template is a cDNA fragment from alpaca peripheral blood lymphocytes. Reaction conditions: 94℃ pre-denaturation for 10 min, 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles, 72℃ extension for 10 min. Segment 2: Reaction system: 1 μL each of primer 3 and primer 4, 10 μL of ApexHF HS DNA polymerase, 10 μL of ddH2O, and 2 μL of template; the template is the mixed product fragment after amplification of segment 1. Reaction conditions: 94℃ pre-denaturation for 10 min, 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles, 72℃ extension for 10 min. Segment 3: Reaction system: 1 μL each of primer 5 and primer 6, 10 μL of ApexHF HSDNA polymerase, 10 μL of ddH2O, and 2 μL of template; the template is the mixed product fragment after amplification of segment 2. Reaction conditions: 94℃ pre-denaturation for 10 min, 94℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles, 72℃ extension for 10 min.

8. The use of a randomized library as described in claim 1 in screening H9 subtype avian influenza virus nanobodies.

Images