UMAD1 gene molecular marker primer related to chicken continuous production character and application of UMAD1 gene molecular marker primer

By using PCR amplification with UMAD1 gene molecular marker primers and Sanger sequencing, the SNP molecular marker genotype of the UMAD1 gene was detected, which solved the problem of difficulty in identifying continuous laying traits in chicken breeding and improved egg production and breeding efficiency.

CN121109618AActive Publication Date: 2025-12-12NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511678749.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-17
Publication Date
2025-12-12
Estimated Expiration
2045-11-17

Smart Images

  • Figure CN121109618A_ABST
    Figure CN121109618A_ABST
Patent Text Reader

Abstract

The invention relates to a UMAD1 gene molecular marker primer related to chicken continuous laying traits and application of the UMAD1 gene molecular marker primer, and belongs to the technical field of biology. The UMAD1 gene molecular marker is located at the 24741087th basic group of a chromosome 2 of a chicken reference genome GRCg7b version, the basic group is mutated into G or T, and the genotypes are G / G, G / T and T / T. The total continuous production length of the T / T genotype chicken is higher than that of the G / T and G / G genotype individuals, and the total continuous production length of the G / T genotype chicken is higher than that of the G / G genotype individuals. According to the present invention, the forward and reverse primer pair is used to amplify the fragment containing the molecular marker site, and the amplification product is subjected to Sanger sequencing so as to rapidly and accurately identify the genotype of the individual; the molecular marker can be used as a genetic marker for chicken breeding, can efficiently and accurately detect the continuous laying character of chicken, improves the total egg laying number of chicken flocks, and has important value for chicken breeding and production.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a UMAD1 gene molecular marker primer related to chicken continuous laying traits and application thereof, and belongs to the technical field of biotechnology. BACKGROUND

[0002] The development of follicle is a continuous process: once the primordial follicle is activated, a clear hierarchical system is formed in the ovary according to the functional state. Near ovulation, 5-7 yellow pre-ovulatory follicles in a hierarchical distribution can be observed; these hierarchical follicles ovulate in turn, and the average interval between two adjacent ovulations is 24-27 hours, and the shortest interval is slightly higher than 21 hours. This ovulation rhythm makes the hens appear the phenomenon of continuous egg production.

[0003] The total continuous laying length of chicken is positively correlated with the egg production, and many studies at home and abroad show that continuous selection on the continuous laying traits can effectively improve the egg production. The ovulation rhythm of poultry is dominated by the biological clock and is regulated by the daily light-dark cycle, and a luteinizing hormone (LH) peak appears before ovulation, accompanied by the growth and maturation of follicle. The longer the total continuous laying length is, the higher the egg production is, and it is one of the important indicators for measuring the reproductive performance of poultry. At present, there is a lack of gene molecular markers that can accurately identify the continuous laying traits of chicken, and they are applied to breeding selection to quickly identify the corresponding traits for early screening. SUMMARY

[0004] The purpose of the present application is to provide a UMAD1 gene molecular marker primer related to chicken continuous laying traits and application thereof to solve the problems in the prior art, which can quickly detect and screen the continuous laying traits of chicken.

[0005] The present application records the individual egg production records of recessive white Lohmann hens from the onset of laying to 36 weeks of age, calculates the total continuous laying length, performs SNP genotyping by using whole genome resequencing technology, and screens the UMAD1 gene molecular marker significantly related to the total continuous laying length of chicken by whole genome association analysis, thereby providing a new gene and molecular marker resource for the selection of chicken continuous laying traits.

[0006] UMAD1 gene is located on the short arm of chromosome 2, which is a protein-coding gene with dual identity of 'endosomal-ubiquitin homeostatic regulator' and'synaptic plasticity regulator'. UMAD1 gene is associated with the quantitative trait locus related to eggshell color in chicken. It can be inferred that: on the one hand, UMAD1 regulates synaptic plasticity and endosomal-ubiquitin homeostasis to affect the neuroendocrine axis, and then regulates gonadotropin releasing hormone / luteinizing hormone (GnRH / LH) secretion and laying length; on the other hand, the signal of UMAD1 in GWAS of obesity indicates that it can affect the energy balance required for egg production through energy metabolism-insulin pathway; at the same time, the gene is co-located with the eggshell color QTL, which suggests that it may be a pleiotropic locus, and the same variation can affect eggshell pigment deposition and laying length at the same time.

[0007] The application solves the technical problem by the following technical scheme: first, a UMAD1 gene molecular marker primer related to chicken laying traits is provided, the molecular marker is located at the 24741087th base on chicken chromosome 2, the base mutation is G or T, the 252th base sequence is shown in SEQ ID NO: 3 or SEQ ID NO: 4, and the nucleotide sequence of the chicken DNA specific primer pair required for molecular marker detection is shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0008] The application further provides the application of the specific primer, including the application for detecting the SNP genotype related to the laying traits of recessive white Leghorn chickens. The application is specifically applied to a method for detecting the SNP genotype related to the laying traits of chickens by PCR amplification combined with Sanger sequencing, and includes the following steps: Step 1, providing a chicken DNA sample to be tested, and performing PCR amplification on the chicken DNA sample by using a DNA specific primer pair to obtain an amplification product, wherein the chicken DNA sample to be tested contains a SNP molecular marker of the 24741087th base on chicken chromosome 2; Step 2, performing Sanger sequencing on the PCR product; Step 3, judging the genotype of the SNP molecular marker of the 24741087th base on chicken chromosome 2 according to the sequencing result of step 2.

[0009] The deoxyribonucleotide sequence of the chicken DNA specific primer pair in step 1 is as follows: Upstream primer: 5'-TGAGTAAAGTCTGCCCGAAGA-3' (SEQ ID NO: 1) Downstream primer: 5'-CTGTTTGGAGTTTGTGTAGTAGC-3' (SEQ ID NO: 2) The amplification product in step 1 has a length of 366 bp and contains the 24741087th base on chicken chromosome 2.

[0010] The final volume of the reaction system (25 μl) is: 50 ng of chicken DNA to be tested 2 x Accurate Taq Master Mix 12.5 μl 1 μl of upstream primer 1 μl of downstream primer sterilized water, supplemented to 25 μl, The reaction conditions of the PCR amplification are as follows: 5 min of pre-denaturation at 94℃; 27 cycles of denaturation at 94℃ for 30 sec, annealing at 60℃ for 30 sec, extension at 72℃ for 60 sec; 5 min of extension at 72℃; and storage at 4℃.

[0011] The nucleotide sequence of the amplification product is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0012] In the third step, the judgment standard is that the total clutch length of a chicken with the SNP site of T / T genotype is higher than that of a chicken with the SNP site of G / T and G / G genotype, and the total clutch length of a chicken with the SNP site of G / T genotype is higher than that of a chicken with the SNP site of G / G genotype.

[0013] The present application detects the genotype of the chicken clutch trait by the UMAD1 gene molecular marker, finds that the total clutch length of a chicken with the SNP site of T / T genotype is higher than that of a chicken with the SNP site of G / T and G / G genotype, and the total clutch length of a chicken with the SNP site of G / T genotype is higher than that of a chicken with the SNP site of G / G genotype. By taking the genomic DNA of a chicken to be tested as a template, the specific primer is used for PCR amplification, and then the PCR amplification product is subjected to Sanger sequencing and SNP molecular marker genotyping, the genotype based on the SNP molecular marker can realize the selection of the chicken clutch trait. In breeding, according to the breeding target, the individuals with the SNP site of G / G and G / T genotype are eliminated, and the individuals with the SNP site of T / T genotype are reserved, and the beneficial effects are that the molecular marker can be used as a genetic marker for chicken breeding, can efficiently and rapidly identify the chicken clutch trait, and can improve the total number of eggs laid by a chicken population, provides a scientific basis for early selection, and has important value for chicken breeding. In addition, the detection method disclosed by the present application is simple and easy to operate, and can be carried out in a laboratory. BRIEF DESCRIPTION OF DRAWINGS

[0014] Figure 1 is a Manhattan plot of the total clutch length of a chicken.

[0015] Figure 2 is the Sanger sequencing result of the PCR amplification product of three genotypes. DETAILED DESCRIPTION

[0016] The following examples are suitable for the breeding of chickens.

[0017] Example 1 This example statistically analyzes the total length of continuous laying of White Leghorn hens from the beginning of laying to 36 weeks of age, uses second-generation sequencing technology for whole genome SNP genotyping, and screens for UMAD1 gene molecular markers significantly associated with the continuous laying trait by whole genome association analysis, and the results are shown in Figure 1 .

[0018] This example identifies and applies the UMAD1 gene molecular marker associated with the chicken continuous laying trait through the following experiments.

[0019] 1. Phenotype determination and genotype detection (1) Experimental materials and phenotype determination Select 2598 White Leghorn hens as test animals, raise them under the same feeding conditions, and continuously record the laying time of each hen from the beginning of laying, and calculate the total length of continuous laying as the phenotype data.

[0020] (2) Extraction of genomic DNA Blood was collected from the subwing vein of the test individual, anticoagulated, lysed, digested with proteinase K, extracted with the saturated sodium chloride method, dissolved in TE, and stored at -20°C.

[0021] (3) PCR amplification The above extracted genomic DNA was used as a template to amplify the fragment containing the 24741087th base on chromosome 2.

[0022] Upstream primer: 5'-TGAGTAAAGTCTGCCCGAAGA-3' (SEQ ID NO: 1) Downstream primer: 5'-CTGTTTGGAGTTTGTGTAGTAGC-3' (SEQ ID NO: 2) The final volume of the reaction system (25 μl) is: Test DNA 50 ng 2x Accurate Taq Master Mix 12.5 μl Upstream primer 1 μl Downstream primer 1 μl Sterile water to 25 μl.

[0023] PCR amplification reaction conditions: 94℃ pre-denaturation 5 min; 94℃ denaturation 30 sec, 60℃ annealing 30 sec, 72℃ extension 60 sec, 27 cycles in total; 72℃ extension 5 min; 4℃ preservation; 10 μl was taken for agarose detection, and the length of the single target band of the amplification product was 366 bp, and the SNP molecular marker at the 24741087 base site of chicken chromosome 2 was contained; the sequence of the amplification product was as follows: SEQ ID NO: 3 TGAGTAAAGTCTGCCCGAAGATTAGCTGCTGTACTGTTTTTGCCTTTTCTGAGGACAGAGTAAATGGATTTATGTTTTATTTTATGTGGAGACTGCCTAATTCTTAACCTCTTTTGTTGGTTTGCCTTTAGATTTTAGATCTCCTTCCTGAGGCTGAGGGAGTTCAGAAGGTTGTAGCAATAAAATGAAATTAATGTTCTAAACCAAAACTGATGTATCAAGGAGCTTTAGAGGTAGAGGTGCCTGAATAAGGTCTTATAATTGCTTTTGGATGTAGGTTTTCCTTCTTTCATGTTTACAACCATTGTGTAAAACCTTTAGATTTATTCATAAGCTTGTATTTGCTACTACACAAACTCCAAACAG SEQ ID NO: 4 TGAGTAAAGTCTGCCCGAAGATTAGCTGCTGTACTGTTTTTGCCTTTTCTGAGGACAGAGTAAATGGATTTATGTTTTATTTTATGTGGAGACTGCCTAATTCTTAACCTCTTTTGTTGGTTTGCCTTTAGATTTTAGATCTCCTTCCTGAGGCTGAGGGAGTTCAGAAGGTTGTAGCAATAAAATGAAATTAATGTTCTAAACCAAAACTGATGTATCAAGGAGCTTTAGAGGTAGAGGTGCCTGAATAATGTCTTATAATTGCTTTTGGATGTAGGTTTTCCTTCTTTCATGTTTACAACCATTGTGTAAAACCTTTAGATTTATTCATAAGCTTGTATTTGCTACTACACAAACTCCAAACAG.

[0024] (4) Sanger sequencing and genotyping The PCR products of each sample were subjected to Sanger sequencing, respectively, and the sequencing peak graphs of different genotypes obtained are shown in Figure 2 .

[0025] 2. Correlation analysis Select 2598 individuals of recessive white Lohmann chickens with clear phenotype records for correlation analysis. The ANOVA test function of R4.2 statistical plotting software was used for statistical test, and the average value comparison mode between each other was selected for statistical test of the genotypes and total laying length of the test chickens, P < 0.05 indicating significant difference. The results are shown in Table 1, the average total laying length of T / T genotype individuals is 61.76 days, which is higher than that of G / T genotype individuals (59.24 days) (P < 0.05) and G / G genotype individuals (57.11 days) (P < 0.05). The total laying length of G / T genotype individuals is higher than that of G / G genotype individuals. The results show that the chicken UMAD1 gene molecular marker is significantly related to the phenotype of chicken laying traits, and T / T genotype individuals can be selected for breeding to breed chickens with longer total laying length, improve the total laying length and uniformity of the population, and improve the breeding efficiency according to the actual breeding goal.

[0026] Table 1 Correlation analysis of UMAD1 gene molecular marker and laying traits

[0027] Note: The same column data with the same letter indicates no significant difference, and the different letters indicate significant difference (P < 0.05).

[0028] Example 2 Genotype frequencies of different breeds 1. Blood sample collection The blood samples of recessive white Lohmann chickens, Wenchang chickens, Beijing oil chickens, Wuding chickens, Daweishan miniature chickens, Jingxing yellow chickens, mustache chickens and large bone chickens were collected by using the subclavian vein blood collection method, and were stored at -20℃ for standby.

[0029] 2. Extraction of genomic DNA The tissue samples obtained in the first step were used to extract genomic DNA using the Omega tissue genomic DNA extraction kit, and the specific method was referred to the standard operation procedure provided by Omega.

[0030] 3. Genotype detection The genomic DNA obtained in the second step was used as a template, and the primer pair composed of F nucleotide sequence (SEQ ID NO: 1) and R nucleotide sequence (SEQ ID NO: 2) was used for PCR amplification and Sanger sequencing to obtain the G / G genotype, G / T genotype and T / T genotype of the individual.

[0031] 4. Results analysis Wenchang chicken, Beijing fatty chicken, Wuding chicken, Daweishan miniature chicken, whisker chicken and big bone chicken are well-known Chinese local chicken breeds, which have high genetic diversity, low egg production, good egg quality, less abnormal eggs and low total egg length. Beijingxing yellow chicken is a yellow-feathered broiler matching line developed from Chinese local resources, which has excellent meat flavor, high growth rate and similar reproductive performance to Chinese local breeds. Recessive white Lohmann chicken is a popular commercial breed in the market, which is often used as a specialized line in medium-speed yellow-feathered broiler matching line. The main breeding goal is to improve growth rate, feed reward and egg production performance, and the T allele frequency is relatively high. The SNP marker exists polymorphism in different types of breeds, which is suitable for total egg length breeding of each breed / line and accelerates the breeding progress of reproductive performance. The distribution of allele frequency of UMAD1 gene molecular marker in different breeds is shown in Table 2.

[0032] Table 2 Distribution of allele frequency of UMAD1 gene molecular marker in different breeds .

[0033] In addition to the above implementations, the present application can have other implementations. Any technical solutions formed by equivalent replacement or equivalent transformation fall within the protection scope of the present application.

Claims

1. A UMAD1 gene molecular marker primer associated with chicken egg laying traits, characterized in that: The nucleotide sequence of the molecular marker primer is shown as SEQ ID NO: 1 and SEQ ID NO: 2, and the molecular marker site is located at the base at position 24741087 of chromosome 2 of chicken reference genome GRCg7b version 2, the base is G or T, and the genotype is G / G, G / T and T / T.

2. The use of a UMAD1 gene molecular marker primer associated with chicken fertility traits, characterized by: The molecular marker primer is used for detecting the recessive white rock chicken continuous production trait, and the detection method comprises the following steps: In the first step, the DNA sample of the chicken to be tested is subjected to PCR amplification using the molecular marker primer shown as SEQ ID NO: 1-2 to obtain an amplification product, the length of the amplification product is 366 bp, and the amplification product contains the base at position 24741087 of chromosome 2 of chicken reference genome GRCg7b version 2; In the second step, the PCR product is subjected to Sanger sequencing; In the third step, the SNP molecular marker genotype of the base at position 24741087 of chromosome 2 of reference genome GRCg7b version 2 is determined according to the sequencing result of the second step.

3. The use of the UMAD1 gene molecular marker primer associated with the chicken connected trait according to claim 2, characterized in that: The PCR reaction system is 25 μl, and the system is as follows: 50 ng of DNA of the chicken to be tested 2x Accurate Taq Master Mix 12.5 μl 1 μl of upstream primer 1 μl of downstream primer Sterile water is added to 25 μl; The reaction conditions of the PCR amplification are as follows: 94 ℃ pre-denaturation for 5 min; 94 ℃ denaturation for 30 sec, 60 ℃ annealing for 30 sec, 72 ℃ extension for 60 sec, a total of 27 cycles; 72 ℃ extension for 5 min; 4 ℃ storage; and the nucleotide sequence of the amplification product is shown as SEQ ID NO: 3 or SEQ ID NO:

4.

4. The use of the UMAD1 gene molecular marker primer associated with the chicken connected trait according to claim 2, characterized in that: The judgment standard of the third step is that the total continuous production length of the chicken with T / T genotype at the SNP site is higher than that of the individuals with G / T and G / G genotypes, and the total continuous production length of the chicken with G / T genotype is higher than that of the individual with G / G genotype.