Application of CREG1 in preparation of medicine for treating spontaneous abortion caused by hyperhomocysteinemia

Abstract

The invention discloses application of CREG1 in preparation of a medicine for treating spontaneous abortion caused by hyperhomocysteinemia (HHcy), and belongs to the technical field of biological medicine. Experiments show that the CREG1 is highly expressed in villus tissue trophoblastic cells of HHcy combined with spontaneous abortion, cell viability decline caused by DL-hcy can be effectively improved by inhibiting expression of the CREG1, embryo absorption and placenta dysfunction caused by HHcy can be improved by targeted intervention of the CREG1, and the CREG1 can be used as a key target of drugs for high-throughput screening of HHcy-induced spontaneous abortion and can be used for preparing drugs for treating HHcy-induced spontaneous abortion. Wide application prospects are realized; the sh-CREG1 lentivirus, chloroquine and the derivative of chloroquine are used for treating the spontaneous abortion caused by HHcy, and a brand new solution is provided for clinic.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of biological medicine, and particularly relates to an application of CREG1 in preparation of a drug for treating natural abortion caused by hyperhomocysteinemia. BACKGROUND

[0002] A large number of epidemiological studies at home and abroad have confirmed the close relationship between hyperhomocysteinemia (HHcy) and natural abortion. It has been found that 21% of 102 women with recurrent unexplained natural abortion suffer from HHcy, which is identified as a risk factor for non-pregnant early abortion women. It has also been found that the serum Hcy level of 63 women with recurrent spontaneous abortion is higher than that of the control group, and the increase of serum Hcy is related to MTHFR A1298C polymorphism. Studies have shown that HHcy induces trophoblast cell apoptosis, endoplasmic reticulum stress and thus trophoblast cell dysfunction; HHcy helps to produce hydrogen peroxide and superoxide radicals, leading to oxidative damage of endothelial cells, reduction of blood vessels in the villi, poor blood circulation at the maternal-fetal interface, and reduction of nitric oxide released by endothelial cells, induction of platelet aggregation and promotion of thrombosis, which in turn affects placental perfusion; HHcy affects the development and function of the placenta and is accompanied by excessive autophagy. At present, the clinical main supplement therapy of folic acid, vitamin B6 / B12 has limited effect on patients with MTHFR C677T gene mutation. Therefore, it is urgent to develop a new targeted treatment strategy.

[0003] CREG1 (Cellular repressor of E1A-stimulated genes 1, CREG1) is an important intracellular regulatory factor and plays an important role in the regulation of various cell functions. Studies have found that CREG1 improves the response capacity of skeletal muscle to exercise endurance by regulating mitochondrial autophagy; CREG1 is a lysosomal protein that maintains cardiac function in cardiomyocytes through autophagy; CREG1 reduces pyroptosis of nucleus pulposus cells in intervertebral disc degeneration (IVDD) by promoting the PINK1 / Parkin-related mitochondrial autophagy pathway; in the proliferation and differentiation process of bovine placental trophoblast cells in early pregnancy, CREG1 participates in the generation and release of exosomes by acting on IGF2R, and participates in the regulation of organoid differentiation through exosome transport. Previous studies have found that CREG1 is highly expressed in the placenta of HHcy mice and the villi tissue of HHcy combined abortion, and whether CREG1 can be used as a target for preparing a drug for treating natural abortion caused by hyperhomocysteinemia has not been clearly studied. SUMMARY

[0004] To address the aforementioned technical problems, the present invention aims to provide the application of CREG1 in the preparation of drugs for treating spontaneous abortion caused by hyperhomocysteinemia, thereby solving the problem of the lack of targets for preparing drugs for treating spontaneous abortion caused by hyperhomocysteinemia.

[0005] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: In a first aspect, the invention provides the use of CREG1 in the preparation of a medicament for treating spontaneous abortion caused by hyperhomocysteinemia.

[0006] Furthermore, we screened drugs that inhibit CREG1 expression as treatments for spontaneous abortion caused by hyperhomocysteinemia.

[0007] Furthermore, CREG1 activates autophagy, and drugs that inhibit autophagy include chloroquine and its derivatives.

[0008] In a second aspect, the invention provides the use of CREG1 as a biomarker for the diagnosis, treatment, or prognosis of spontaneous abortion caused by hyperhomocysteinemia.

[0009] A third aspect of the invention provides a medicament for treating spontaneous abortion caused by hyperhomocysteinemia, comprising chloroquine and its derivatives.

[0010] In a fourth aspect, the invention provides the use of a lentiviral vector that inhibits CREG1 in the preparation of a medicament for treating spontaneous abortion caused by hyperhomocysteinemia.

[0011] Furthermore, the target sequence of the lentiviral vector that inhibits CREG1 is shown in SEQ ID NO.1.

[0012] The present invention has the following beneficial effects: (1) The present invention found through experiments that CREG1 is highly expressed in trophoblast cells of villous tissue in HHcy-induced miscarriage. Inhibiting the expression of CREG1 can effectively improve the decline in cell viability caused by DL-hcy and improve HHcy-related adverse pregnancy outcomes. CREG1 can be used as a key target for high-throughput screening of drugs for HHcy-induced spontaneous abortion and has broad application prospects.

[0013] (2) This invention uses sh-CREG1 lentivirus and chloroquine and its derivatives to treat spontaneous abortion caused by HHcy, thereby improving the decline in cell viability caused by DL-hcy and improving adverse pregnancy outcomes caused by HHcy, providing a new solution for clinical practice. Attached Figure Description

[0014] Figure 1The figure shows the experimental results of CREG1 expression in HHcy-related spontaneous abortion villus tissue in Example 1. (A) shows the immunohistochemical staining results, (B) shows the H-Score results, (C) shows the ELISA results, (D) shows the Western Blot results, and (E) shows the relative expression levels of CREG1, P62, and LC3B. Figure 2 The figure shows the experimental results of the cell system-level verification of the role of CREG1 in HTR8 / SVneo cells in Example 2. Among them, (A) is the qRT-PCR result of lentivirus knockdown of CREG1, (B) is the Western Blot result of lentivirus knockdown of CREG1, (C) is the CCK8 experiment result, (D) is the Western Blot result of the first experimental group, and (E) is the Western Blot result of the second experimental group. Figure 3 The results of the cell immunofluorescence experiment in Example 2 are shown, where (A) is the first experimental group and (B) is the second experimental group. Figure 4 The results of serum Hcy level, mouse embryo resorption rate and blastodisc weight in Example 3 are shown, where (A) is serum Hcy level, (B) is mouse embryo resorption rate and (C) is blastodisc weight. Figure 5 The results of the immunohistochemical experiment in Example 3; Figure 6 The transmission electron microscopy characterization results are from Example 3; Figure 7 The results are from the Western Blot experiment in Example 3. Detailed Implementation

[0015] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0016] Example 1: Expression of CREG1 in chorionic villus tissue of HHcy-related spontaneous abortion (a) Sample collection and grouping Samples were collected and grouped as follows: (1) Normal pregnancy group (NC): chorionic villus tissue and serum (serum Hcy < 10.16 μmol / L) were collected from 20 cases of induced abortion at 6-8 weeks of gestation.

[0017] (2) HHcy combined with spontaneous abortion group (SA / HHcy): chorionic villus tissue and serum were collected from 20 cases of spontaneous abortion at 6-8 weeks of gestation (serum Hcy>10.16 μmol / L).

[0018] (3) Non-HHcy combined with spontaneous abortion group (SA / non-HHcy): chorionic villus tissue and serum were collected from 20 cases of spontaneous abortion at 6-8 weeks of gestation (serum Hcy <10.16 μmol / L).

[0019] (4) Sample processing: After quick freezing in liquid nitrogen, the samples were stored at -80℃ (some samples were fixed in formalin for immunohistochemistry).

[0020] (II) Detection Methods (1) Immunohistochemical (IHC) detection of CREG1 protein Includes the following steps: 1) Dewaxing paraffin sections to water: treat with xylene I / II for 10 min each, then treat with gradient ethanol (100%-75%) for 5 min each, and rinse with PBS; 2) Antigen retrieval: Autoclave with sodium citrate buffer (pH 6.0) for 3 min; 3) Incubate with 3% H2O2 at room temperature for 10 min to block endogenous peroxidase; 4) After blocking with 3% BSA for 30 min, add CREG1 primary antibody (volume ratio 1:200) and incubate at 4℃ overnight; 5) The next day, wash three times with PBS, then add HRP-labeled secondary antibody (volume ratio 1:500) and incubate at 37°C for 1 hour; 6) Develop by DAB staining, counterstain with hematoxylin, and mount with neutral resin; 7) Result interpretation: Image-Pro Plus software was used to analyze the percentage of positive cells and the integrated optical density (IOD).

[0021] (2) Western Blot detection of CREG1 and autophagy-related proteins Includes the following steps: 1) Tissue lysis: Lyse on ice for 30 min with RIPA lysis buffer (containing PMSF), centrifuge at 12000 g for 15 min, and collect the supernatant; 2) Protein was quantified using the BCA method, with a protein loading amount of 20 μg; 3) Perform 10% SDS-PAGE electrophoresis separation and transfer to a PVDF membrane; 4) Block with 5% skim milk for 1 h, add primary antibodies (CREG1 to total solution volume ratio 1:1000, LC3-II to total solution volume ratio 1:2000, p62 to total solution volume ratio 1:5000), and incubate overnight at 4℃. 5) Wash with TBST 3 times, 15 min each time, add secondary antibody (volume ratio of 1:1000 to total solution), treat at room temperature for 1 h, then wash with TBST 3 times again, 15 min each time; 6) Finally, the band grayscale values ​​are analyzed using ECL development and Image Lab software.

[0022] (3) ELISA detection of serum CREG1 expression Includes the following steps: 1) Sample preparation: First, collect venous blood, then centrifuge at 3000 g for 15 min, and store the serum at -80℃; 2) Prepare CREG1 standard dilutions (1000, 500, 250, 125, 62.5, 31.25, 15.625 and 0 pg / mL) and 1× wash buffer (PBS-Tween20); 3) The sample loading test was performed using the 96-well plate method. First, 100 μL of sample was added to each well, and the plate was covered with a membrane at 37°C for 2 h and then washed. Then, 100 μL of biotinylated antibody was added to each well, and the plate was treated at 37°C for 1 h and then washed. Next, 100 μL of Streptavidin-HRP enzyme was added to each well, and the plate was treated at 37°C for 30 min and then washed. All the washing conditions were 4 washes with 1× washing buffer, 1 min each time. Finally, 100 μL of TMB was added to each well for color development (blue) for 15 min, and 50 μL of sulfuric acid was added to each well to stop the color development (yellow color). The OD value was then measured.

[0023] 4) Calculate the concentration (pg / mL) of CREG1 in the sample by fitting a standard curve using standards. The standard curve R... 2 ≥0.99, duplicate CV% <1%.

[0024] (III) Experimental Results and Analysis Experimental results are as follows Figure 1 As shown.

[0025] The expression level of CREG1 in tissues was assessed using the H-Score, such as... Figure 1 As shown in Figures (A) and (B), the expression level of CREG1 in the NC group and the SA / non-HHcy group was significantly lower than that in the SA / HHcy group, with statistical differences, and it was mainly distributed in the cytoplasm.

[0026] The expression of CREG1 in the serum of the three groups was detected by ELISA, such as...Figure 1 As shown in Figure (C), serum CREG1 expression was higher in the SA / HHcy group than in the SA / non-HHcy group, and the expression level in the NC group was higher than that in the SA / non-HHcy group.

[0027] The expression of autophagy-related proteins was detected by Western blot, such as... Figure 1 As shown in Figures (D) and (E), the expression of CREG1 protein in the villous tissue of the SA / HHcy group was significantly higher than that of the SA / non-HHcy group, while there was no significant difference in CREG1 expression between the NC and SA / non-HHcy groups; the expression of P62 protein in the villous tissue of the SA / HHcy group was significantly lower than that of the SA / non-HHcy group, while the expression of LC3B was higher than that of the SA / non-HHcy group.

[0028] Example 2: Validation of the role of CREG1 in HTR8 / SVneo cells at the cellular level (a) Experimental materials (1) Cell line: Human placental trophoblast cells HTR8 / SVneo; (2) Lentiviral system shRNA-CREG1 lentivirus: purchased from Hanheng Biotechnology Co., Ltd., the target sequence is shown in SEQ ID NO.1, CGTTATTCATTCGACACCCTGAGAT (SEQ ID NO.1). Chloroquine: Product No. HY-17589A, CQ concentration 10 μmol / L; DL-homocysteine: DL-hcy, IC 50 Concentration 150 μmol / L.

[0029] (II) Experimental Grouping Group 1 (Lentivirus Intervention Group): sh-NC: Negative control lentivirus treatment; sh-CREG1: CREG1 knockout lentivirus treatment; sh-NC+DL-hcy: Negative control lentivirus + DL-hcy treatment; sh-CREG1+DL-hcy: CREG1 knockout lentivirus + DL-hcy treatment.

[0030] Group Two (Drug Intervention Group): Ctrl: Normal culture control group; Ctrl+CQ: Chloroquine treatment group; Ctrl+DL-hcy: DL-hcy process group; Ctrl+DL-hcy+CQ: DL-hcy + chloroquine combined treatment group.

[0031] (III) Experimental Methods (1) Lentiviral infection and cell processing 1) Cell culture: HTR8 / SVneo cells were seeded in 6-well plates at 5 × 10⁶ cells / well. 5 / well, incubate at 37°C until fusion reaches 50%; 2) Viral infection: The experimental group was given sh-CREG1 lentivirus (MOI=30), and the control group was given sh-NC lentivirus (MOI=30). At the same time, 4 μg / mL Polybrene was added to enhance the infection efficiency; after incubation at 37℃ for 24 h, the culture medium was replaced with fresh medium. 3) The cultured products were added to a culture medium containing 1 μg / mL puromycin and screened for 72 h; 4) The selected cells were treated with 150 μmol / L DL-hcy for 24 h.

[0032] The following drug treatments were administered according to the grouping scheme in the experimental grouping: In the first group, the sh-NC and sh-CREG1 groups were not treated with DL-hcy, while the sh-NC+DL-hcy and sh-CREG1+DL-hcy groups were treated with 150 μmol / L DL-hcy for 24 h.

[0033] (2) CCK-8 cell viability assay 1) HTR8 / SVneo cells were seeded in 96-well plates at 5 × 10⁶ cells / well. 3 / hole, with 6 duplicate holes set in each group; 2) Drug treatment The following drug treatments were administered according to the grouping scheme in the experimental grouping: In the second group, the Ctrl group received no drug treatment, the Ctrl+CQ group was treated with 10 μmol / L chloroquine for 24 h, the Ctrl+DL-hcy group was treated with 150 μmol / L DL-hcy for 24 h, and the Ctrl+DL-hcy+CQ group was treated with both 10 μmol / L chloroquine and 150 μmol / L DL-hcy for 24 h.

[0034] 3) Detection: Add 10 μL of CCK-8 reagent to each well, incubate at 37℃ for 2 h, and measure the absorbance at 450 nm using an ELISA reader.

[0035] (3) Western Blot detection: The detection method is the same as in Example 1.

[0036] (4) qRT-PCR detection: The expression level of CREG1 was detected by qRT-PCR. RNA was extracted from the cell line according to the instructions of the RNeasy Mini Kit (QIAGEN); the RNA was reverse transcribed using the TaKaRa primescriptRT reagent Kit with Gdna Eraser; the fluorescence intensity was used to achieve the quantitative purpose of real-time PCR.

[0037] (5) Cell immunofluorescence detection 1) Cell slide preparation: Place sterile coverslips in 24-well plates and seed HTR8 / SVneo cells (1×10⁻⁶ cells / wells). 4 / hole); 2) Treatment and fixation: Treat according to the grouping scheme for 24 h, and fix with 4% paraformaldehyde for 15 min; 3) Permeabilization and sealing: Permeabilize with 0.1% Triton X-100 for 10 min; seal with 5% BSA for 30 min. 4) Antibody incubation: First, add primary antibody LC3 (volume ratio of 1:200 to the total system) and P62 (volume ratio of 1:500 to the total system) and incubate overnight at 4°C. Then, discard the primary antibody, wash three times with pre-cooled PBS for 3 min each time, and finally add 100 μL of donkey anti-rabbit secondary antibody conjugated with LDylight594 phosphoprotein and incubate at room temperature in the dark for 1 h. 5) Nuclear staining and mounting: Stain the nucleus with DAPI for 5 min, then mount with anti-fluorescence quenching mounting medium; 6) Image acquisition and analysis: The number of P62 and LC3 spots was quantified using confocal microscopy and ImageJ software.

[0038] (iv) Experimental Results and Analysis Experimental results are as follows Figure 2 and Figure 3 As shown.

[0039] The efficiency of lentiviral knockdown of CREG1 was detected by qRT-PCR and Western Blot, such as... Figure 2 As shown in Figures (A) and (B), the lentivirus-constructed sh-CREG1 can significantly reduce the expression of CREG1.

[0040] The CCK8 experimental results are as follows: Figure 2 As shown in Figure (C), the results indicate that DL-hcy can reduce cell viability, while knocking down CREG1 and using CQ can partially restore cell viability.

[0041] Western blotting results are as follows: Figure 2 As shown in Figures (D) and (E), in the control group, the expression of P62 and LCB decreased after the addition of DL-hcy. However, after knocking down CREG1, the expression of P62 and LCB increased compared to sh-NC. In the sh-CREG1 and sh-CREG1+DL-hcy groups, the expression of P62 and LC3B showed a decreasing trend. After using CQ, the expression trends of P62 and LC3B were similar to those of sh-CREG1.

[0042] Results of cell immunofluorescence experiments as follows Figure 3 As shown in Figures (A) and (B), the results showed that the expression of P62 was significantly reduced after using DL-hcy, while knocking down CREG1 and using CQ increased the expression of P62 in cells.

[0043] The above results indicate that, in vitro, DL-hcy mainly affects the viability of trophoblast cells by activating autophagy through CREG1, while knocking down CREG1 and using CQ restore the viability of trophoblast cells by improving autophagy.

[0044] Example 3: Animal-based verification of the role of CREG1 in HHcy-induced spontaneous abortion (a) Experimental materials Animal model: Purchase 5-6 week old C57BL / 6 female mice (n=150) and induce the HHcy model by feeding them a diet high in methionine with a mass fraction of 3%.

[0045] Adenovirus: Purchased the CREG1 interference vector of adenovirus packaged by Hanheng Biotechnology Co., Ltd.

[0046] Drug: Chloroquine (CQ, catalog number HY-17589A, dosage 30 mg / kg / day, intraperitoneal injection).

[0047] (II) Experimental Grouping The experiment was divided into five groups: Ctrl, HHcy, HHcy+sh-NC, HHcy+sh-CREG1, and HHcy+CQ.

[0048] (III) Modeling and Grouping Five- to six-week-old C57BL / 6 mice were divided into five groups of 50 mice each, according to experimental needs. The HHcy model group and the experimental groups (HHcy+sh-NC, HHcy+sh-CREG1, and HHcy+CQ) were fed a diet high in 3% methionine for eight weeks. Serum Hcy levels were measured by orbital blood sampling, and a serum Hcy level >15 μmol / L was defined as successful model establishment. Female mice in estrus were paired with fertile male mice. The day after the test, a vaginal plug was detected, which was recorded as 0.5 days of gestation. In the HHcy+sh-CREG1 group, the vector was injected intraperitoneally every three days, and in the HHcy+CQ group, CQ was injected intraperitoneally daily. Mice were sacrificed at E13.5.

[0049] (iv) Experimental characterization (1) Observation of autophagosomes by transmission electron microscopy First take 1 mm 3 Placental tissue was fixed in 2.5% glutaraldehyde for 24 h, then fixed in 1% osmium tetroxide for 2 h, embedded in epoxy resin, ultrathin sectioned (70 nm), and finally stained with uranium acetate-lead citrate double staining and observed under a Hitachi HT7800 electron microscope.

[0050] (2) The Western Blot and tissue immunohistochemistry experiments were performed in the same way as in Example 1.

[0051] (V) Experimental Results and Analysis Experimental results are as follows Figures 4-7 As shown.

[0052] To confirm the induction effect of a high-methionine diet on the HHcy mouse model, serum Hcy levels were measured, and the results are as follows: Figure 4 As shown in Figure (A), the results indicate that a high-methionine diet has an inducing effect on the HHcy mouse model, and the HHcy mouse model was successfully constructed. Figure 4 As shown in Figures (B) and (C), the embryo resorption rate and placental weight of mice in the HHcy group were significantly lower than those in the Ctrl group, while knocking down CREG1 and using CQ improved pregnancy outcomes in mice.

[0053] like Figure 5 As shown, immunohistochemical experiments indicated that the expression of placental labyrinth Ki67 in the HHcy group was lower than that in the control group, while knockdown of CREG1 and use of CQ increased the expression of placental labyrinth Ki67.

[0054] like Figure 6 As shown, transmission electron microscopy results revealed an abnormally increased number of autophagosomes in placental trophoblast cells from the HHcy group, while the number of autophagosomes was reduced in placental trophoblast cells with knocked-down CREG1 and those treated with CQ.

[0055] likeFigure 7 As shown, Western blotting experiments revealed that P62 and LC3B expression was reduced in the HHcy group, while knockdown of CREG1 and the use of CQ resulted in the recovery of P62 and LC3B expression.

[0056] The above results indicate that in vivo, HHcy mainly affects trophoblast cell proliferation by activating autophagy through CREG1, while knocking down CREG1 and using CQ can restore placental function and thus improve HHcy-related adverse pregnancy outcomes.

[0057] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of CREG1 in the preparation of drugs for treating spontaneous abortion caused by hyperhomocysteinemia.

2. The application of CREG1 according to claim 1 in the preparation of a drug for treating spontaneous abortion caused by hyperhomocysteinemia, characterized in that, To screen for drugs that inhibit CREG1 expression as treatments for spontaneous abortion caused by hyperhomocysteinemia.

3. The use of CREG1 according to claim 2 in the preparation of a drug for treating spontaneous abortion caused by hyperhomocysteinemia, characterized in that... CREG1 activates autophagy, and drugs that inhibit autophagy include chloroquine and its derivatives.

4. Application of CREG1 as a biomarker for the diagnosis, treatment, or prognosis of spontaneous abortion caused by hyperhomocysteinemia.

5. A drug for treating spontaneous abortion caused by hyperhomocysteinemia, characterized in that, This includes chloroquine and its derivatives.

6. Application of lentiviral vectors that inhibit CREG1 in the preparation of drugs for treating spontaneous abortion caused by hyperhomocysteinemia.

7. The use of the lentiviral vector that inhibits CREG1 according to claim 6 in the preparation of a drug for treating spontaneous abortion caused by hyperhomocysteinemia, characterized in that, The target sequence of the lentiviral vector that inhibits CREG1 is shown in SEQ ID NO.1.

Images