Use of circular RNA circRPS14 in preparation of a drug for treating head and neck squamous cell carcinoma

Abstract

The application provides application of circular RNA circRPS14 in preparation of a drug for preventing and / or treating head and neck squamous cell carcinoma, and a sequence of the circular RNA circRPS14 is shown as SEQ ID NO:1. The circular RNA circRPS14 disclosed by the application can sponge miR-16-5p, down-regulate the expression of miR-16-5p in head and neck squamous cell carcinoma; the circRPS14 can also promote ferroptosis of head and neck squamous cell carcinoma, and can also inhibit proliferation, migration and clonogenicity of tumor cells; in-vivo experiments prove that overexpression of the circRPS14 can also significantly inhibit the growth of head and neck squamous cell carcinoma tumors. Therefore, the circRPS14 is expected to become a candidate nucleic acid drug for treating head and neck squamous cell carcinoma, and has great clinical application prospect and value.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and in particular relates to the application of a circular RNA circRPS14 in the preparation of a drug for treating head and neck squamous cell carcinoma. Background Technology

[0002] Head and neck squamous cell carcinoma (HNSCC) is a malignant tumor originating from the mucosal epithelium of the head and neck, commonly occurring in the oral cavity, pharynx, and nasal cavity, accounting for approximately 90% of head and neck malignancies. Its incidence is closely related to smoking, alcohol consumption, and human papillomavirus (HPV) infection; long-term exposure to betel nut and ultraviolet light also increases the risk. Early symptoms include ulcers, lumps, or hoarseness, which are easily overlooked. As the disease progresses, pain, difficulty swallowing, and cervical lymph node metastasis may occur. Treatment primarily involves a comprehensive approach including surgery, radiotherapy, chemotherapy, and targeted immunotherapy. Prognosis is stage-dependent; the 5-year survival rate for early-stage patients exceeds 70%, while it significantly decreases in advanced stages. Current treatment options for head and neck squamous cell carcinoma still do not meet clinical needs, necessitating the development of new therapeutic drugs.

[0003] MiR-16-5p, a microRNA, plays a crucial role in the progression of various tumors due to its high expression. Studies have shown that high expression of miR-16-5p can promote tumor cell proliferation, invasion, and metastasis by targeting and inhibiting tumor suppressor genes (such as PTEN and TP53) or regulating cell cycle-related proteins. High expression of miR-16-5p is observed in solid tumors such as esophageal squamous cell carcinoma, upper respiratory tract ureteral epithelial carcinoma, Kaposi's sarcoma, and high-grade serous ovarian carcinoma, and is significantly associated with tumor stage progression, lymph node metastasis, and poor prognosis.

[0004] CircRNAs are a class of non-coding RNAs with closed circular structures. They have diverse functions and play important roles in gene regulation. CircRNAs often act as molecular sponges for miRNAs, competitively binding to miRNAs to release their regulatory effects on target genes and regulate the expression of downstream genes. CircRPS14 is usually produced by the RPS14 gene through a special backsplicing mechanism. It has a closed circular structure, lacks a 5' cap and a 3' poly(A) tail, making it less susceptible to degradation by exonucleases and more stable than linear RNA. Its high stability and strong tissue specificity make it a potential diagnostic biomarker and therapeutic target. Currently, there is no clear research on the role of CircRPS14 in head and neck squamous cell carcinoma. Summary of the Invention

[0005] In view of this, in order to solve the technical problem of limited treatment options for head and neck squamous cell carcinoma that cannot meet clinical needs and the urgent need to develop new therapeutic drugs, this invention proposes the application of circular RNA circRPS14 in the preparation of drugs for the prevention and / or treatment of head and neck squamous cell carcinoma. The circular RNA circRPS14 has good application prospects in the development of drugs against head and neck squamous cell carcinoma.

[0006] To achieve the above objectives, the technical solution of the present invention is implemented as follows:

[0007] This invention provides, in one aspect, the use of circular RNA circRPS14 in the preparation of drugs for the prevention and / or treatment of head and neck squamous cell carcinoma, wherein the sequence of circular RNA circRPS14 is shown in SEQ ID NO:1.

[0008] circRPS14: 5′GAAUCCUCACCAUAUGCUGCUA 3′ (SEQ ID NO: 1).

[0009] In some preferred embodiments of the present invention, the circular RNA circRPS14 inhibits at least one of the following: cancer cell proliferation, cancer cell migration, cancer cell colony formation, cancer cell ferroptosis, and tumor growth in vivo.

[0010] In some preferred embodiments of the present invention, the circular RNA circRPS14 achieves the purpose of preventing and / or treating head and neck squamous cell carcinoma by at least one of the following:

[0011] (a) Sponge adsorption of miR-16-5p;

[0012] (b) Promotes ROS accumulation in tumor cells;

[0013] (c) Promotes lipid peroxidation in tumor cells;

[0014] (d) Inhibit the expression of ferroptosis marker proteins GPX4 and SLC7A11 in tumor cells;

[0015] (e) Inhibits tumor cell proliferation, migration, and colony formation;

[0016] (f) Inhibits the growth of tumors in the body.

[0017] In some preferred embodiments of the invention, the medicament comprises a preventive and / or therapeutically effective amount of the circular RNA circRPS14 and a pharmaceutically acceptable nucleic acid drug delivery system thereof.

[0018] In some preferred embodiments of the present invention, the nucleic acid drug delivery system is one or more of hydrogels, lipid nanoparticles, nanovesicles, nanoparticles, and lentiviruses.

[0019] In some preferred embodiments of the present invention, the dosage form of the drug is one or more of the following: tablets, capsules, pills, suppositories, aerosols, oral liquid preparations, granules, powders, injections, syrups, tinctures, lotions, and films.

[0020] In some preferred embodiments of the present invention, the route of administration of the drug is one or more of oral, injection, implantation, and inhalation.

[0021] Another aspect of the present invention provides a medicament for the prevention and / or treatment of squamous cell carcinoma of the head and neck, the medicament comprising a circular RNA circRPS14, the sequence of which is shown in SEQ ID NO:1.

[0022] In some preferred embodiments of the medicament of the present invention, the medicament further includes a pharmaceutically acceptable nucleic acid drug delivery system.

[0023] Compared with existing technologies, the circular RNA circRPS14 described in this invention has the following advantages in the preparation of drugs for treating head and neck squamous cell carcinoma:

[0024] circRPS14 can promote ferroptosis in head and neck squamous cell carcinoma by sponging miR-16-5p, thereby inhibiting the progression of head and neck squamous cell carcinoma. Specifically, circRPS14 expression in head and neck squamous cell carcinoma tumor tissues is significantly lower than that in normal adjacent tissues, while miR-16-5p expression is the opposite. Overexpression of circRPS14 significantly reduces miR-16-5p expression in cells, and luciferase reporter gene assays show a direct interaction between miR-16-5p and circRPS14. These results indicate that circRPS14 can sponge-adsorb miR-16-5p to reduce the level of miR-16-5p in cells. In addition, overexpression of circRPS14 can also upregulate ROS levels in head and neck squamous cell carcinoma cells, promote lipid peroxidation of tumor cells, and inhibit cell migration, colony formation, and proliferation, thereby inhibiting the progression of head and neck squamous cell carcinoma.

[0025] circRPS14 can upregulate the expression of ALOX12, a key regulatory gene for ferroptosis, by adsorbing miR-16-5p through a sponge, thereby activating the phosphorylation of its downstream AMPK / ACC1 pathway and inhibiting the expression of ferroptosis marker proteins GPX4 and SLC7A11. This lays the foundation for circRPS14 to exert its anti-squamous cell carcinoma effect in vivo.

[0026] In summary, circRPS14 could be a novel nucleic acid drug for the treatment of head and neck squamous cell carcinoma, with great potential and value in clinical application. Attached Figure Description

[0027] Figure 1 This diagram shows the expression of circRPS14(A) and miR-16-5p(B) in clinical tumor tissue and adjacent normal tissue of patients with head and neck squamous cell carcinoma. The horizontal axis represents the experimental group. Tumor represents the patient's tumor tissue, and Normal represents the patient's adjacent normal tissue. * represents P < 0.05, ** represents P < 0.01, and *** represents P < 0.001.

[0028] Figure 2 This diagram shows the intracellular expression levels of circRPS14(A) and miR-16-5p(B) in CAL27 clinical cell carcinoma cells of the head and neck after overexpression of circRPS14. The horizontal axis represents the experimental groups, where NC represents the control group transfected with the control plasmid, and OE-circRPS14 represents the circRPS14 overexpression group transfected with the circRPS14 overexpression plasmid. * represents P < 0.05, ** represents P < 0.01, and *** represents P < 0.001.

[0029] Figure 3 The interaction analysis between miR-16-5p and circRPS14 is shown, where WT represents the wild-type group of circRPS143'UTR and MUT represents the mutant group of circRPS143'UTR. * represents P < 0.05, ** represents P < 0.01, and *** represents P < 0.001.

[0030] Figure 4 The effect of circRPS14 overexpression on intracellular ROS levels (A) and lipid peroxidation levels (B) in CAL27 cells is shown. * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001.

[0031] Figure 5To demonstrate the effect of circRPS14 overexpression on the expression of ALOX12, p-AMPK / AMPK, p-ACC1 / ACC1, GPX4 and SLC7A11 in CAL27 cells using Western blotting, the cells are arranged from top to bottom as follows: ALOX12, phosphorylated AMPK, AMPK, phosphorylated ACC1, ACC1, GPX4, SLC7A11 and GAPDH as an internal control.

[0032] Figure 6 The effects of overexpression of circRPS14 on cell migration (A), colony formation (B), and proliferation (C) in CAL27 cells are shown. * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001.

[0033] Figure 7 The effect of overexpression of circRPS14 on the growth of squamous cell carcinoma of the head and neck is shown. NC represents the control group transfected with the control plasmid, and OE-circRPS14 represents the circRPS14 overexpression group transfected with the circRPS14 overexpression plasmid.

[0034] Figure 8 This is a schematic diagram of the formation mode of the circular RNA circRPS14 described in this invention. Detailed Implementation

[0035] Unless otherwise defined, the technical terms used in the following embodiments have the same meanings as commonly understood by those skilled in the art. Unless otherwise specified, the test reagents, kits, raw materials, and equipment used in the following embodiments are commercially available. Unless otherwise specified, the experimental or detection methods involved in this invention are conventional experimental or detection methods in the art, or can be performed with reference to the corresponding kits or product instructions.

[0036] The present invention will now be described in detail with reference to the embodiments and accompanying drawings.

[0037] Main reagent sources:

[0038] Clinical samples from patients with squamous cell carcinoma of the head and neck were obtained from Tianjin Stomatological Hospital;

[0039] circRPS14 plasmid and control plasmid were purchased from Shanghai Ruibo Biotechnology Co., Ltd.

[0040] BALB / c Nude mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.

[0041] Anti-ALOX12, p-AMPK, AMPK, p-ACC1, ACC1, GPX4, SLC7A11, and GAPDH antibody (used as an internal control) were all purchased from Affinity (USA).

[0042] The reactive oxygen species (ROS) detection kit was purchased from Solarbio.

[0043] Human tongue squamous cell carcinoma cells (CAL27 cells) were purchased from Shanghai Fuheng Biotechnology Co., Ltd.

[0044] The sequence of the circular RNA circRPS14 is shown in SEQ ID NO:1. Figure 8 This is a schematic diagram of the formation pattern of the circular RNA circRPS14.

[0045] Example 1: circRPS14 downregulates miR-16-5p expression in head and neck squamous cell carcinoma via sponge adsorption.

[0046] 1. Expression analysis of circRPS14 and miR-16-5p in clinical samples

[0047] Between October 2023 and June 2024, 16 pairs of tumor tissue and their corresponding adjacent normal tissue samples were obtained from 16 patients diagnosed with head and neck squamous cell carcinoma at Tianjin Stomatological Hospital.

[0048] After the tissue samples were homogenized using a tissue homogenizer, total RNA was extracted from the tissue cells using the Trizol method: Trizol was added to the tissue homogenate, mixed well, and then 200 μL of chloroform was added to each EP tube. After standing, the tube was vortexed for 15-20 seconds to ensure thorough mixing until the liquid turned milky white, and then allowed to stand for 2 minutes. The tube was then centrifuged at 12,000 rpm for 15 minutes at 4°C. After centrifugation, the RNA was found in the colorless aqueous phase at the top. The upper layer of liquid was transferred to a new EP tube using a pipette, taking care not to aspirate the white turbidity. An equal volume of isopropanol was added, mixed well, and allowed to stand for 10 minutes. The tube was then centrifuged at 12,000 rpm for 10 minutes at 4°C. The precipitate was the total RNA from the cells. The supernatant was discarded, and the precipitate was washed with 75% ethanol. The tube was then centrifuged at 7,000 rpm for 5 minutes at 4°C. This process was repeated at least twice. Finally, the ethanol was poured out, the tube was opened, and the remaining ethanol was allowed to evaporate completely before adding DEPC water to dissolve the RNA. Take 2 μL of the solution to measure RNA concentration, and use the remaining RNA solution for reverse transcription.

[0049] Reverse transcription: Add 4 μL of 5×Fasting-RT SuperMix and 50 ng–2 μg of total RNA to an octet tube, and bring the total volume to 20 μL with RNase-free H2O. Then, reverse transcribe the cDNA using a reaction program of 42℃ for 15 min and 95℃ for 3 min. Using the reverse-transcribed cDNA as a template, prepare a reaction system according to the following settings: 10 μL of 2×TranStart TopGreen qPCR SuperMix, 0.4 μL of Forward Primer (10 μM), 0.4 μL of Reverse Primer (10 μM), 2 μg of cDNA, and 20 μL with RNase-free H2O. Perform real-time quantitative PCR using a reaction program of pre-denaturation at 95℃ for 30 s, 95℃ for 10 s for 40–45 cycles, and 60℃ for 30 s.

[0050] 2. Effects of circRPS14 overexpression on miR-16-5p in CAL27 cells

[0051] Cell transfection: CAL27 cells were cultured in 10cm² culture dishes. Once the cells reached a certain density, the medium was replaced with opti-MEM. Two EP tubes were prepared. One tube contained 500μL opti-MEM with the required amount of plasmid DNA, and the other contained 500μL opti-MEM with the required amount of transfection reagent. The two tubes were gently mixed and allowed to stand at room temperature for 5 minutes. The plasmid DNA mixture was then slowly added drop by drop vertically to the transfection reagent solution. The bottom of the tube was gently tapped to mix, and the mixture was allowed to stand for 15 minutes. Finally, the mixture was slowly and vertically added to the cell culture dish, ensuring even distribution across the entire surface. The dish was then incubated for 24-48 hours.

[0052] Trizol method for extracting total RNA from cells: Discard the culture medium in the culture dish, wash 2-3 times with PBS, add 1 mL of Trizol to the cells in a fume hood, shake to ensure Trizol covers all cells, gently pipette the cells, and transfer the suspension to EP tubes. Then add 200 μL of chloroform to each EP tube, let stand, vortex for 15-20 seconds to thoroughly mix the liquid until it turns milky white, and let stand for 2 minutes. Centrifuge at 12000 rpm for 15 minutes at 4°C. After centrifugation, RNA will be present in the colorless aqueous phase at the top. Use a pipette to transfer the top liquid to a new EP tube, being careful not to aspirate the white turbidity. Add the same volume of isopropanol, mix well, let stand for 10 minutes, and centrifuge at 12000 rpm for 10 minutes at 4°C. The precipitate is the total RNA from the cells. Discard the supernatant, wash the precipitate with 75% ethanol, and centrifuge at 7000 rpm for 5 minutes at 4°C. Repeat this process at least twice. Finally, pour out the ethanol, open the cap, and allow the remaining ethanol in the tube to evaporate completely. Then, add DEPC water to dissolve the RNA. Take 2 μL of the solution to measure the RNA concentration, and use the remaining RNA solution for reverse transcription.

[0053] Reverse transcription: Add 4 μL of 5×Fasting-RT SuperMix and 50 ng–2 μg of total RNA to an octet tube, and bring the total volume to 20 μL with RNase-free H2O. Then, reverse transcribe the cDNA using a reaction program of 42℃ for 15 min and 95℃ for 3 min. Using the reverse-transcribed cDNA as a template, prepare a reaction system according to the following settings: 10 μL of 2×TranStart TopGreen qPCR SuperMix, 0.4 μL of Forward Primer (10 μM), 0.4 μL of Reverse Primer (10 μM), 2 μg of cDNA, and 20 μL with RNase-free H2O. Perform real-time quantitative PCR using a reaction program of pre-denaturation at 95℃ for 30 s, 95℃ for 10 s for 40–45 cycles, and 60℃ for 30 s.

[0054] 3. Interaction analysis between circRPS14 and miR-16-5p

[0055] Following the cell transfection steps described above, wild-type plasmids of the miR-16-5pmimics+circRPS143'UTR luciferase reporter gene and mutant plasmids of the miR-16-5pmimics+circRPS143'UTR luciferase reporter gene were co-transfected into cells. After culturing for 24 hours, the cells were evenly seeded into 96-well plates at a density of 5000-10000 cells per well, with three replicates per group. Cells were cultured for another 24 hours, and the culture medium was discarded. The cells were washed three times with PBS. Using a luciferase kit (Promega, USA), 50 μL of cell lysis buffer was added to each well, and the cells were lysed at 120 rpm for 30 minutes on a shaker. The 96-well plates were placed on ice, and the cell lysis buffer (35 μL / well) was transferred to a white plate. Luciferase Assay Substrate and liquid luciferase Assay Buffer were mixed, and 40 μL of the mixed working solution was added to each well. Then, the fluorescence value, i.e. the activity of cellular luciferase, is measured using a luciferase fluorescence detector.

[0056] 4. Test Results

[0057] 4.1) qPCR test results of clinical tissue samples as follows Figure 1 As shown, by Figure 1 It is evident that, compared with adjacent normal tissue, the expression of circRPS14 in head and neck squamous cell carcinoma tumor tissue is significantly lower than that in normal tissue, while the expression of miR-16-5p in tumor tissue is significantly higher than that in adjacent normal tissue. This indicates that circRPS14 is poorly expressed in cancer tissue, and its expression level is negatively correlated with miR-16-5p.

[0058] 4.2) qPCR detection results of CAL27 cells are as follows Figure 2 As shown, Figure 2 The results showed that, compared with the control group, the expression of circRPS14 in CAL27 cells was significantly increased after transfection with the circRPS14 overexpression plasmid, while the expression of miR-16-5p in CAL27 cells was significantly decreased after overexpression of circRPS14. These results indicate that overexpression of circRPS14 can significantly downregulate the expression of miR-16-5p in CAL27 cells.

[0059] 4.3) Luciferase reporter gene assay results as follows Figure 3As shown, compared with the control group, overexpression of miR-16-5p significantly inhibited the expression of wild-type circRPS14 3'UTR, while having no significant effect on the expression of mutant circRPS14 3'UTR; these results indicate that miR-16-5p can bind to the 3'UTR region of circRPS14, thereby enabling circRPS14 sponges to adsorb miR-16-5p.

[0060] Example 2: circRPS14 can promote ferroptosis in head and neck squamous cell carcinoma via the ALOX12 / AMPK / ACC1 pathway.

[0061] 1. Overexpression of circRPS14 can promote the accumulation of ROS and lipid peroxidation in CAL27 cells.

[0062] Following the transfection steps described above, NC plasmid and circPRS14 control plasmid were transfected into CAL27 cells. Cells were collected 48 hours after transfection for reactive oxygen species detection and lipid peroxidation analysis (C11-BODIPY 581 / 591).

[0063] Reactive oxygen species (ROS) detection measures intracellular ROS levels using the DCFH-DA fluorescent probe. DCFH-DA was diluted to a final concentration of 10 μM / L with FBS-free cell culture medium. Cells were digested and centrifuged, the supernatant was discarded, and the diluted DCFH-DA was added to resuspend the cells. The cell concentration in the EP tube was determined to be 1 × 10⁻⁶ cells / L using a cell counter. 6 ~2×10 7 Incubate at 37°C for 20 minutes, inverting the plate every 5 minutes to ensure the probe fully penetrates the cells. All procedures must be performed in the dark. After incubation, add the cell suspension to a 96-well plate and read the absorbance at 488 nm and 525 nm using a microplate reader.

[0064] C11-BODIPY 581 / 591 is a fluorescent probe for detecting intracellular lipid peroxidation.

[0065] (1) Probe preparation: Dissolve the probe by dissolving C11-BODIPY 581 / 591 powder in DMSO to prepare a 1-10 mM stock solution. Aliquot the stock solution and store it at -20℃ in the dark.

[0066] (2) Cell treatment: Seed cells in culture plates or dishes to achieve 70%-80% confluence.

[0067] (3) Probe loading: Dilute the C11-BODIPY 581 / 591 stock solution with culture medium to a final concentration of 1-10 μM. Remove the cell culture medium and add culture medium containing the probe. Incubate at 37°C and 5% CO2 for 30 minutes to 1 hour.

[0068] (4) Remove unbound probes: After incubation, wash the cells with PBS 2-3 times to remove unbound probes.

[0069] (5) Fluorescence Detection: Fluorescence Microscopy Observation: Cells were observed using a fluorescence microscope. C11-BODIPY 581 / 591 cells showed red fluorescence in the unoxidized state (excitation / emission: 581 / 591 nm) and green fluorescence after oxidation (excitation / emission: 488 / 520 nm). The changes in the ratio of red to green fluorescence were recorded. Flow Cytometry Analysis: Cells were digested with trypsin, and the cell suspension was collected. Red and green fluorescence signals were detected using flow cytometry. Lipid peroxidation levels were analyzed.

[0070] (6) Data analysis: The ratio of red fluorescence to green fluorescence (Red / Green ratio) was calculated. A decrease in the ratio indicates an increase in lipid peroxidation. The results of different experimental groups were compared to assess the effect of oxidative stress.

[0071] 2. circRPS14 promotes ferroptosis in head and neck squamous cell carcinoma cells via ALOX12 / AMPK / ACC1.

[0072] In this embodiment, Western blotting analysis was used to examine the effects of circRPS14 on the ALOX12 / AMPK / ACC1 signaling pathway and the expression of ferroptosis markers GPX4 and SLC7A11 in head and neck squamous cell carcinoma.

[0073] Cells were divided into a control group and a circRPS14 overexpression group. Total cellular protein was extracted from cultured cells in each experimental group, and the expression levels of relevant proteins were analyzed by Western blotting. Specifically, total cellular protein was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The electrophoretic bands were transferred to polyvinylidene fluoride (PVDF) membranes (Milan, Italy), sealed with 5% fat-free milk, and then incubated overnight at 4°C with antibodies against ALOX12, p-AMPK, AMPK, p-ACC1, ACC1, GPX4, SLC7A11, and GAPDH as an internal control. The membranes were further incubated with the corresponding secondary antibodies (affinity, 1:10000). Finally, the membranes were placed in an electrophoresis gel imaging system (ChemiScope 6000, CLIX, Shanghai, China) for imaging analysis.

[0074] 3. Test Results

[0075] 3.1) Detection results of reactive oxygen species (ROS) are as follows: Figure 4 As shown in Figure A, compared with the control group, the ROS content in CAL27 cells was significantly increased after overexpression of circRPS14. This result indicates that overexpression of circRPS14 can promote the accumulation of ROS in head and neck squamous cell carcinoma cells.

[0076] 3.2) The results of lipid peroxidation are as follows: Figure 4 As shown in Figure B, compared with the control group, the green fluorescence of oxidized cells in CAL27 cells was significantly enhanced after overexpression of circRPS14, indicating that overexpression of circRPS14 can promote lipid peroxidation in head and neck squamous cell carcinoma cells.

[0077] 3.3) The results of the western blot are as follows Figure 5 As shown, compared with the control group, overexpression of circRPS14 significantly increased the levels of ALOX12, p-AMPK, and p-ACC1 in CAL27 cells, while significantly decreased the expression levels of ferroptosis marker proteins GPX4 and SLC7A11. These results indicate that overexpression of circRPS14 can promote ferroptosis in head and neck squamous cell carcinoma by activating the ALOX12 / AMPK / ACC1 signaling pathway and downregulating the expression of GPX4 and SLC7A11 proteins.

[0078] Example 3: circRPS14 inhibits the migration, colony formation, and proliferation of head and neck squamous cell carcinoma.

[0079] 1. Effect of circRPS14 overexpression on the migration of head and neck squamous cell carcinoma

[0080] The cell scratch assay is used to evaluate the effect of drugs on the migration ability of tumor cells. First, two parallel lines, used for marking during photography, are drawn on the bottom of a 24-well plate with a marker. Cells are divided into a control group and a circRPS14 overexpression group. After transfection, the transfected cells are digested and centrifuged, and seeded into 24-well plates at a density of 2 × 10⁴ cells / well. Once the cell density in the wells reaches 100%, a straight line is drawn on the bottom of the well using a 200 μL pipette tip, creating a blank area between the cells. The 24-well plate is gently shaken, and the dead cells are washed with PBS. Fresh cell culture medium is added. Cell migration at the bottom of the wells is photographed using an inverted microscope at 0 h, 24 h, and 48 h. Statistical analysis is performed using ImageJ to calculate the cell migration rate.

[0081] 2. Effects of circRPS14 overexpression on colony formation in head and neck squamous cell carcinoma

[0082] Cells were divided into a control group and a circRPS14 overexpression group. After transfection, the transfected cells were digested and centrifuged, and then distributed at 5 × 10⁶ cells per well. 2 Cell density: CNE, TU686, CAL27, and FADU cells were seeded into 6-well plates. Cell colonies were observed after 14 days of growth in a 37°C cell culture incubator, with fresh culture medium added every 3-4 days. After 14 days, colonies were fixed with 4% paraformaldehyde for 10 minutes, washed twice with PBS, and then stained with crystal violet at room temperature for 10 minutes. After washing thoroughly with PBS, visible colonies were counted and photographed.

[0083] 3. Effect of circRPS14 overexpression on the proliferation of head and neck squamous cell carcinoma

[0084] Cells were divided into a control group and a circRPS14 overexpression group. After transfection, the transfected cell lines were seeded at 5 × 10⁶ cells / well. 4 Cells were seeded at a density of [number] cells per well in 96-well plates. After cell attachment, MTT solution (5 mg / mL) was added at 0 h, 24 h, 48 h, and 72 h, and the cells were incubated at 37°C for 3.5–4 h. Subsequently, 150 μL of dimethyl sulfoxide (DMSO) was added to dissolve the blue-purple formazan crystals produced by the live cells, and the optical density (OD) at 570 nm was measured using a microplate reader (Thermo Fisher Scientific, USA). This experiment was repeated at least three times.

[0085] 4. Test Results

[0086] 4.1) The results of the cell scratch assay are as follows: Figure 6 As shown in Figure A, compared with the control group, the migration distance of CAL27 cells overexpressing circRPS14 was significantly shorter than that of the control group cells, and this was time-dependent. The results indicate that overexpression of circRPS14 can inhibit the migration ability of head and neck squamous cell carcinoma cells.

[0087] 4.2) Results of the clonogenic experiment are as follows Figure 6 As shown in Figure B, compared with the control group, the number of clones in CAL27 cells after overexpression of circRPS14 was significantly less than that in the control group. The results indicate that overexpression of circRPS14 can inhibit the clonogenic ability of head and neck squamous cell carcinoma cells.

[0088] 4.3) The results of the cell proliferation curve are as follows: Figure 6 As shown in Figure C, compared with the control group, the proliferation ability of CAL27 cells after overexpression of circRPS14 was significantly lower than that of the control group cells. The results indicate that overexpression of circRPS14 can inhibit the proliferation ability of head and neck squamous cell carcinoma cells.

[0089] Example 4: circRPS14 inhibits the growth of head and neck squamous cell carcinoma tumors.

[0090] 1. Evaluation of the effect of circRPS14 on tumor growth in a nude mouse xenograft model

[0091] A nude mouse xenograft model was established to evaluate the inhibitory effect of circRPS14 on tumor growth. SPF-grade female BALB / c Nude mice, aged 5–6 weeks and weighing 15–18 g, were selected. Cultured tumor cells were digested and centrifuged, resuspended in PBS, and the cell suspension was mixed with Matrigel matrix gel at a 1:1 ratio to achieve a final density of 1 × 10⁸ cells / mL. The nude mice were placed sideways in a clean bench. The cell suspension was first thoroughly mixed by pipetting 1 mL of the suspension. Using a 1 mL syringe, 100 μL of the cell suspension was injected subcutaneously into the back of each mouse, gently pushing upwards to prevent leakage. Tumor volume was measured one week later, and measured when the tumor reached approximately 100 mm². 3 Mice were randomly divided into a blank control group and an experimental group. Starting the second day and continuing every other day, mouse weight and tumor volume were recorded using the formula v = ab. 2 / 2 (where a represents tumor length and b represents tumor width) to assess tumor size. The cycle is set to 21 days.

[0092] 2. Test Results

[0093] Evaluation results of the nude mouse xenograft model are as follows: Figure 7 As shown, compared with the control group, the tumor volume of mice overexpressing circRPS14 was significantly smaller than that of the control group, indicating that overexpression of circRPS14 can significantly inhibit the growth of head and neck squamous cell carcinoma tumors.

[0094] In summary, circPRS14 can directly bind to miR-16-5p and sponge-adsorb miR-16-5p, thereby activating the ALOX12 / AMPK / ACC1 signaling pathway in head and neck squamous cell carcinoma, promoting ferroptosis, and thus inhibiting the proliferation, migration, colony formation, and in vivo tumor growth of head and neck squamous cells, inhibiting the development of head and neck squamous cell carcinoma. Therefore, it can be considered as a candidate therapeutic drug for head and neck squamous cell carcinoma and has great clinical value.

[0095] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The use of circular RNA circRPS14 in the preparation of drugs for the prevention and / or treatment of head and neck squamous cell carcinoma, wherein the circular RNA circRPS14 is hsa_circ_0074535.

2. The application according to claim 1, characterized in that: The circular RNA circRPS14 inhibits at least one of the following: cancer cell proliferation, cancer cell migration, cancer cell clone formation, cancer cell ferroptosis, and tumor growth in vivo.

3. The application according to claim 1, characterized in that: The circular RNA circRPS14 achieves the purpose of preventing and / or treating squamous cell carcinoma of the head and neck through at least one of the following: (a) Sponge adsorption of miR-16-5p; (b) Promotes ROS accumulation in tumor cells; (c) Promotes lipid peroxidation in tumor cells; (d) Inhibit the expression of ferroptosis marker proteins GPX4 and SLC7A11 in tumor cells; (e) Inhibits tumor cell proliferation, migration, and colony formation; (f) Inhibit the growth of tumors in the body.

4. The application according to any one of claims 1 to 3, characterized in that: The drug comprises a preventive and / or therapeutically effective amount of the circular RNA circRPS14 and its pharmaceutically acceptable nucleic acid drug delivery system.

5. The application according to claim 4, characterized in that: The nucleic acid drug delivery system is one or more of hydrogels, nanovesicles, nanoparticles, and lentiviruses.

6. The application according to claim 4, characterized in that: The dosage form of the drug is one of the following: tablets, capsules, pills, suppositories, aerosols, oral liquid preparations, granules, powders, injections, tinctures, ointments, and films.

7. The application according to claim 4, characterized in that: The drug can be administered via one of the following routes: oral, injection, implantation, or inhalation.

Images