A method for controlling membrane fouling by applying polysaccharide-degrading bacteria

Abstract

The application belongs to the technical field of water treatment, and particularly relates to a membrane pollution control method using polysaccharide-degrading bacteria. The application takes activated sludge in a MBR as a source of screening bacteria, and through culture with sodium alginate as a substrate, a strain of bacteria with polysaccharide-degrading performance, i.e., P.carboxydivorans P-1 strain, is screened and separated. The bacterial solution of the strain is injected and encapsulated in a hollow fiber membrane cavity, and the hollow fiber membrane encapsulating the polysaccharide-degrading bacteria is placed in a membrane bioreactor, which can be used for membrane pollution control. The above technical scheme of the application can effectively reduce the content of polysaccharide in soluble microbial products (SMP) and extracellular polymeric substance (EPS) in the membrane bioreactor, reduce the viscosity of the activated sludge, thereby reducing the adhesion of microorganisms on the membrane surface, and durably and effectively controlling the membrane pollution of the membrane bioreactor (MBR).

Description

Technical Field

[0001] This invention belongs to the field of water treatment technology, specifically relating to a membrane fouling control method using polysaccharide-degrading bacteria. Background Technology

[0002] A membrane bioreactor (MBR) is a novel wastewater treatment system that organically combines membrane separation technology with biological treatment technology. This system replaces the secondary sedimentation tank at the end of traditional biological treatment processes with membrane modules, maintaining a high concentration of activated sludge within the bioreactor, increasing the organic load of biological treatment, thereby reducing the footprint of wastewater treatment facilities, and minimizing excess sludge by maintaining a low sludge load. Its main function is to utilize membrane separation equipment to remove activated sludge and large molecular organic matter from the water.

[0003] MBR technology offers numerous advantages, such as the complete separation of hydraulic retention time and sludge age within the bioreactor. This allows for a high sludge age with a relatively short retention time, creating favorable conditions for the degradation of organic and nitrogenous pollutants. However, with the widespread application of MBR technology, some problems have gradually emerged, among which membrane fouling is a major obstacle to its further large-scale application. Numerous studies have shown that biofilm fouling is inevitable during MBR operation, leading to continuous biofilm thickening, which in turn degrades membrane performance, reduces flux, necessitates frequent membrane cleaning, affects membrane lifespan, and may even cause performance degradation. Membrane biofouling significantly increases the operating cost of MBR, thus greatly hindering its further promotion. Therefore, controlling membrane fouling in MBR is crucial.

[0004] Extracellular polymers secreted by microorganisms are the main components of membrane fouling. These polymer macromolecules mainly include proteins, peptides, lipids, and polysaccharides, among which polysaccharides are the primary cause of membrane fouling. Therefore, effectively reducing the concentration of polysaccharides in MBR can effectively inhibit membrane fouling, increase membrane lifespan, and thus significantly reduce the cost of the MBR process. Summary of the Invention

[0005] To overcome the shortcomings of the prior art, the present invention provides a membrane fouling control method using the polysaccharide-degrading bacterium Pseudonocardia carboxydivorans. This method can effectively reduce the polysaccharide content in soluble microbial products (SMP) and extracellular polymeric substances (EPS) in membrane bioreactors, reduce the viscosity of activated sludge, thereby reducing the adhesion of microorganisms to the membrane surface and effectively and persistently controlling membrane fouling in membrane bioreactors (MBR).

[0006] To achieve the above objectives, this invention provides a newly screened and isolated polysaccharide-degrading bacterium, *P. carboxydivorans* P-1, which was obtained by inoculating 1% of activated sludge from an MBR (Mechanical Bioreactor) into 100 ml of sodium alginate liquid culture medium at a concentration of 1%, followed by multiple purification and enrichment cultures in both liquid and solid media (sodium alginate being the sole carbon source). Simultaneously, a membrane fouling control method based on the polysaccharide-degrading bacterium *P. carboxydivorans* P-1 is also provided. Specifically, during the initial operation of the reactor, the polysaccharide-degrading bacterium *P. carboxydivorans* is encapsulated within a hollow fiber membrane and then placed in the membrane bioreactor.

[0007] Specifically, the technical solution adopted in this invention is:

[0008] The first aspect of this invention provides a polysaccharide-degrading bacterium (Pseudonocardia carboxydivorans) strain P-1, which was deposited at the Guangdong Provincial Microbial Culture Collection Center on November 22, 2024, with accession number GDMCCNO:65529; the 16S rDNA sequence of the polysaccharide-degrading bacterium P-1 is shown in SEQ ID No: 1.

[0009] The second aspect of this invention provides the application of the polysaccharide-degrading bacterium (Pseudonocardia carboxydivorans) P-1 strain described in the first aspect in the control of membrane fouling in membrane bioreactors.

[0010] This invention utilizes the degradation effect of P. carboxydivorans Strain P-1 on polysaccharide macromolecules. In the initial stage of membrane bioreactor operation, P. carboxydivorans Strain P-1 is encapsulated in a hollow fiber membrane, and then the membrane is placed in the membrane bioreactor. This strain can reduce the content of polysaccharides in soluble microbial products (SMP) and extracellular polymeric substances (EPS) in the membrane bioreactor, reduce the viscosity of activated sludge, thereby reducing the adhesion of microorganisms on the membrane surface and effectively controlling membrane fouling of the membrane bioreactor in a long-term and effective manner.

[0011] The third aspect of the present invention provides a method for controlling membrane fouling, specifically: in the initial stage of operation of the membrane bioreactor, the polysaccharide-degrading bacteria (Pseudonocardia carboxydivorans) P-1 strain described in the first aspect is encapsulated in a hollow fiber membrane and then placed in the membrane bioreactor.

[0012] Preferably, the method for encapsulating the polysaccharide-degrading bacteria (Pseudonocardia carboxydivorans) P-1 strain in a hollow fiber membrane is as follows: after culturing the polysaccharide-degrading bacteria (Pseudonocardia carboxydivorans) P-1 strain, the bacterial solution is collected and injected into the membrane filaments of the hollow fiber membrane.

[0013] More preferably, the amount of bacterial solution injected is 1-3% of the volume of the membrane bioreactor.

[0014] More preferably, the pore size of the membrane fiber is 0.1-1 μm.

[0015] More preferably, the polysaccharide-degrading bacterium *Pseudonocardia carboxydivorans* strain P-1 was cultured using sodium alginate liquid medium. The sodium alginate liquid medium was prepared as follows: sodium alginate 1 g / L, (NH4)2SO4 0.5 g / L, KH2PO4 0.2 g / L, K2HPO4 0.8 g / L, NaCl 1 g / L, MgSO4·7H2O 0.5 g / L, CaCl2 0.2 g / L; sterilized at 100°C for 30 min. The solid medium was prepared by adding 1.8% agar to the liquid medium.

[0016] More preferably, the OD of the bacterial culture 600 It ranges from 0.12 to 1.2.

[0017] The fourth aspect of the present invention provides a microbial agent for controlling membrane fouling in membrane bioreactors, wherein the microbial agent uses the polysaccharide-degrading bacterium (Pseudonocardia carboxydivorans) P-1 strain described in the first aspect as the main active ingredient.

[0018] Preferably, the bacterial agent is a bacterial solution formed by fermentation culture of the polysaccharide-degrading bacterium (Pseudonocardia carboxydivorans) P-1 strain described in the first aspect.

[0019] Compared with the prior art, the beneficial effects of the present invention are:

[0020] This invention enriches a polysaccharide-degrading bacterium, *P. carboxydivorans* Strain P-1, from activated sludge in an MBR (Membrane Bioreactor) using sodium alginate medium. This strain can effectively degrade polysaccharide macromolecules in the membrane bioreactor. Simultaneously, a membrane fouling control method is established based on this polysaccharide-degrading bacterium. In the initial stage of membrane bioreactor operation, *P. carboxydivorans* Strain P-1 is encapsulated within a hollow fiber membrane, which is then placed inside the membrane bioreactor. This reduces the polysaccharide content in soluble microbial products (SMPs) and extracellular polymeric substances (EPS) in the membrane bioreactor, lowers the viscosity of the activated sludge, thereby reducing microbial adhesion to the membrane surface and effectively controlling membrane fouling in a sustained manner. This invention reduces polysaccharide content and controls membrane fouling in the membrane bioreactor using the polysaccharide-degrading bacterium Strain P-1 without affecting the removal efficiency of COD and ammonia nitrogen by the MBR. Attached Figure Description

[0021] Figure 1 This is an phylogenetic tree of Pseudonocardia carboxydivorans Strain P-1.

[0022] Figure 2 Diagram of an experimental setup for MBR membrane fouling control;

[0023] Figure 3 The viscosity of the MBR sludge;

[0024] Figure 4 This refers to the polysaccharide content in SMP.

[0025] Figure 5 This refers to the polysaccharide content in EPS;

[0026] Figure 6 This is a diagram illustrating the effectiveness of MBR membrane fouling control. Detailed Implementation

[0027] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0028] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0029] Example 1:

[0030] This embodiment provides the isolation and identification process of the polysaccharide-degrading bacterium *Pseudonocardia carboxydivorans* Strain P-1, which was extracted and isolated from MBR sludge in a laboratory-scale facility in Guangdong, China. The specific steps are as follows:

[0031] (1) Activated sludge was obtained from a wastewater treatment plant in southern China and added to a laboratory-scale MBR for one month of acclimatization. Using the activated sludge (MBR suspended sludge) as the inoculum, it was inoculated into 100 mL of sodium alginate liquid medium at a concentration of 1% by volume. The medium was then enriched and cultured on a shaker at 30℃ and 150 mpm for 72 h. After the bacterial solution became turbid, it was transferred to a new medium for further cultivation. The sodium alginate liquid medium was prepared as follows: sodium alginate 1 g / L, (NH4)2SO4 0.5 g / L, KH2PO4 0.2 g / L, K2HPO4 0.8 g / L, NaCl 1 g / L, MgSO4·7H2O 0.5 g / L, CaCl2 0.2 g / L; sterilized at 100℃ for 30 min. The solid medium was prepared by adding 1.8% agar to the liquid medium.

[0032] (2) Dilute the bacterial solution obtained from the enrichment culture to 10. -7 ~10 -4 Spread the diluted solution onto sodium alginate solid culture medium, seal with sealing film, and incubate upside down at 30°C for 72 hours. Observe the colony morphology.

[0033] (3) Select different colonies with good growth status, inoculate them into liquid culture medium, and incubate at 30℃ and 150rpm for 72h.

[0034] (4) Take a small amount of bacterial solution with an inoculation loop and inoculate it into a solid culture medium using the streak plate method. Incubate at 30°C upside down for 72 hours. Repeat steps (2) and (3) 3 to 4 times until the colonies on the plate show a single morphology.

[0035] (5) Select single colonies in sodium alginate liquid medium, incubate at 30℃ and 150rpm for 120h, preserve in glycerol tubes, and store in a -80℃ refrigerator.

[0036] Thus far, a purified strain has been initially obtained, designated as Strain P-1. Strain P-1 grows relatively slowly. After 60 hours of culture on sodium alginate solid medium, visible colonies form on the plate. After 5 days, more distinctive colonies are formed, which are pinkish-white, opaque, dry and rough on the surface, granular, and brownish-red at the bottom.

[0037] Next, strain Strain P-1 was identified, and all experimental procedures were performed under aseptic conditions. First, the isolated Strain P-1 strain was molecularly identified using universal 16S rDNA primers (27F: AGAGTTTGATCCTGGCTCAG, 1492R: TACGGCTACCTTGTTACGACTT). Then, Beijing Biomarker Biotechnology Co., Ltd. performed whole-genome sequencing on the strain. The obtained 16S rDNA sequence (SEQ ID: NO 1) was BLAST-aligned in the NCBI Genome database, and the sequence with the highest similarity (99.79%) was selected as the species identification result. Strain P-1 was ultimately identified as *Pseudonocardia*, belonging to the phylum *Actinobacteria*, and phylum *Actinobacteria* was further analyzed for phylum *Actinobacteria*. Figure 1 The strain P-1 was confirmed to be a different strain of the same species of Pseudomonas.

[0038] Finally, strain Strain P-1 was deposited, and the deposit information is as follows: deposit date: November 22, 2024, depository: Guangdong Provincial Microbial Culture Collection Center (GDMCC), deposit number: GDMCC NO:65529, depository address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, classification name: Pseudonocardia carboxydivorans StrainP-1.

[0039] Pseudonocardia carboxydivorans Strain P-116S rDNA sequence (1418bp, SEQID: NO 1):

[0040]

[0041] Example 2:

[0042] This embodiment provides a membrane fouling control method based on the polysaccharide-degrading bacterium P. carboxydivorans, as detailed below:

[0043] Two MBR reactors with a reaction volume of 1.8L were constructed (MBR1 and MBR2). Figure 2 The system consists of an influent system, an MBR reactor, an aeration system, and an effluent system. The influent system comprises an influent tank and an influent pump; the aeration system comprises a gas flow meter and an air pump, with two air pumps in total, one for continuous aeration and the other for intermittent aeration to ensure more uniform mixing of mud and water; the effluent system includes an effluent pump and a pressure gauge.

[0044] A control experiment was conducted, with two integrated aerobic MBR reactors operating in parallel. Each reactor contained two PVDF hollow fiber membranes with a pore size of 0.45 μm and an effective membrane area of ​​0.016 m². 2 The filtration flux is 12 (L·m -2

[0045] ·h), such as Figure 3 As shown in the figure. In the control group, one membrane module was used for normal effluent, and the other membrane module was added with pure water and placed in the reactor; while in the experimental group, one membrane module was used for effluent, and the other membrane module was added with P. carboxydivoransStrain P-1 bacterial solution and placed in the reactor.

[0046] The activated sludge in both MBR reactors was taken from the return sludge of the secondary sedimentation tank of the municipal wastewater treatment plant, with a sludge concentration of approximately 5000 mg / L. 1.8 L of activated sludge was added to each reactor. The influent to the MBR reactors was domestic sewage from the residential area. Additionally, 200 mg / L of NaHCO3 was added to the influent to adjust the alkalinity to approximately 7.2. MBR1 served as a blank control reactor, and MBR2 served as the experimental reactor. In the initial stage of the experiment, 18 mL of *Carboxydivorans StrainP-1* bacterial culture was injected into the membrane fibers attached to MBR2. [Example 1, Step (5) of the culture yielded bacterial culture, OD...] 600 Hollow fiber membranes with a pH value between 0.12 and 1.2 were used in the control group, while hollow fiber membranes with 18 mL of pure water were used in the control group. During operation, the transmembrane pressure difference was recorded using a pressure sensor and a microcontroller. Sludge samples were periodically collected to extract SMP and EPS, and their concentrations and polysaccharide content were measured. Results are shown below. Figure 3-5 .

[0047] Depend on Figure 3The results showed that the average viscosity of the sludge in MBR1 was 8.25 mPa·s, while the average viscosity of the sludge in MBR2 was 6.66 mPa·s, indicating that the sludge viscosity of MBR2 was 19% lower than that of MBR1. This suggests that the P. carboxydivorans Strain P-1 strain can slow down the membrane fouling rate by affecting the viscosity of activated sludge, making it less likely to adhere to the membrane module.

[0048] Depend on Figure 4 and Figure 5 The results showed that the polysaccharide content of SMP and EPS in MBR2 was lower than that in MBR1. This indicates that the *P. carboxydivorans* Strain P-1 strain can control membrane fouling by reducing the polysaccharide concentration in the MBR reactor, thereby affecting the adhesion of polysaccharide macromolecules to the membrane module and slowing down the rate of membrane flux decline.

[0049] Depend on Figure 6 The results showed that, within the same operating time, MBR1 experienced 13 complete fouling / cleaning cycles (average fouling rate of 3.69 kPa / day), while MBR2 only experienced 7 fouling / cleaning cycles (average fouling rate of 1.66 kPa / day). This indicates that adding P. carboxydivorans Strain P-1 strain to the MBR reactor can effectively alleviate membrane fouling. Furthermore, by injecting the Strain P-1 bacterial solution into the hollow fiber membrane and then attaching it to the reactor, the polysaccharide degradation performance of P. carboxydivorans Strain P-1 strain can be effectively maintained, thus enabling it to continuously and effectively control membrane fouling.

[0050] The embodiments of the present invention have been described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and these variations still fall within the protection scope of the present invention.

Claims

1. A polysaccharide-degrading bacterium, *Pseudonocardia carboxydivorans* strain P-1, characterized in that, The polysaccharide-degrading bacterium *Pseudonocardia carboxydivorans* strain P-1 was deposited at the Guangdong Provincial Microbial Culture Collection Center on November 22, 2024, with accession number GDMCC NO: 65529; the 16S rDNA sequence of the polysaccharide-degrading bacterium P-1 is shown in SEQ ID No:

1.

2. The application of the polysaccharide-degrading bacterium Pseudonocardia carboxydivorans P-1 strain according to claim 1 in membrane fouling control of membrane bioreactors.

3. A method for controlling membrane fouling in a membrane bioreactor, characterized in that, In the initial stage of operation of the membrane bioreactor, the polysaccharide-degrading bacterium Pseudonocardia carboxydivorans P-1 as described in claim 1 is encapsulated in a hollow fiber membrane and then placed in the membrane bioreactor.

4. The membrane fouling control method for a membrane bioreactor according to claim 3, characterized in that, The method for encapsulating the polysaccharide-degrading bacterium Pseudonocardia carboxydivorans P-1 in a hollow fiber membrane is as follows: the polysaccharide-degrading bacterium Pseudonocardia carboxydivorans P-1 is cultured to the stationary phase, and then the stationary phase bacterial solution is collected and injected into the membrane fibers of the hollow fiber membrane.

5. A method for controlling membrane fouling in a membrane bioreactor according to claim 4, characterized in that, The injection volume of the polysaccharide-degrading bacteria Pseudonocardia carboxydivorans P-1 in the stationary phase is 0.1-2% of the volume of the reactor sludge mixture, and the mass ratio of bacteria to sludge is 0.05%-1.5%.

6. The method for controlling membrane fouling in a membrane bioreactor according to claim 4, characterized in that, The pore size of the membrane fibers is 0.1-1 μm.

7. A method for controlling membrane fouling in a membrane bioreactor according to claim 4, characterized in that, The polysaccharide-degrading bacterium *Pseudonocardia carboxydivorans* P-1 was cultured using sodium alginate liquid medium. The sodium alginate liquid medium was prepared as follows: sodium alginate 1 g / L, (NH4)2SO4 0.5 g / L, KH2PO4 0.2 g / L, K2HPO4 0.8 g / L, NaCl 1 g / L, MgSO4·7H2O 0.5 g / L, CaCl2 0.2 g / L; sterilized at 100 ℃ for 30 min.

8. A method for controlling membrane fouling in a membrane bioreactor according to claim 4, characterized in that, OD of bacterial culture 600 It ranges from 0.12 to 1.

2.

9. A microbial agent for controlling membrane fouling in membrane bioreactors, characterized in that, The bacterial agent uses the polysaccharide-degrading bacterium Pseudonocardia carboxydivorans P-1 strain as described in claim 1 as the main active ingredient.

10. The microbial agent for controlling membrane fouling in membrane bioreactors according to claim 9, characterized in that, The bacterial agent is a bacterial solution formed by fermentation culture of the polysaccharide-degrading bacterium Pseudonocardia carboxydivorans P-1.

Images