Xanthophylls and carotenoids

Abstract

The present application relates to the genetic breeding field of Xanthoceras sorbifolia Bunge, in particular to a Xanthoceras sorbifolia Bunge nervonic acid content tightly linked SNP molecular marker and application thereof. The present application further designs specific molecular markers and primer combinations thereof based on the SNP site on the 3rd chromosome of Xanthoceras sorbifolia Bunge, which is significantly associated with the control of nervonic acid content, thereby constructing the SNP site tightly linked to the nervonic acid content of Xanthoceras sorbifolia Bunge, the molecular marker thereof, the application thereof in identifying Xanthoceras sorbifolia Bunge varieties with high nervonic acid content, and the identification method. The identification method has high accuracy and greatly improves the identification efficiency, and provides a practical tool that can be popularized for large-scale germplasm resource screening. In addition, the SNP marker of the present application is located on the intron of the KCS gene, which provides a theoretical basis for subsequent KCS gene research. The present application provides convenience for variety trait improvement and the like, and the development of the SNP marker has important significance for the cultivation of Xanthoceras sorbifolia Bunge varieties with high nervonic acid content.

Description

Technical Field

[0001] This invention relates to the fields of genetic breeding and molecular biology of Xanthoceras sorbifolium, and particularly to a tightly linked SNP molecular marker for nervonic acid content in Xanthoceras sorbifolium and its application. Background Technology

[0002] *Xanthoceras sorbifolium* Bunge, also known as the Chinese privet tree, is a deciduous shrub or small tree belonging to the genus *Xanthoceras* in the family Sapindaceae. It is a woody oilseed tree species endemic to China, widely distributed in arid and semi-arid regions of northern China, exhibiting strong resistance to adverse conditions (cold, drought, and salinity) and ecological restoration capabilities. *Xanthoceras sorbifolium* has high nutritional and industrial value. Its pericarp, seed coat, kernel, leaves, and flowers contain nearly a hundred chemical components, including fatty acids, tocopherols, and flavonoids. The seeds and kernels are rich in oil, with the kernel containing as much as 60%-70% oil (Zhou Liru et al., 2025). *Xanthoceras sorbifolium* oil is a novel healthy edible vegetable oil rich in unsaturated fatty acids, particularly containing 1.25%-4.70% nervonic acid (C24:1), which is generally lacking in other edible vegetable oils. It has strong antioxidant and free radical scavenging functions, showing good effects in preventing hypertension and lowering blood lipids, and possesses extremely high health benefits.

[0003] Nervonic acid, scientifically known as cis-15-tetracosenoic acid (C24:1), is a very long-chain monounsaturated fatty acid (VLCFA). It is a core component in the synthesis of myelin sheaths in brain nerve fibers, directly participating in the synthesis and stability maintenance of the myelin sheath. It is currently the only known substance that can promote the repair and regeneration of damaged nerves, playing a crucial role in brain development. As a neuroinfluencing factor, nervonic acid has significant effects in treating Parkinson's syndrome, accelerating the development of the infant brain and visual nerves, and improving memory. It can also repair damaged nerve fibers in the brain and promote nerve cell regeneration. As a component of biological membranes, nervonic acid plays an active role in the binding of neurotransmitters and receptors, enabling timely feedback of brain information and preventing brain aging and Alzheimer's disease. In scientific research and production, nervonic acid derivatives (such as nervonic acid methyl ester) can be synthesized for use as drug carriers or nanomaterials.

[0004] β-ketoacyl-CoA synthase in the nervonic acid synthesis pathway KCS The role of genes has attracted the attention of many researchers. (Li et al. (2021)) [1] garlic MoKCS11Overexpression of the gene in the model plant Arabidopsis thaliana and the oilseed crop Capsella bursa-pastoris resulted in seed nervonic acid accumulation reaching 5% of total fatty acids. Liang et al. (2022) [2] Studies have found that, compared with Arabidopsis thaliana AtKCS2 / 20 The same species of *Xanthoceras sorbifolium* KCS Gene( XS04G00959 The expression changes of nervonic acid are correlated with the trend of nervonic acid content changes. The nervonic acid content in the kernel oil of *Xanthoceras sorbifolium* remains low and varies significantly among different germplasms, restricting the high-value development and utilization of *Xanthoceras sorbifolium*. Traditional crop breeding is time-consuming, inefficient, and labor-intensive. Molecular marker-assisted breeding, based on genotype screening of germplasm resources, avoids or reduces errors in phenotypic selection, and can greatly improve breeding efficiency. Currently, molecular marker-assisted breeding is widely used in various crop breeding programs.

[0005] Because there are many genetic loci controlling the nervonic acid content in Xanthoceras sorbifolium and the genetics are quite complex, no SNP loci and corresponding molecular markers that can efficiently and accurately identify high nervonic acid strains have yet been developed. Therefore, existing technologies need further improvement. Summary of the Invention

[0006] Based on association analysis of the Xanthoceras sorbifolium genome, this invention is the first to discover and pinpoint a SNP locus (SNP: 25262589) located on chromosome 3 of Xanthoceras sorbifolium that is significantly associated with the control of nervonic acid content. Around this locus, this invention further designed specific molecular markers and their amplification primer combinations, thereby constructing a SNP locus closely linked to the nervonic acid content of Xanthoceras sorbifolium, its molecular markers, their application in identifying Xanthoceras sorbifolium varieties with high nervonic acid content, and an identification method. This identification method has high accuracy and efficiency.

[0007] The specific technical solution of the present invention is as follows:

[0008] This invention provides a tightly linked SNP site for nervonic acid content in *Xanthoceras sorbifolium*, wherein the SNP site is located at position 25262589 on chromosome 3 of *Xanthoceras sorbifolium*. KCS Gene XS03G0218400 Intron regions [3] Its polymorphism is G / A.

[0009] This invention also provides the application of the above-mentioned tightly linked SNP sites of nervonic acid content in *Xanthoceras sorbifolium* in the identification of *Xanthoceras sorbifolium* varieties with high nervonic acid content, that is, the use of the above-mentioned tightly linked SNP sites of nervonic acid content in the preparation of detection reagents, detection chips or detection kits for the identification or auxiliary identification of *Xanthoceras sorbifolium* varieties with high nervonic acid content, as well as their application in the screening of *Xanthoceras sorbifolium* germplasm resources with high nervonic acid content, early molecular marker-assisted selection, molecular design breeding and germplasm improvement.

[0010] Based on the specific SNP molecular marker of this SNP site, the nucleotide sequences of the molecular marker are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively; wherein, the sequence has a G / A single nucleotide polymorphism at the 209th base from the 5′ end, the G allele corresponds to SEQ ID NO.1, and the A allele corresponds to SEQ ID NO.2.

[0011] Primer pairs for detecting the aforementioned specific SNP molecular markers, the nucleotide sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0012] The present invention also provides the application of the specific SNP molecular marker described above in the identification of *Sapindus mukorossi* varieties with high nervonic acid content.

[0013] A method for rapidly and accurately identifying high nervonic acid content genotypes in *Xanthoceras sorbifolium* germplasm resources or breeding populations using the aforementioned SNP molecular markers:

[0014] (1) Extract genomic DNA from *Sapindus mukorossi* samples;

[0015] (2) PCR amplification of extracted genomic DNA was performed using primer pairs with specific SNP molecular markers;

[0016] (3) Electrophoresis detection of the aforementioned PCR products;

[0017] (4) Perform Sanger sequencing on PCR products that show a single band;

[0018] (5) The determination is based on the sequencing results, and the specific criteria are as follows:

[0019] If the 209th base of the cloned product is A, then the tested *Sapindus mukorossi* plant carries the high nervonic acid allele and is classified as a candidate variety with high nervonic acid content.

[0020] If the 209th base of the cloned product is G, then the tested *Xanthoceras sorbifolium* plant carries the low nervonic acid allele and is classified as a candidate variety with low nervonic acid content.

[0021] Specifically, the PCR amplification reaction system in step (2) is as follows: total volume 50 μL, including 1 μL DNA, 1 μL upstream primer, 1 μL downstream primer, 20 μL H2O, and 25 μL 2×SanTaq PCR Mix. The PCR detection reaction conditions are: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; 55℃ annealing for 30 s; 72℃ extension for 30 s, for a total of 35 cycles.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] Precisely locate key genetic loci

[0024] This invention provides a novel SNP locus closely linked to nervonic acid content, located at position 252625893 on chromosome 3, with a polymorphism of G / A. This locus can serve as a specific genetic marker for the high nervonic acid trait. Identifying this locus significantly improves the accuracy of identifying high-nervonic-acid plants in unknown *Xanthoceras sorbifolium* samples to 85.71%, solving the problem of numerous and complex genetic loci controlling nervonic acid content in existing technologies, thus providing a core genetic target for the rapid identification of high-nervonic-acid plants.

[0025] Build an efficient batch identification system

[0026] This invention, based on the aforementioned key SNP sites, specifically develops corresponding SNP molecular markers, specific primers, and a method for identifying *Xanthoceras sorbifolium* varieties with high nervonic acid content using these SNP molecular markers. This method, based on the characteristics of the aforementioned SNP sites and combined with PCR amplification and sequencing, supports batch processing of *Xanthoceras sorbifolium* samples with an accuracy rate of 85.71%. Furthermore, this invention only requires the identification of one SNP marker, representing a substantial improvement over existing methods that require simultaneous detection of multiple KASP markers for screening. When dealing with a large number of varieties, this invention significantly improves identification efficiency, enabling targeted detection of nervonic acid content in *Xanthoceras sorbifolium* varieties and providing a widely applicable and practical tool for large-scale germplasm resource screening. In addition, the SNP markers of this invention are located on introns of the KCS gene, providing a theoretical basis for subsequent research on the KCS gene.

[0027] Significantly reduce breeding research and development costs and accelerate variety improvement

[0028] The high-nervate candidate plants screened using the SNP markers of this invention only require targeted nervate content determination of the target samples to confirm the final results, avoiding the manpower and time consumption of traditional methods. This method enhances the identification significance of high-nervate-content *Xanthoceras sorbifolium* varieties, providing key molecular evidence for early targeted breeding, genetic background analysis, and molecular design breeding of high-nervate *Xanthoceras sorbifolium* varieties, significantly shortening the breeding cycle, and is of great significance for the cultivation of high-nervate-content *Xanthoceras sorbifolium* varieties. Attached Figure Description

[0029] Figure 1 Manhattan plot of SNP sites associated with the proportion of nervonic acid in *Sapindus mukorossi*;

[0030] Figure 2 The sequencing results are those obtained after PCR amplification of 25 *Sapindus mukorossi* seed kernel materials using nervonic acid SNP primers.

[0031] Figure 3 The sequencing results are used to validate 15 leaves and kernels of *Sapindus mukorossi* using SNP markers. Detailed Implementation

[0032] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in the art. Unless otherwise specified, the methods in the following embodiments are conventional methods in the art.

[0033] To facilitate understanding of the invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined elsewhere in this document, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains.

[0034] Based on the references [4-6] In this invention, high nervonic acid content refers to a nervonic acid content in the *Xanthoceras sorbifolium* sample greater than 3.50%; low nervonic acid content refers to a nervonic acid content in the *Xanthoceras sorbifolium* sample less than 2.50%; and medium nervonic acid content refers to a nervonic acid content in the *Xanthoceras sorbifolium* sample between 2.5% and 3.5%. Example 1

[0035] Obtaining closely linked SNP sites in *Sapindus mukorossi* nervonic acid content

[0036] This invention provides a novel tightly linked SNP locus for nervonic acid content, located at position 252625893 on chromosome 3, with a polymorphism of G / A. Identifying this locus can improve the accuracy of identifying whether an unknown *Sapindus mukorossi* sample is a high-nervonic acid plant to 85.71%.

[0037] Figure 1 The Manhattan plot shows the SNP sites associated with the nervonic acid content of *Xanthoceras sorbifolium*. Each point in the plot represents a SNP. The vertical axis is the P-value calculated for each SNP, which is -log10. The horizontal axis is the chromosome where the SNP is located. The SNP pointed to by the arrow is position 25262589 on chromosome 3, which is a SNP site closely linked to the nervonic acid content of *Xanthoceras sorbifolium*. Example 2

[0038] Development of SNP molecular markers closely linked to nervonic acid content

[0039] 1. Design of SNP primers

[0040] SNP primers were designed based on the SNP sites provided in Example 1. The forward primer was SNP-F: CTCTTTCTAACTTCCGTTGT (SEQ ID NO.3), and the reverse primer was SNP-R: TGATGTTCTCTGTGCTGAC (SEQ ID NO.4). The PCR amplification product was 411 bp, and its sequence is shown in SEQ ID NO.1 and SEQ ID NO.2. The 209th position of the sequence is the polymorphic site G / A.

[0041]

[0042] 2. Extraction and PCR amplification of genomic DNA from samples

[0043] The base types of SNP sites in 25 *Xanthoceras sorbifolium* seed kernel samples were analyzed, including 8 samples with low nervonic acid content (nervonic acid content less than 2.50%), 8 samples with high nervonic acid content (nervonic acid content greater than 3.50%), and 9 samples with medium nervonic acid content (nervonic acid content between 2.99% and 3.46%). DNA was extracted from the *Xanthoceras sorbifolium* seed kernel samples using a DNA extraction kit.

[0044] Experimental methods

[0045] Using the genomes extracted from the 25 samples in the previous step as templates, a PCR reaction system was constructed under the following conditions: total volume 50 μL, including 1 μL DNA, 1 μL upstream primer, 1 μL downstream primer, 20 μL H2O, and 25 μL 2×SanTaq PCRMix. The PCR reaction conditions were: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; 55℃ annealing for 30 s; 72℃ extension for 30 s, for a total of 35 cycles.

[0046] (2) Results Analysis

[0047] The PCR products were directly sent to Sangon Biotech (Shanghai) Co., Ltd. for Sanger sequencing. The sequencing results are as follows: Figure 2 As shown, among the 25 cloned products, 11 samples exhibited a guanine (G) to adenine (A) mutation at 209 bp, representing a mutation rate of 44.00%. The proportion of nervonic acid in the mutated samples ranged from 2.11% to 5.09%. In the high-nervonic acid samples, 3 bases at this SNP site were G and 5 were A; in the low-nervonic acid samples, 5 bases at this SNP site were G and 3 were A. Therefore, this SNP site can be considered a key SNP site controlling the synthesis and accumulation of nervonic acid. Materials with this SNP site being A are potential high-nervonic acid germplasm.

[0048] 3. Validation of SNP markers

[0049] (1) Validation materials

[0050] Fifteen samples of *Xanthoceras sorbifolium* were subjected to nervonic acid testing and SNP validity verification.

[0051] (2) Experimental methods

[0052] The nervonic acid content of the sample was detected, genomic DNA was extracted from the sample and PCR amplification was performed, and the amplification product was sent to bioengineering for sequencing.

[0053] (3) Results Analysis

[0054] Fifteen samples of seed kernels and leaves from *Xanthoceras sorbifolium* were randomly selected. The nervonic acid content of the 15 samples is shown in Table 1.

[0055] Table 1. Percentage of nervonic acid in 15 samples of *Sapindus mukorossi*.

[0056]

[0057] Sequencing results as follows Figure 3 As shown, among the 15 cloned products, 7 samples exhibited a guanine (G) to adenine (A) mutation at 209 bp, representing a mutation rate of 46.67%. The proportion of nervonic acid in the mutated samples ranged from 2.90% to 3.86%. In the high-nervonic acid samples, all four bases at this SNP site were A; in the low-nervonic acid samples, all six bases at this SNP site were G. Therefore, the SNP site of this invention can serve as a key SNP site for controlling the synthesis and accumulation of nervonic acid. Example 3

[0058] A kit for evaluating the nervonic acid content of Xanthoceras sorbifolium.

[0059] I. Experimental Methods

[0060] The kit consists of the forward primer from Example 2: CTCTTTCTAACTTCCGTTGT (SEQ ID NO. 3), and the reverse primer: TGATGTTCTCTGTGCTGAC (SEQ ID NO. 4). This kit was used to test 15 *Xanthoceras sorbifolium* samples from Example 2.

[0061] II. Experimental Results

[0062] The test results were consistent with those obtained by Sanger sequencing in Example 2. This kit can be used to preliminarily evaluate the nervonic acid content of Xanthoceras sorbifolium.

[0063] References:

[0064] [1]Li ZW, Ma SJ, Song H, Yang Z, Zhao CZ, Taylor D, Zhang M. A 3-ketoacyl-CoA synthase 11 (KCS11) homolog from Malania oleifera synthesizesnervonic acid in plants rich in 11Zeicosenoic acid. Tree Physiol. 2021, 41:331-342.

[0065] [2]Liang Q, Liu JN, Fang H, Dong YH, Wang CX, Bao Y, Hou WR, Zhou R,Ma XM, Gai SS, Wang LC, Li SK, Yang KQ, Sang YL. Genomic and transcriptomicanalyses provide insights into valuable fatty acid biosynthesis andenvironmental adaptation of yellowhorn. Front. Plant Sci.2022, 13: 991197.

[0066] [3]Liu H, Yan XM, Wang XR, Zhang DX, Zhou Q, Shi TL, Jia KH, Tian XC,Zhou SS, Zhang RG, Yun QZ, Wang Q, Xiang Q, Mannapperuma C, Van Zalen E,Street NR, Porth I, El-Kassaby YA, Zhao W, Wang XR, Guan W, Mao JF.Centromere-Specific Retrotransposons and Very-Long-Chain Fatty AcidBiosynthesis in the Genome of Yellowhorn ( Xanthoceras sorbifolium ,Sapindaceae), an Oil-Producing Tree With Significant Drought Resistance.Front Plant Sci. 2021 Nov 22;12:766389.

[0067] [4] Tang Donghui et al. Analysis of oil content and fatty acid composition in different varieties of Sapindus mukorossi. China Oils and Fats, 2017, 42: 77-81;

[0068] [5] Liu Lingyue et al. Synergistic regulation of fatty acid formation in the kernel oil of *Sapindus mukorossi*. Molecular Plant Breeding 2019, 17: 1834-1842;

[0069] [6] Jiang Yi. Genome-wide association analysis of important economic traits of *Sapindus mukorossi* and identification of key genes for nervonic acid. Shenyang Agricultural University, 2025.

[0070] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. A specific SNP molecular marker closely linked to the nervonic acid content of *Sapindus mukorossi*, characterized in that, The nucleotide sequences of the molecular markers are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively; a G / A single nucleotide polymorphism exists at the 209th base from the 5' end of the sequence, with the G allele corresponding to SEQ ID NO.1 and the A allele corresponding to SEQ ID NO.

2.

2. The application of the specific SNP molecular marker of claim 1 in the identification of *Sapindus mukorossi* varieties with high nervonic acid content.

3. The application according to claim 2, characterized in that, This includes the preparation of detection reagents, detection chips, or detection kits for identifying or assisting in the identification of *Sapindus mukorossi* varieties with high nervonic acid content.

4. A method for identifying high nervonic acid content genotypes in *Xanthoceras sorbifolium* germplasm resources or breeding populations using the SNP molecular markers described in claim 1, characterized in that... Includes the following steps: (1) Extract genomic DNA from *Sapindus mukorossi* samples; (2) PCR amplification of extracted genomic DNA was performed using primer pairs with specific SNP molecular markers; (3) Electrophoresis detection of PCR products; (4) Perform Sanger sequencing on PCR products that show a single band; (5) Make a judgment based on the sequencing results; The specific criteria for step (5) are as follows: If the 209th base of the cloned product is A, then the tested *Sapindus mukorossi* plant carries the high nervonic acid allele and is classified as a candidate variety with high nervonic acid content. If the 209th base of the cloned product is G, then the tested *Xanthoceras sorbifolium* plant carries the low nervonic acid allele and is classified as a candidate variety with low nervonic acid content.

5. The method according to claim 4, characterized in that, The PCR amplification reaction system in step (2) consists of 1 μL DNA, 1 μL upstream primer, 1 μL downstream primer, 20 μL H2O, and 25 μL 2×SanTaq PCR Mix. The PCR detection reaction conditions are: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; 55℃ annealing for 30 s; and 72℃ extension for 30 s, for a total of 35 cycles.

Images