An indel molecular marker related to yellowing of leaves at growth point of melon seedling and application thereof
By developing Indel molecular markers for leaves at the growth point of melon seedlings and using ATTTAGTT insertion/deletion polymorphism for PCR and electrophoresis identification, the early screening problem of leaf yellowing trait in melon breeding was solved, improving breeding efficiency and accuracy and shortening the breeding cycle.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-20
- Publication Date
- 2026-03-27
AI Technical Summary
Existing technologies lack stable molecular markers associated with yellowing leaves at the growth point of melon seedlings, making early molecular-level screening and breeding impossible, resulting in low breeding efficiency.
An Indel molecular marker was developed that is associated with yellow leaves at the growing point of melon seedlings. The leaf color at the growing point of melon seedlings was identified by PCR amplification and polyacrylamide gel electrophoresis, and the genotype was identified by ATTTAGTT insertion-deletion polymorphism.
It enables rapid and reliable identification of leaf color at the growth point of melon seedlings, significantly improving the efficiency and accuracy of hybrid purity identification, shortening the breeding cycle, and reducing breeding costs.
Smart Images

Figure CN121137254B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular marker technology, and in particular to an Indel molecular marker associated with the yellowing of leaves at the growth point of melon seedlings and its application. Background Technology
[0002] melon( Cucumis melo Melon (L.) is a horticultural crop of significant economic value, widely loved by consumers for its unique color, aroma, and flavor, and extensively cultivated both domestically and internationally. Leaves are the primary site of photosynthesis in plants, and leaf color largely determines the plant's photosynthetic productivity. In the course of long-term melon germplasm innovation and breeding practice, this invention discovered a naturally occurring mutant material with yellowing true leaves at the melon's growing point. Through multiple generations of self-pollination on a single plant, a new germplasm with a stable genetic background was obtained. This germplasm exhibits specific and stable phenotypic characteristics: from the first true leaf at the growing point in the seedling stage, the newly emerging leaves at the growing point continuously exhibit a yellow phenotype, gradually turning to normal green as the leaves mature; throughout the entire vegetative growth period of the plant, the newly emerging leaves at the growing point maintain the yellow phenotype. This forms a significant and stable difference from the conventional melon germplasm phenotype of "all newly emerging true leaves at the growing point are green." This specific yellowing trait, due to its intuitive phenotype and genetic stability, possesses core potential as a "visual morphological marker trait."
[0003] Existing research indicates that leaf yellowing mutants are ideal experimental models for elucidating plant chlorophyll metabolism pathways, chloroplast structural development and functional regulation, and photosynthetic physiological mechanisms. Furthermore, leaf color mutations, as natural morphological markers, can be rapidly identified through visual observation during the melon seedling stage, without relying on complex instruments. This makes them highly efficient and convenient in breeding processes such as purity identification of hybrids (using yellowed leaf materials as maternal parents) and early screening of plants with target genotypes. However, the genetic regulation of leaf yellowing in melons remains unclear, and stable molecular markers closely linked to this trait are lacking, hindering early molecular-level screening. Summary of the Invention
[0004] To address the aforementioned problems, this invention provides an Indel molecular marker associated with yellowing leaves at the growing point of melon seedlings and its application. The Indel molecular marker provided by this invention is a molecular marker associated with yellowing leaves at the growing point of melon seedlings. Identifying the color of leaves at the growing point of melon seedlings using this molecular marker requires only one PCR amplification and polyacrylamide gel electrophoresis of the DNA of the plant to be tested. Identification can be performed based on the genotype of the molecular marker. The identification results are reliable, stable, and simple to operate, providing an important technical means for creating new melon germplasm with yellow leaves at the growing point of seedlings.
[0005] To achieve the above objectives, the present invention provides the following technical solution:
[0006] The application provides an Indel molecular marker related to yellow leaves of seedling growth points of melons, which is a nucleic acid molecule with an ATTTAGTT insertion and deletion polymorphism.
[0007] The nucleotide sequence of the nucleic acid molecule with the ATTTAGTT insertion is shown in SEQ ID NO. 1 or SEQ ID NO. 2.
[0008] The nucleotide sequence of the nucleic acid molecule with the ATTTAGTT deletion is shown in SEQ ID NO. 3 or SEQ ID NO. 4.
[0009] The application provides application of a product for detecting the Indel molecular marker in the above technical solution in 1) and / or 2):
[0010] 1) screening melons with yellow leaves of seedling growth points;
[0011] 2) breeding melon varieties with yellow leaves of seedling growth points;
[0012] When the genotype of the Indel molecular marker is ATTTAGTT deletion homozygote, the seedling growth point leaves of the melon are yellow.
[0013] Preferably, the product comprises primers or a kit.
[0014] The application provides a primer pair for detecting the Indel molecular marker in the above technical solution, which comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 5, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 6.
[0015] The application provides a kit for detecting the Indel molecular marker in the above technical solution, which comprises the primer pair in the above technical solution.
[0016] Preferably, the kit further comprises reagents used for PCR amplification in addition to the primer pair.
[0017] The application provides a method for screening melons with yellow leaves of seedling growth points, which comprises the following steps:
[0018] determining the genotype of the Indel molecular marker in the melon to be detected in the above technical solution;
[0019] According to the determined genotype result, the melon with the ATTTAGTT deletion homozygote of the Indel molecular marker is screened, and the seedling growth point leaves of the melon are yellow.
[0020] Preferably, the determining comprises: performing PCR amplification on the melon to be tested, and performing sequencing or polyacrylamide gel electrophoresis on the obtained amplification product; the primer pair for the PCR amplification comprises the primer pair described in the technical solution; and the Indel molecular marker genotype is determined according to the polyacrylamide gel electrophoresis result, specifically as follows:
[0021] If the amplification product has only one band of 233 bp, the Indel molecular marker genotype is ATTTAGTT deletion homozygote.
[0022] If the amplification product has only one band of 241 bp, the Indel molecular marker genotype is ATTTAGTT homozygote.
[0023] If the amplification product has one band of 233 bp and one band of 241 bp, the Indel molecular marker genotype is ATTTAGTT deletion heterozygote.
[0024] The application provides a method for cultivating melon varieties with yellow leaves at growth points of seedlings, comprising the following steps:
[0025] Determining the genotype of the Indel molecular marker in the melon to be tested according to the technical solution.
[0026] Discarding the melon with the Indel molecular marker genotype of ATTTAGTT homozygote, and self-crossing the remaining melons, and retaining the melon with the Indel molecular marker genotype of ATTTAGTT deletion homozygote in the offspring, which is the melon with yellow leaves at growth points of seedlings.
[0027] Preferably, the determining comprises: performing PCR amplification on the melon to be tested, and performing sequencing or polyacrylamide gel electrophoresis on the obtained amplification product; the primer pair for the PCR amplification comprises the primer pair described in the technical solution; and the Indel molecular marker genotype is determined according to the polyacrylamide gel electrophoresis result, specifically as follows:
[0028] If the amplification product has only one band of 233 bp, the Indel molecular marker genotype is ATTTAGTT deletion homozygote.
[0029] If the amplification product has only one band of 241 bp, the Indel molecular marker genotype is ATTTAGTT homozygote.
[0030] If the amplification product has one band of 233 bp and one band of 241 bp, the Indel molecular marker genotype is ATTTAGTT deletion heterozygote.
[0031] Beneficial effects:
[0032] The application mines a key candidate gene for controlling the leaf color of the growth point of melon seedlings MELO3C016136 , and an Indel molecular marker (ygp2) for identifying the leaf color of the growth point of melon seedlings is developed based on the 8-bp base insertion / deletion polymorphism (ATTTAGTT) in the upstream promoter region of the gene. The identification of the leaf color of the growth point of melon seedlings by using ygp2 only needs one-time PCR amplification and polyacrylamide gel electrophoresis on the DNA of the plant to be tested, and the identification result is reliable and easy to operate. The yellow leaf genotype (ATTTAGTT base deletion, - / -), the hybrid green leaf genotype (ATTTAGTT / -), and the pure green leaf genotype (ATTTAGTT / ATTTAGTT) of the target plant can be identified, and the coincidence rate of the genotype and the leaf color phenotype of the growth point of the seedling is 100%, which provides important technical support for creating new melon germplasm with yellow leaves at the growth point of the seedling. BRIEF DESCRIPTION OF DRAWINGS
[0033] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below.
[0034] Figure 1 Comparison results of the leaf color of cotyledon expansion of melon wild material FP (green) and mutant material MP (yellow) and their F1 (green) hybrid;
[0035] Figure 2 Δsnp-index distribution map for detecting the site related to the yellow leaf of melon seedlings on chromosome 7 of melon; mapping window: 1 Mb; mapping step: 10 kb; blue threshold line: pvalue<=0.05; red threshold line: pvalue<=0.01;
[0036] Figure 3 Comparison results of the leaf color of cotyledon expansion of melon wild material FP (green) and mutant material MP (yellow) and their F1 (green) hybrid; MELO3C016136 Comparison results of the 8-base variation site in the coding region of the gene;
[0037] Figure 4 Comparison results of the 8-base variation site in the coding region of the gene; ygp2 Polyacrylamide gel electrophoresis detection results of melon wild material FP (green) and mutant material MP (yellow) and the hybrid F1 and F2 populations derived from the two are shown in the schematic diagram. From left to right, lane 1 is DNA Marker, and from top to bottom, 300 bp and 200 bp are respectively; lane 2 is mutant MP; lane 3 is wild type FP; lane 4 is the hybrid F1 of wild type FP and mutant MP; and lanes 5 to the rightmost lane are randomly selected samples of the F2 separation population. DETAILED DESCRIPTION
[0038] The present application provides an Indel molecular marker related to the yellowing of the leaves of the growth point of melon seedlings, which is a nucleic acid molecule with an ATTTAGTT insertion-deletion polymorphism;
[0039] The nucleotide sequence of the nucleic acid molecule with ATTTAGTT insertion is shown in SEQ ID NO. 1 or SEQ ID NO. 2;
[0040] The nucleotide sequence of the nucleic acid molecule with ATTTAGTT deletion is shown in SEQ ID NO. 3 or SEQ ID NO. 4, specifically as follows:
[0041] SEQ ID NO. 1:
[0042]
[0043] SEQ ID NO. 2:
[0044] 5'-GCCCTATTTAGCCTTTGAACTAAATTAGACCTATTTTTTTTACTCCATTGAATTTAAGTCTAAATAATTACTATTTAATTGAACCGCTTAATCCAATTAAAACAATGGACTTATAAAGCAATTTAGATatttagttATTTAGTTTTAATTTGGGACACAGGTTAACTTTAAAGTAGTCTCAACTTCAATTATTTGTGTTTTTGCTGTTAATTTGGTAAATAATGTGACAATTTGTGATTGA-3';
[0045] wherein the lowercase atttagtt is the deletion polymorphism sequence of the Indel molecular marker and the corresponding site;
[0046] SEQ ID NO. 3:
[0047]
[0048] SEQ ID NO.4:
[0049] 5'-GCCCTATTTAGCCTTTGAACTAAATTAGACCTATTTTTTTTACTCCATTGAATTTAAGTCTAAATAATTACTATTTAATTGAACCGCTTAATCCAATTAAAACAATGGACTTATAAAGCAATTTAGATATTTAGTTTTAATTTGGGACACAGGTTAACTTTAAAGTAGTCTCAACTTCAATTATTTGTGTTTTTGCTGTTAATTTGGTAAATAATGTGACAATTTGTGATTGA-3'.
[0050] The growth point leaf of the application is the first true leaf of the seedling, which is yellow and gradually turns green with growth, and each new growth point leaf is yellow thereafter.
[0051] The application digs a key candidate gene for the yellowing of the growth point leaf of the melon MELO3C016136 , and a 8bp base deletion (ATTTAGTT) exists in the upstream promoter region of the mutant MP. The seedling growth point leaf of the homozygous ATTTAGTT deletion melon is yellow. Based on this, an Indel molecular marker (ygp2) for identifying the color of the seedling growth point leaf of the melon is developed. The Indel molecular marker provided by the application has the following core application values: 1) for the melon hybrid combination configured with "growth point leaf color yellowing germplasm as the female parent and normal green germplasm as the male parent", the hybrid purity can be identified by molecular detection within a few days after sowing, the identification time node is greatly advanced, environmental interference or phenotype misjudgment is avoided, and the efficiency and accuracy of identification are significantly improved; 2) the marker can be used as a specific molecular tag for the yellowing trait of the melon, and provides a molecular tool for analyzing the genetic regulation mechanism of the yellowing trait; 3) in molecular marker assisted breeding, the marker can be used for the breeding of "yellowing trait + target breeding trait (such as disease resistance and high sugar)", without waiting for the phenotype to appear, the breeding cycle is shortened, and the breeding cost is reduced.
[0052] Based on the above advantages, the application provides the application of the product for detecting the gene mutant of the above technical solution or the product for detecting the Indel molecular marker of the above technical solution in 1) and / or 2):
[0053] 1) screening of the melon with yellow seedling growth point leaf;
[0054] 2) breeding of the melon variety with yellow seedling growth point leaf;
[0055] When the genotype of the Indel molecular marker is ATTTAGTT deletion homozygote, the seedling growth point leaf of the melon is yellow.
[0056] As an embodiment, the product comprises primers or a kit.
[0057] The application provides a primer pair for detecting the Indel molecular marker, which is composed of an upstream primer and a downstream primer.
[0058] The application provides a kit for detecting the Indel molecular marker, which comprises the primer pair.
[0059] The application provides a method for screening melon with yellow seedling growth point leaf, which comprises the following steps:
[0060] Determining the genotype of the Indel molecular marker in the melon to be detected;
[0061] According to the genotype result, the melon with the genotype of ATTTAGTT deletion homozygote is screened, that is, the melon with yellow seedling growth point leaf.
[0062] As an embodiment, the determination comprises: performing PCR amplification on the melon to be detected, and performing sequencing or polyacrylamide gel electrophoresis on the obtained amplification product; the primer pair for PCR amplification comprises the primer pair.
[0063] If the amplification product has only one band of 233 bp, the genotype of the Indel molecular marker is ATTTAGTT deletion homozygote;
[0064] If the amplification product has only one band of 241 bp, the genotype of the Indel molecular marker is ATTTAGTT homozygote;
[0065] If the amplification product has one band of 233 bp and one band of 241 bp, the genotype of the Indel molecular marker is ATTTAGTT deletion heterozygote.
[0066] The application provides a method for cultivating melon varieties with yellow seedling growth point leaf, which comprises the following steps:
[0067] determining the genotype of the Indel molecular marker in the melon to be tested according to the technical solution described above;
[0068] Discarding the melon with the genotype of the Indel molecular marker being ATTTAGTT homozygote, and selfing and / or crossing the remaining melons, and retaining the melon with the genotype of the Indel molecular marker being ATTTAGTT deletion homozygote in the offspring, i.e., the melon with yellow leaves at the seedling growth point.
[0069] As an implementation form, the determination comprises: performing PCR amplification on the melon to be tested, and performing sequencing or polyacrylamide gel electrophoresis on the obtained amplification product; the primer pair for the PCR amplification comprises the primer pair according to the technical solution described above; and the genotype of the Indel molecular marker is determined according to the result of the polyacrylamide gel electrophoresis, specifically as follows:
[0070] If the amplification product has only one band of 233 bp, the genotype of the Indel molecular marker is ATTTAGTT deletion homozygote;
[0071] If the amplification product has only one band of 241 bp, the genotype of the Indel molecular marker is ATTTAGTT homozygote;
[0072] If the amplification product has one band of 233 bp and one band of 241 bp, the genotype of the Indel molecular marker is ATTTAGTT deletion heterozygote.
[0073] In order to further illustrate the present application, the Indel molecular marker related to the yellow leaves at the seedling growth point of melon and the application thereof provided by the present application are described in detail below in conjunction with the examples and the accompanying drawings, but they should not be understood as limiting the scope of protection of the present application.
[0074] The seedling yellow leaf selfing line MP in the example is disclosed in Chinese Patent CN202110560648.4, corresponding to the true leaf green line M137-7-1 of melon, and the seedling green leaf selfing line FP is a normal green leaf melon.
[0075] Example 1: Mining of functional genes for controlling the leaf color at the seedling growth point of melon
[0076] The seedling green leaf selfing line FP and the seedling yellow leaf selfing line MP of Shanghai Agricultural Academy of Horticulture were crossed to obtain F1 generation (F1), Figure 1 ), and the F1 generation was selfed to obtain 348 F2 individuals. The leaf color phenotype of the F2 population was identified at the one-leaf-one-heart stage, of which 251 were green leaves and 97 were yellow leaves. According to the phenotype of F1 (green leaves) and the segregation ratio between F2 individuals, it was 3:1 (χ 2(≈0.3832, P≈0.536), indicating that the yellow leaves are controlled by a recessive single gene.
[0077] To further explore the localization region of this gene, hybrid pool segregation analysis (BSA) and high-throughput sequencing were performed on two parents and two amplification pools containing 30 individuals with extreme F2 phenotypes (completed by Shanghai Ling'en Biotechnology Co., Ltd.). After quality control, the region associated with the target trait was assessed based on the ΔSNP-index value between the two pools. A locus associated with yellow leaves was identified on chromosome 7, ranging from 5.87 Mb to 26.28 Mb, totaling approximately 20.41 Mb. Figure 2 ).
[0078] To further narrow down the candidate region, 16 pairs of Indel markers and 3 pairs of SNP polymorphic markers were developed within the initially mapped region, and a genetic linkage map was constructed using a population of 348 F2 strains, further reducing the region to 894.9 kb. To further reduce the distance, 23 recombination-exchange single organisms were screened from a large F2 population of 3715 strains using the developed polymorphic molecular markers, further narrowing the region to 30.5 kb, where 4 genes were annotated. Combining MP mutant and FP wild-type resequencing data, it was found that within this region… MELO3C016136 There is an 8bp insertion / deletion mutation at -429bp upstream of the gene promoter. Figure 3 Therefore, it is preliminarily determined that... MELO3C016136 It may be a candidate gene that controls the leaf color at the growing point of melon seedlings.
[0079] Example 2
[0080] Screened according to Example 1 MELO3C016136 To detect the 8 bp insertion / deletion polymorphism of the gene, a pair of Indel markers was designed, named ygp2, and the primer sequences are as follows:
[0081] ygp2-F: 5'-GCCCTATTTAGCCTTTGAACTAA-3', SEQ ID NO.5;
[0082] ygp2-R: 5'-TCAATCACAAATTGTCACATTATTT-3', SEQ ID NO. 6.
[0083] From a large F2 population of 3715 plants constructed with MP and FP as parents, 189 individual plants were randomly selected. Leaf samples were collected from each plant to extract DNA, and genotyping was performed using ygp2 markers. The specific method is as follows:
[0084] ① Take the appropriate amount of leaves in 2 mL centrifuge tube, add 1 particle diameter 4 mm steel ball, immerse the centrifuge tube containing leaves and steel ball in liquid nitrogen and freeze quickly, then place the sample on the sample grinder and grind the sample;
[0085] ② Add 600 μL 2 × CTAB extraction buffer (20 g / L CTAB, 100 mM Tris-HCL pH8.0, 50 mM EDTA pH8.0, 82 g / L NaCl) to the ground sample, incubate in 65℃ water bath for about 1 h, and mix several times during the incubation;
[0086] ③ Take out the sample, cool to room temperature, add 600 μL chloroform, mix, and centrifuge at 12000 rpm for 10 min;
[0087] ④ Absorb 400 μL supernatant into another 1.5 mL centrifuge tube, add 400 μL isopropanol pre-cooled at -20℃ in equal proportion, and place in -20℃ low-temperature refrigerator for 1 h;
[0088] ⑤ Centrifuge at 12000 rpm for 1 min to collect DNA, and discard the supernatant;
[0089] ⑥ Add 1 mL 75% ethanol to wash the DNA precipitate, repeat twice, and finally completely absorb the ethanol until it is completely volatilized, and add 50 μL sterilized ultrapure water to dissolve the DNA.
[0090] (2) PCR amplification
[0091] ① Reaction system: total volume is 12 μL, template DNA (20 ng / μL) 2 μL, ygp2-F 0.5 μM, ygp2-R 0.5 μM, 2 × Taq premix PCR reaction system (containing dye) 6 μL, ddH2O 3 μL, mix, and centrifuge;
[0092] ② Reaction conditions: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 20 s, 55℃ annealing for 20 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min; 16℃ preservation.
[0093] (3) Result identification
[0094] The PCR amplification product is detected by polyacrylamide gel electrophoresis, and identified according to the electrophoresis results, as follows:
[0095] If the amplification product has only one band of 233 bp, the plant to be tested is yellow leaf, and the genotype is ATTTAGTT deletion homozygote (- / -);
[0096] If the amplification product has only one band of 241 bp, the plant to be tested is green leaf, and the genotype is ATTTAGTT homozygote (ATTTAGTT / ATTTAGTT);
[0097] If the amplification product has one band of 233 bp and one band of 241 bp, the plant to be tested is hybrid green leaf, and the genotype is ATTTAGTT deletion heterozygote (ATTTAGTT / -).
[0098] The genotype verification of ygp2 marker in F2 population constructed by MP and YP as parents hybridization was carried out, and it was found that ygp2 marker could divide each single plant of F2 population into three band types, as shown in Table 2. Figure 4 As shown in Table 2, the genotype detection result of ygp2 marker in F2 population was completely consistent with the phenotype identification result of seedling growth point leaf color. Therefore, ygp2 marker can be used as an effective molecular marker for identifying the change of yellow to green of seedling growth point leaf of melon.
[0099] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, but not all the embodiments, and other embodiments can be obtained according to the present embodiment without creativity, which all belong to the protection scope of the present application.
Claims
1. Use of a product for detecting an Indel molecular marker, characterized in that, The Indel molecular marker is an Indel molecular marker related to yellow leaves of seedling growth point of Cucumis melo, and the Indel molecular marker is a nucleic acid molecule with ATTTAGTT insertion and deletion polymorphism; The nucleotide sequence of the nucleic acid molecule with ATTTAGTT insertion is shown as SEQ ID NO. 2; The nucleotide sequence of the nucleic acid molecule with ATTTAGTT deletion is shown as SEQ ID NO. 4; The application is selected from: 1) screening Cucumis melo with yellow leaves of seedling growth point; or 2) breeding Cucumis melo variety with yellow leaves of seedling growth point; When the genotype of the Indel molecular marker is ATTTAGTT deletion homozygote, the seedling growth point leaves of Cucumis melo are yellow.
2. Use according to claim 1, characterized in that, The product comprises a primer pair for detecting the Indel molecular marker or a kit comprising the primer pair.
3. Use according to claim 2, characterized in that, The primer pair comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 5, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.
6.
4. A method of screening for a melon plant having yellow leaves at the growth point of the seedling, characterized in that, The method comprises the following steps: determining the genotype of the Indel molecular marker in the Cucumis melo to be tested in claim 1; According to the determined genotype result, screening Cucumis melo with ATTTAGTT deletion homozygote of the Indel molecular marker genotype, that is, Cucumis melo with yellow leaves of seedling growth point.
5. The method of claim 4, wherein, The determination comprises: extracting DNA of the Cucumis melo sample to be tested, performing PCR amplification on the extracted DNA, and performing sequencing or polyacrylamide gel electrophoresis on the obtained amplification product; the primer pair for PCR amplification is the primer pair in claim 3; if polyacrylamide gel electrophoresis is performed on the amplification product, the genotype of the Indel molecular marker is determined according to the polyacrylamide gel electrophoresis result, and specifically as follows: If the amplification product has only one band of 233 bp, the genotype of the Indel molecular marker is ATTTAGTT deletion homozygote; If the amplification product has only one band of 241 bp, the genotype of the Indel molecular marker is ATTTAGTT homozygote; If the amplification product has one band of 233 bp and one band of 241 bp, the genotype of the Indel molecular marker is ATTTAGTT deletion heterozygote.
6. A method of breeding a melon variety having yellow growth point leaves in seedlings, characterized by, The method comprises the following steps: determining the genotype of the Indel molecular marker in the Cucumis melo to be tested in claim 1; Discarding Cucumis melo with ATTTAGTT homozygote of the Indel molecular marker genotype, and selfing and / or crossing the remaining Cucumis melo, and retaining Cucumis melo with ATTTAGTT deletion homozygote of the Indel molecular marker genotype in the offspring, that is, Cucumis melo with yellow leaves of seedling growth point.
7. The method of claim 6, wherein, The determination comprises extracting DNA of the melon sample to be determined, performing PCR amplification on the extracted DNA, and performing sequencing or polyacrylamide gel electrophoresis on the obtained amplification product; the primer pair for the PCR amplification is the primer pair as defined in claim 3; if polyacrylamide gel electrophoresis is performed on the amplification product, the Indel molecular marker genotype is determined according to the polyacrylamide gel electrophoresis result, and specifically as follows: If the amplification product has only one band of 233 bp, the Indel molecular marker genotype is ATTTAGTT deletion homozygote; If the amplification product has only one band of 241 bp, the Indel molecular marker genotype is ATTTAGTT homozygote; If the amplification product has one band of 233 bp and one band of 241 bp, the Indel molecular marker genotype is ATTTAGTT deletion heterozygote.
Citation Information
Patent Citations
Method for identifying purity of muskmelon hybrid
CN113207679A