Use of serpinel protein or its coding gene as a therapeutic target for hepatitis b virus infection
By enhancing autophagy flux through the interaction of SERPINE1 protein with PIKfyve and activating SERPINE1 function with betulinic acid, the problem of HBsAg being difficult to clear effectively in existing technologies has been solved, achieving significant inhibition and synergistic therapeutic effects against HBV.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-19
- Publication Date
- 2026-04-14
AI Technical Summary
Existing technologies lack innovative strategies and drug targets that can effectively reduce or eliminate hepatitis B virus (HBV) surface antigen (HBsAg). Nucleoside (acid) analogs and interferon-α have unsatisfactory therapeutic effects and are subject to side effects and drug resistance.
We discovered and validated that the SERPINE1 protein is a key host factor for HBV infection. By interacting with phosphatidylinositol kinase PIKfyve, it enhances lysosomal acidification and autophagy flux, and reduces HBV DNA replication and HBsAg expression. We used the SERPINE1 protein or its encoding gene as a therapeutic target and betulinic acid as a SERPINE1 agonist to activate its function.
It significantly reduces HBV DNA replication and HBsAg expression, providing a new treatment strategy. The combination of betulinic acid and the existing drug entecavir significantly enhances the inhibitory effect, realizing the advantages of synergistic therapy.
Smart Images

Figure CN121154648B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of medicine, specifically relating to the application of a SERPINE1 protein or its encoding gene as a therapeutic target for hepatitis B virus infection. Background Technology
[0002] Currently, nucleoside (acid) analogs and interferon-alpha (INF-α) are the main antiviral treatments. Nucleoside (acid) analogs are difficult to effectively clear HBsAg, and the rate of achieving functional cure is extremely low; although the HBsAg clearance rate of interferon has improved, it is still not ideal, and there are problems with side effects and drug resistance.
[0003] Therefore, the core bottleneck and unmet clinical need in the current treatment of hepatitis B virus (HBV) lies in the lack of innovative strategies and drug targets that can effectively reduce or even eliminate HBsAg. Developing novel therapeutic drugs that act on new targets and can significantly reduce HBsAg levels is a key breakthrough direction for achieving functional cure of hepatitis B.
[0004] Betulinic acid (BetA) is a naturally occurring pentacyclic triterpenoid compound. Literature reports indicate that betulinic acid possesses various biological activities, including anti-inflammatory and anti-tumor effects. However, current technology has not yet elucidated the precise molecular targets and mechanisms of action of betulinic acid's anti-HBV activity. Notably, current technology also fails to disclose the biological function of plasminogen activator inhibitor-1 (SERPINE1) protein in the HBV infection process, or its potential application as a therapeutic intervention target. Summary of the Invention
[0005] The primary objective of this invention is to overcome the aforementioned deficiencies of the prior art and provide an application of the SERPINE1 protein or its encoding gene as a therapeutic target for hepatitis B virus infection.
[0006] This invention is the first to discover and validate that SERPINE1 is a key host factor regulating HBV infection. The SERPINE1 protein enhances lysosomal acidification and degradation by directly binding to phosphatidylinositol kinase PIKfyve, thereby promoting autophagy flux, reversing HBV's inhibition of host cell autophagy, and significantly reducing HBV DNA replication and hepatitis B surface antigen (HBsAg) expression. Therefore, the SERPINE1 protein or its encoding gene is a potential new therapeutic target for hepatitis B virus (HBV) infection. This invention was completed based on this finding.
[0007] As a preferred embodiment of this application, the application includes any one or more of (1) to (5):
[0008] (1) Promotes autophagosome-lysosome fusion;
[0009] (2) Enhance autophagy flux;
[0010] (3) Reduce HBV DNA levels;
[0011] (4) Inhibit HBsAg expression;
[0012] (5) Inhibit HBcAg expression.
[0013] As a preferred embodiment of this application, the enhanced autophagy flux is regulated through the interaction between the SERPINE1 protein and the phosphatidylinositol kinase PIKfyve protein. Furthermore, the SERPINE1 protein or its encoding gene also enhances lysosomal function and promotes autophagy flux to reverse the hijacking effect of HBV on cellular autophagy flux.
[0014] Preferably, the SERPINE1 protein is obtained by transfecting a SERPINE1 protein expression vector into a hepatitis B cell line or mouse liver tissue cells. The SERPINE1 protein expression vector can be a recombinant plasmid, lentiviral vector, or adeno-associated virus (AAV) vector, containing the SERPINE1 coding gene shown in SEQ ID NO:1 or SEQ ID NO:2 and an operatively linked promoter thereto, for overexpressing the SERPINE1 protein. When the hepatitis B cell line is used, the SERPINE1 protein expression vector contains the SERPINE1 coding gene shown in SEQ ID NO:1 and an operatively linked promoter thereto; when mouse liver tissue cells are used, the SERPINE1 protein expression vector contains the SERPINE1 coding gene shown in SEQ ID NO:2 and an operatively linked promoter thereto.
[0015] A second aspect of the present invention provides a method for screening candidate compounds for the prevention or treatment of HBV infection, the method comprising the steps of:
[0016] (a) Contact the candidate compound with the SERPINE1 protein;
[0017] (b) Detect whether the candidate compound binds to the SERPINE1 protein and activates its function;
[0018] (c) Select compounds that can bind to and activate SERPINE1 function as candidate compounds for anti-HBV infection.
[0019] As a preferred embodiment of this application, step (a) includes:
[0020] (a1) Prepare biological samples of hepatitis B cell lines in good growth condition;
[0021] (a2) Preparation of photoaffinity probes for relevant candidate compounds;
[0022] (a3) The prepared photoaffinity probe and the hepatitis B cell line biological sample were co-incubated to bring the candidate compound into contact with the SERPINE1 protein.
[0023] As a preferred embodiment of this application, in step (b), at least one of the following methods is used to verify the specific binding of the candidate compound to the SERPINE1 protein: surface plasmon resonance (SPR), cell thermal migration analysis (CETSA), molecular docking simulation, and molecular fishing coupled with mass spectrometry.
[0024] The present invention utilizes the method described above to screen for candidate compounds that can specifically bind to the SERPINE1 protein.
[0025] A third aspect of the present invention provides the use of a SERPINE1 protein agonist in the preparation of a medicament for the prevention and / or treatment of hepatitis B virus infection.
[0026] As a preferred embodiment of this application, the SERPINE1 protein agonist is betulinic acid or a pharmaceutically acceptable derivative thereof. Betulinic acid or its derivatives, as natural compounds of SERPINE1 agonist, can embed themselves in the SERPINE1 protein binding pocket and directly bind to the SERPINE1 protein, thereby activating SERPINE1 protein function and achieving prevention and / or treatment of hepatitis B virus infection, such as reducing hepatitis B surface antigen (HBsAg) levels.
[0027] As a preferred embodiment of this application, the betulinic acid derivative is a pharmaceutically acceptable salt, ester, solvate, or prodrug of betulinic acid.
[0028] As a preferred embodiment of this application, the pharmaceutically acceptable salt of betulinic acid is preferably selected from sodium, potassium, calcium, magnesium, hydrochloride, sulfate, citrate, or lactate.
[0029] A fourth aspect of the present invention provides a medicament for preventing or treating hepatitis B virus infection, comprising:
[0030] A therapeutically effective amount of the SERPINE1 protein agonist, along with a pharmaceutically acceptable carrier, excipient, or diluent.
[0031] As a preferred embodiment of this application, the SERPINE1 protein agonist is betulinic acid (BetA) or a pharmaceutically acceptable derivative thereof. This agonist achieves prevention and / or treatment of hepatitis B virus infection by activating the SERPINE1 protein, such as by reducing hepatitis B surface antigen (HBsAg) levels.
[0032] As a preferred embodiment of this application, the betulinic acid derivative is a pharmaceutically acceptable salt, ester, solvate, or prodrug of betulinic acid. Betulinic acid or its derivatives are natural compounds that act as SERPINE1 agonists, capable of embedding in the SERPINE1 protein-binding pocket and directly binding to the SERPINE1 protein for the prevention or treatment of hepatitis B virus infection.
[0033] As a preferred embodiment of this application, the drug further comprises one or more additional anti-HBV drugs. The additional anti-HBV drugs are selected from nucleoside (acid) analogs, interferons, or immunomodulatory agents. The anti-HBV drugs include, but are not limited to, entecavir, tenofovir, lamivudine, or pegylated interferon-α (PEG-IFNα). Most preferably, the anti-HBV drug is entecavir. When betulinic acid or its derivatives are used in combination with entecavir, a synergistic effect is observed in inhibiting HBV replication and HBsAg expression. Betulinic acid, as a natural compound of SERPINE1 agonist, can embed into the SERPINE1 protein-binding pocket and directly bind to the SERPINE1 protein, while entecavir inhibits reverse transcriptase. The combination of betulinic acid and entecavir synergistically inhibits HBV replication and surface antigen expression, and its anti-hepatitis B efficacy is superior to monotherapy.
[0034] As a preferred embodiment of this application, the amount of the SERPINE1 protein agonist is 10~30 μM.
[0035] As a preferred embodiment of this application, the amount of the SERPINE1 protein agonist is 20 μM.
[0036] As a preferred embodiment of this application, the dosage form of the drug is an injection or an oral dosage form.
[0037] As a preferred embodiment of this application, the dosage of entecavir is 5-20 nM.
[0038] As a preferred embodiment of this application, the dosage of entecavir is 10 nM.
[0039] The terms "therapeutic effective amount," "therapeutic effective dose," "effective amount," or "effective dose" all refer to an amount that is functional or active in humans and / or animals and is acceptable to humans and / or animals. The term "pharmaceutically acceptable" refers to a substance suitable for use in humans and / or mammals without excessive adverse side effects (such as toxicity, irritation, and allergic reactions), i.e., a substance with a reasonable benefit / risk ratio. The term "pharmaceuticalally acceptable carrier" refers to a carrier used for the administration of a therapeutic agent, including various excipients and diluents. More preferably, the carrier is an injection buffer, liposome, or nanoparticle delivery system.
[0040] Pharmaceutically acceptable carriers include, but are not limited to: water, saline, buffer solutions, glycerol, ethanol, liposomes, lipids, proteins, protein-antibody conjugates, peptides, cellulose, nanogels, or combinations thereof. The choice of carrier should be appropriate for the route of administration, as is well known to those skilled in the art.
[0041] The pharmaceutical compositions of the present invention contain a safe and effective amount of the active ingredient of the present invention and a pharmaceutically acceptable carrier. Generally, pharmaceutical formulations should be matched to the route of administration; the dosage forms of the pharmaceutical compositions of the present invention are injections, oral formulations (tablets, capsules, oral liquids), transdermal formulations, and sustained-release formulations. They are prepared, for example, using physiological saline or an aqueous solution containing glucose and other excipients by conventional methods. The pharmaceutical compositions are preferably manufactured under aseptic conditions. More preferably, the dosage forms of the pharmaceutical compositions are injections (e.g., intravenous injection, intramuscular injection) or oral dosage forms (e.g., tablets, capsules, oral liquids).
[0042] The effective amount of the active ingredient described in this invention can vary depending on the administration method and the severity of the disease to be treated. A preferred effective amount can be determined by those skilled in the art based on various factors (e.g., through clinical trials). These factors include, but are not limited to: pharmacokinetic parameters of the active ingredient, such as bioavailability, metabolism, and half-life; the severity of the disease to be treated, the patient's weight, the patient's immune status, and the route of administration.
[0043] Compared with the prior art, the beneficial effects of this application are:
[0044] (1) The invention first discovered and verified SERPINE1 as a new target for anti-HBV therapy: This invention reveals for the first time that SERPINE1 is a key host factor that regulates HBV infection. By activating the PIKfyve-mediated autophagy pathway, it reverses the hijacking of host cell autophagy flow by the virus, thereby significantly inhibiting viral replication and antigen expression, providing a new strategy and target for achieving functional cure of hepatitis B.
[0045] (2) A novel and highly efficient agonist targeting SERPINE1 protein was discovered: By constructing a multi-dimensional target identification and verification platform, this invention has for the first time discovered that the natural compound betulinic acid is a high-affinity specific agonist of SERPINE1, providing a lead compound for the development of new anti-HBV drugs that directly target SERPINE1.
[0046] (3) Provides a new synergistic treatment option: This invention confirms that betulinic acid can produce a synergistic effect when used in combination with the existing standard drug entecavir, significantly improving the effect of inhibiting HBV DNA and HBsAg, which lays a solid foundation for developing more effective combination treatment options. Attached Figure Description
[0047] Figure 1 SERPINE1 overexpression inhibits HBV replication and antigen expression in vitro. Specifically, A verifies the transcriptional overexpression level of SERPINE1 plasmid in HepG2.2.15 and HepAD38 cell lines; B verifies the protein overexpression level of SERPINE1 plasmid in the two hepatitis B cell lines; C shows that SERPINE1 overexpression significantly reduces the levels of HBsAg and HBeAg in the two hepatitis B cell lines; D confirms from Western Blot results that SERPINE1 overexpression can inhibit HBcAg expression in hepatitis B cells; and E further corroborates that SERPINE1 can reduce HBcAg levels in hepatitis B cells using immunofluorescence.
[0048] Figure 2 SERPINE1 exerts anti-hepatitis B function in an AAV-HBV mouse model. A shows the in vivo animal experimental design for SERPINE1; B shows the transcriptional level verification of the effect of AAV-SERPINE1 overexpression in vivo; C shows the protein level verification of the effect of AAV-SERPINE1 overexpression in vivo; D shows that in vivo overexpression of SERPINE1 significantly reduces the level of HBsAg in mouse serum; E shows that in vivo overexpression of SERPINE1 significantly reduces the level of HBV DNA in mouse serum; F shows that in vivo overexpression of SERPINE1 significantly reduces the expression levels of HBcAg and HBsAg in mouse liver tissue; G shows the changes in body weight of mice in the empty vector group and the overexpression group during the experimental period; H shows the changes in ALT, AST, and Creatinine in the serum of the two groups of mice at the experimental endpoint; I shows the HE staining results of liver tissue from each group of mice.
[0049] Figure 3SERPINE1 promotes intracellular autophagy flux; A shows that overexpression of SERPINE1 significantly reduces the levels of LC3II and P62 in HepG2.2.15 cells; B and C show that electron microscopy results indicate that overexpression of SERPINE1 can increase the number of autolysosomes in cells; D and E show that the mCherry-GFP-LC3 dual fluorescence system results indicate that SERPINE1 can promote the number of autolysosomes in cells and enhance autophagy flux.
[0050] Figure 4 SERPINE1 and PIKfyve have a direct interaction; where A is the CO-IP experiment showing that SERPINE1 and PIKfyve interact in hepatitis B cells; B is the in vitro SPR confirming the direct interaction between SERPINE1 and PIKfyve.
[0051] Figure 5 Multidimensional evidence of the binding of betulinic acid to SERPINE1: A is a schematic diagram of the photoaffinity molecular fishing process; B shows that the molecular fishing results show that betulinic acid has a strong binding with SERPINE1 protein in living cells; C is the surface plasmon resonance (SPR) experiment confirming that betulinic acid and SERPINE1 bind directly in vitro; D is the cell thermal migration (CETSA) experiment showing that betulinic acid binds to SERPINE1 at the cellular level; E is the CB-Dock docking showing that betulinic acid and SERPINE1 bind.
[0052] Figure 6 The study evaluated the in vivo and in vitro efficacy and safety of betulinic acid against hepatitis B. A represents the in vitro exploration of the safe concentration of betulinic acid; B, C, and D represent the significant reduction in HBsAg, HBeAg, and HBV DNA expression levels in two hepatitis B cell lines by betulinic acid; E represents the significant reduction in intracellular HBcAg expression levels in two hepatitis B cell lines by betulinic acid; F represents the significant reduction in intracellular hepatitis B transcript expression levels in two hepatitis B cell lines by betulinic acid; G and H represent the significant reduction in serum HBsAg and HBV DNA levels in mice by betulinic acid; I represents the significant inhibition of HBcAg and HBsAg expression in mouse liver cells by betulinic acid; J represents the HE staining results of vital organs in the control and treatment groups; and K represents the changes in serum ALT, AST, and Creatinine levels in each group at the experimental endpoint.
[0053] Figure 7The mechanism by which betulinic acid exerts its anti-hepatitis B therapeutic effect through SERPINE1 mediation is confirmed. Among them, A represents the effect of betulinic acid on the transcriptional level of SERPINE1; B represents the effect of betulinic acid on the protein level of SERPINE1; C represents the ability of the SERPINE1 inhibitor Tiplaxtinin to reverse the inhibitory effect of betulinic acid on the secretion of HBsAg and HBeAg; D represents the ability of Tiplaxtinin to reverse the inhibitory effect of betulinic acid on HBcAg; and E represents the ability of betulinic acid to enhance the expression level of PIKfyve protein.
[0054] Figure 8 The study aimed to validate the superior efficacy of betulinic acid combined with entecavir in the treatment of hepatitis B. A represents the inhibitory effect of entecavir monotherapy, betulinic acid monotherapy, and the combination therapy on HBsAg; B represents the inhibitory effect of entecavir monotherapy, betulinic acid monotherapy, and the combination therapy on HBV DNA.
[0055] Figure 9 TLC chromatogram of photoaffinity probe.
[0056] Figure 10 Map of human SERPINE1 fusion plasmid with 3XFlag.
[0057] Figure 11 Map of mouse SERPINE1 with 3XFlag fusion plasmid. Detailed Implementation
[0058] The following specific examples illustrate the implementation of this application. Those skilled in the art can easily understand other advantages and effects of this application from the content disclosed in this specification. This application can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of this application.
[0059] It should be noted that the process equipment or apparatus not specifically mentioned in the following embodiments are all conventional equipment or apparatus in the art.
[0060] Furthermore, it should be understood that the existence of other method steps before or after the combined steps, or the insertion of other method steps between these explicitly mentioned steps, does not preclude the existence of other method steps before or after the combined steps, or the insertion of other method steps between these explicitly mentioned steps, unless otherwise stated. It should also be understood that the combined connection relationship between one or more devices / apparatus mentioned in this invention does not preclude the existence of other devices / apparatus before or after the combined devices / apparatus, or the insertion of other devices / apparatus between these explicitly mentioned devices / apparatus, unless otherwise stated. Moreover, unless otherwise stated, the numbering of each method step is merely a convenient tool for identifying each method step, and not for limiting the order of the method steps or limiting the scope of the invention. Changes or adjustments to their relative relationships, without substantially altering the technical content, should also be considered within the scope of the invention.
[0061] Example 1: Validation of the anti-hepatitis B virus function of SERPINE1 protein
[0062] 1. In vitro verification of anti-hepatitis B effect
[0063] Two hepatitis B cell lines containing the full-length HBV genome, HepG2.2.15 (purchased from Sigma-Aldrich, catalog number: SCC249) and HepAD38 (purchased from American Type Culture Collection, catalog number: CRL-3561), were selected for hepatitis B function validation. All cells were cultured in DMEM containing 10% FBS and 300 μg / mL G418 at 37°C and 5% CO2. The SERPINE1 plasmid (Gikai gene) was transfected into the HepG2.2.15 and HepAD38 cell lines. After treatment for 48 or 72 hours, cells were collected, total RNA was extracted, and the expression level of SERPINE1 mRNA was detected by qPCR. Primer sequences: F: ACCGCAACGTGGTTTTCTCA (nucleotide sequence as shown in SEQ ID NO:5); R: TTGAATCCCATAGCTGCTTGAAT (nucleotide sequence as shown in SEQ ID NO:6). Simultaneously, cells were lysed, and the expression of SERPINE1 protein was analyzed by Western Blot (Anti-SERPINE1 antibody, Abmart, TN25266S, 1:2000) to assess its overexpression effect. Based on this, cell culture supernatants were collected 48 or 72 hours after transfection, and the levels of HBsAg and HBeAg in the supernatant were detected by ELISA. Simultaneously, Western Blot and immunofluorescence (IF) assays were performed on the treated cells to assess the intracellular expression of HBcAg (Anti-HBcAg antibody, ZSGB-Bio, ZM-04Z21, WB: 1:500; IF: 1:50).
[0064] The SERPINE1 plasmid mentioned above is a human SERPINE1 fusion plasmid with 3XFlag. Specific information is as follows:
[0065] 1. Vector partial sequence (CDS sequence of human SERPINE1 gene NM_000602.5 transcript, fused with a 3X flag tag, nucleotide sequence as shown in SEQ ID NO:3):
[0066] 2. Vector name: CV061;
[0067] 3. Component order: CMV-MCS-3FLAG-SV40-Puromycin;
[0068] 4. Cloning sites: XhoI, KpnI;
[0069] 5. Vector map as follows Figure 10 As shown.
[0070] Experimental results: Compared with the empty vector group, hepatitis B cells that successfully overexpressed SERPINE1 protein (mRNA upregulated by approximately 40-fold, p<0.0001) Figure 1 The HBsAg secretion levels in the supernatants of A and B were significantly reduced (the highest level decreased by approximately 50%, p<0.0001). Figure 1 The expression level of HBcAg in cells was significantly inhibited (inhibition rate was approximately 50%, p < 0.01). Figure 1 The D and E samples showed clear anti-HBV activity, suggesting their potential application value in the treatment of hepatitis B.
[0071] 2. In vivo verification of hepatitis B resistance
[0072] Six-week-old male C57BL / 6 mice were selected and injected via tail vein with AAV-HBV (1 x 10^10 / mouse) and AAV-SERPINE1 plasmid (5 x 10^10 / mouse). 11 / mouse) viral fluid mixture (100μL) was administered continuously for 8 weeks to establish a hepatitis B mouse model (AAV-HBV mouse model) and to achieve in vivo overexpression of SERPINE1 protein. Figure 2 (As shown in A in the figure). During the experiment, body weight and orbital vein blood were collected weekly to determine safety and changes in serum HBsAg and HBV DNA levels in mice. After 8 weeks, mice were sacrificed, and the expression levels of SERPINE1 protein in mouse serum and liver tissue were detected by ELISA and Western Blot to verify the overexpression effect. At the same time, the expression of HBsAg (Anti-HBsAg antibody, Gene Tech, GT222404, 1:100) and HBcAg (Anti-HBcAg antibody, ZSGB-Bio, ZM-04Z21, 1:50) in hepatocytes were evaluated by immunohistochemistry.
[0073] Experimental results: This method can effectively achieve stable overexpression of SERPINE1 protein in mice (approximately 1.5-fold, p<0.0001). Figure 2 (As shown in B and C). Compared with the control group, overexpression of SERPINE1 protein significantly reduced the levels of HBsAg (approximately 80% reduction, p < 0.001) and HBV DNA (approximately 10% reduction, p < 0.05) in mouse serum. Figure 2 As shown in Figures D and E), the expression of hepatitis B virus surface antigen and core antigen in liver tissue was also significantly inhibited (HBsAg inhibition rate was approximately 88%, p < 0.001; HBcAg inhibition rate was approximately 65%, p < 0.05). Figure 2 (As shown in F in the figure). Furthermore, there was no significant difference in body weight between the empty vector control group and the overexpression group (as shown in F in the figure). Figure 2 As shown in G), and no significant statistical differences were observed in any of the histological and serological indicators, nor were any significant histopathological changes found. Figure 2 (As shown in H and I in the figure), suggesting that this strategy has good safety and antiviral potential in vivo.
[0074] The AAV-SERPINE1 plasmid described above is a mouse SERPINE1 fusion plasmid with 3XFlag. Specific information is as follows:
[0075] 1. Vector partial sequence (CDS sequence of mouse SERPINE1 gene NM_008871.2 transcript, fused with 3X flag tag, nucleotide sequence as shown in SEQ ID NO:4);
[0076] 2. Vector name: pAAV-TBG-MCS-P2A-GFP
[0077] 3. Component order: TBG promoter - Serpine1 (mouse) - 3X Flag
[0078] 4. Cloning site: MluI-EcoRV
[0079] 5. The vector spectrum is shown below. Figure 11 .
[0080] Example 2: Evidence of SERPINE1 positively regulating autophagic flow
[0081] We used the three gold standard methods for autophagy detection—autophagy-related protein level analysis, transmission electron microscopy, and the mCherry-GFP-LC3 dual fluorescent labeling system—to detect SERPINE1-overexpressing cells and compare them with an empty control group to evaluate the effect of SERPINE1 on autophagy flux.
[0082] 1. Autophagy Protein Level Detection: LC3B is a key protein on the autophagosome membrane, and the LC3II content can directly characterize the number of autophagosomes. P62 is a adaptor protein for selective autophagy, and its intracellular expression level is negatively correlated with autophagy. Western blotting was used to detect the expression levels of LC3B (Anti-LC3B antibody, Abmart, T55992F, 1:1000) and P62 (Anti-P62 antibody, Abmart, T55546F, 1:1000) in HepG2.2.15 cells transfected with SERPINE1 plasmid for 48 or 72 hours. The results showed that overexpression of this protein significantly decreased the expression of both LC3II and P62 in hepatitis B cells (LC3II level decreased by approximately 80%, p<0.0001; P62 level decreased by approximately 70%, p<0.0001). Figure 3 As shown in Figure A), this indicates an increase in cellular autophagy flux.
[0083] 2. Electron Microscopy Observation: Cells transfected with SERPINE1 plasmid for 48 hours were discarded from the culture medium, digested with trypsin, and washed once with PBS. The final cell mass was pea-sized cell clusters. The PBS was discarded, and electron microscopy fixative (2.5% glutaraldehyde fixative at room temperature) was slowly added for fixation at low temperature in the dark before electron microscopy observation. The results showed that overexpression of SERPINE1 significantly increased the number of autolysosomes in the cells (approximately 3-fold, p < 0.001). Figure 3 (As shown in B and C).
[0084] 3. mCherry-GFP-LC3 Dual-Fluorescence System (Hanheng Biotechnology): GFP is an acid-sensitive GFP protein, while mCherry is a stable fluorescent expression group, unaffected by external factors. When autophagosomes fuse with lysosomes to form autolysosomes, GFP is quenched due to the acidic internal environment, while the intensity of the unaffected mCherry signal directly characterizes the smoothness of autophagy from autophagosome to autolysosome stage. Cells were infected with adenovirus overexpressing mCherry-GFP-LC3, and after changing the medium 4-6 hours after infection, gene overexpression was performed. The number of autophagosomes and autolysosomes was observed after 48 hours. The experimental results showed that the number of autolysosomes increased in the overexpression group (approximately 3-fold, p<0.05). Figure 3 (As shown in D and E).
[0085] Experimental results: SERPINE1 protein can increase the formation of autolysosomes in cells and promote autophagy flux.
[0086] Example 3: Verification of the interaction between SERPINE1 and PIKfyve proteins
[0087] 1. Immunoprecipitation:
[0088] The full-length SERPINE1 plasmid was constructed using the HepG2.2.15 hepatitis B cell line, cultured in serum-containing medium to 70-80% confluence. Cells were transfected with the plasmid for 48 hours, followed by cell lysis and protein extraction. Cells were collected, washed with pre-chilled PBS, and lysed on ice for 60 minutes using the lysis buffer included in the Protein A / G Magnetic Bead IP Kit (ACE, catalog number: BK0004-02) according to the specific experimental procedures. Centrifuge (12,000 rpm, 4°C, 15 min), collect the supernatant (total protein extract). Add 5 μL of IP-grade antibody SERPINE1 (Abmart, TN25266S) to the protein lysis buffer extracted above. Add an equal volume of IP-grade IgG antibody (Proteintech, 30000-0-AP) to the control group. Incubate overnight at 4°C with rotation. After overnight incubation, add 10 μL of magnetic beads to the lysis buffer and incubate with rotation at room temperature for 4 h. Then wash the magnetic beads 3 times with lysis buffer to remove non-specific binding. Add elution buffer and elute on a shaker at room temperature for 10 min. Finally, add 1×SDS loading buffer and heat at 95°C for 10 min to elute the bound proteins. Separate the eluted samples by SDS-PAGE electrophoresis. Transfer to a PVDF membrane and block with 5% skim milk at room temperature for 1 h. Use anti-PIKfyve antibody (CST, 92839S, 1:1000) Incubate overnight at 4°C, while simultaneously verifying the original lysis buffer group (Input group). Incubate with secondary antibody (HRP labeling) at room temperature for 1 hour, then develop ECL.
[0089] Experimental results: A PIKfyve protein band was detected in the SERPINE1 immunoprecipitation complex, while it was not detected in the control IgG group, indicating that SERPINE1 protein and PIKfyve have a specific intracellular interaction. Figure 4 (As shown in A in the diagram).
[0090] 2. Surface plasmon resonance
[0091] In vitro surface plasmon resonance experiments were conducted using recombinant and active SERPINE1 protein (Abcam, ab282405) and PIKfyve protein (Abcam, ab207977). The results showed that recombinant SERPINE1 protein and recombinant PIKfyve protein directly bind in vitro, with a binding dissociation constant (KD) of 1.214 μM. Figure 4 (As shown in B).
[0092] Example 4: Analysis of Photoaffinity Molecular Fishing Technology
[0093] like Figure 5As shown in A, we will describe the process of using the photoaffinity molecule fishing technology of this invention as follows:
[0094] 1. Synthesis of photoaffinity probes:
[0095] According to the proportions in Table 1, carboxylic acid (1 equiv), diazinon (1 equiv), potassium carbonate (1 equiv), and acetone were added to a reaction flask and reacted at 50 °C for 16 h. After the reaction was completed, the mixture was cooled to room temperature, and the reaction mixture was dried under reduced pressure to remove the solvent. The residue was purified by silica gel column chromatography. Subsequently, the efficacy of the synthesized probe was tested on a hepatitis B cell line, and it was found that it did not affect the efficacy of the probe itself.
[0096]
[0097] Table 1. Amounts of each component used in the preparation of the photoaffinity probe
[0098]
[0099] Figure 9 The image shows a TLC chromatogram of the photoaffinity probe. The efficacy of the synthesized probe was detected by TLC separation on a hepatitis B cell line. The TLC developing solvent conditions were: DCM : MeOH = 20:1.
[0100] 2. In-situ probe labeling and competition:
[0101] The specific steps for in-situ and competitive probe labeling and lysis buffer experiments are as follows:
[0102] (1) For in situ proteomic labeling, cells were grown in 6-well plates to 80-90% confluence. The culture medium was removed and the cells were washed twice with PBS, and then treated with probe-containing medium, with or without excess competitive agent.
[0103] (2) After incubation for 3-5 hours, discard the culture medium and wash the cells twice with PBS to remove excess probes;
[0104] (3) Lyse cells on ice with 200 μL of RIPA lysis buffer containing protease inhibitors for 30 min, and then sonicate to disrupt the cells;
[0105] (4) A soluble protein solution was obtained by centrifugation (10 min, 15000 rpm, 4℃);
[0106] (5) Protein concentration was determined using the BCA protein kit and diluted with PBS to 1 mg / mL; fresh premixed click reaction reagents were added and the reaction was carried out at room temperature in the dark with shaking for 2-4 h. The click reaction reagents were prepared in the following order: TAMRA-azide (dissolved in DMSO, 5 mM stock solution, 50 μM final concentration); NaVc (dissolved in ddH2O, freshly prepared, 100 mM stock solution, 1 mM final concentration), THPTA (dissolved in DMSO, 100 mM, 100 μM final concentration), CuSO4 (dissolved in ddH2O, 100 mM stock solution, 1 mM final concentration), and vortexed for a few seconds after each reagent was added;
[0107] (6) Add pre-cooled acetone (-20℃) and incubate at -20℃ for 1 h or overnight; then centrifuge (15000 rpm, 4℃, 10 min) to collect the precipitated protein. Dissolve the sample in 1× loading buffer by sonication and heat at 95℃ for 10 min;
[0108] (7) Load 60 μg of protein onto a 10% SDS-PAGE gel and perform routine electrophoresis. After electrophoresis, perform silver staining.
[0109] 3. Silver staining experiment:
[0110] (1) Fixed:
[0111] After electrophoresis, place the gel into approximately 100 mL of fixative and shake on a shaker at room temperature for 20 minutes at a speed of 60-70 rpm. Fixation for 40 minutes or more, or even overnight, can further reduce background. Preparation of fixative: Add 50 mL of ethanol, 10 mL of acetic acid, and 40 mL of Milli-Q grade pure water or double-distilled water sequentially, mix well to obtain 100 mL of fixative.
[0112] (2) Washing with 30% ethanol:
[0113] Discard the fixative, add 100 mL of 30% ethanol, and shake on a shaker at room temperature for 10 minutes at a speed of 60-70 rpm. Preparation of 30% ethanol: Add 30 mL of ethanol to 70 mL of Milli-Q grade pure water or double-distilled water, mix well, and you will have 100 mL of 30% ethanol.
[0114] (3) Water washing:
[0115] Discard the 30% ethanol, add 200 mL of Milli-Q grade pure water or double-distilled water, and shake on a shaker at room temperature for 10 minutes at a speed of 60-70 rpm. Washing with water for a longer time in this step can slightly help reduce the staining background.
[0116] (4) Sensitization:
[0117] Discard the water, add 100 mL of silver staining sensitizing solution (1X), and shake on a shaker at room temperature for 2 minutes at a speed of 60-70 rpm.
[0118] Preparation of silver staining sensitizer (1X): Add 1 mL of silver staining sensitizer (100X) to 99 mL of Milli-Q grade pure water or double-distilled water, mix well, and the silver staining sensitizer (1X) is ready. The silver staining sensitizer (1X) should be used within 2 hours after preparation.
[0119] (5) Wash with water (twice in total):
[0120] Discard the original solution, add 200mL of Milli-Q grade pure water or double-distilled water, and shake on a shaker at room temperature for 1 minute at a speed of 60-70rpm.
[0121] Discard the water, then add 200mL of Milli-Q grade pure water or double-distilled water, and shake on a shaker at room temperature for 1 minute at a speed of 60-70rpm.
[0122] (6) Silver dyeing:
[0123] Discard the water, add 100 mL of silver solution (1X), and shake on a shaker at room temperature for 10 minutes at a shaking speed of 60-70 rpm.
[0124] Preparation of silver solution (1X): Add 1 mL of silver solution (100X) to 99 mL of Milli-Q grade pure water or double-distilled water, mix well, and the silver solution (1X) is ready. The silver solution (1X) should be used within 2 hours after preparation.
[0125] (7) Washing with water:
[0126] Discard the original solution, add 100mL of Milli-Q grade pure water or double-distilled water, and shake on a shaker at room temperature for 1-1.5 minutes at a shaking speed of 60-70rpm.
[0127] Note: The washing time should not exceed 1.5 minutes.
[0128] (8) Color development:
[0129] Discard the water, add 100mL of silver staining solution, and shake on a shaker at room temperature for 3-10 minutes until the desired protein band appears. The shaking speed is 60-70rpm.
[0130] Preparation of silver staining developer: Add 20 mL of basic silver staining developer (5X) to 80 mL of Milli-Q grade pure water or double-distilled water, then add 0.05 mL of silver staining accelerating developer (2000X), mix well, and the silver staining developer is ready. The silver staining developer should be used within 20 minutes after preparation.
[0131] (9) Termination:
[0132] Discard the silver staining developer, add 100 mL of silver staining stop solution (1X), and shake on a shaker at room temperature for 10 minutes at a speed of 60-70 rpm. Gas production upon termination is normal; the gas produced is carbon dioxide.
[0133] Preparation of silver staining stop solution (1X): Add 5mL of silver staining stop solution (20X) to 95mL of Milli-Q grade pure water or double-distilled water, mix well and the silver staining stop solution (1X) is ready. Silver staining stop solution (1X) should be used on the same day after preparation.
[0134] (10) Washing with water:
[0135] Discard the silver staining stop solution, add 100 mL of Milli-Q grade pure water or double-distilled water, and shake on a shaker at room temperature for 2-5 minutes at a speed of 60-70 rpm.
[0136] (11) Take a photo / save:
[0137] Take photos and preserve them in Milli-Q pure water or double-distilled water.
[0138] 4. Identification of target proteins in adhesive strips
[0139] To identify the cellular targets of betulinic acid, pμL l-down (PD) assays were performed, followed by LC-MS / MS.
[0140] 4.1 PμLl down experiment
[0141] (1) When the HepG2.2.15 cells reach 80-90% growth in the culture dish, remove the culture medium and incubate with medium containing a probe concentration of 20 μmol / L for 3-5 h, with or without the presence of a corresponding competitive agent. Wash away excess probe; lyse the cells with RIPA buffer and centrifuge (10 min, 14000 rpm, 4℃) to obtain a soluble protein solution.
[0142] (2) Protein concentration was determined using a BCA protein kit and diluted to 1 mg / mL with PBS; fresh premixed click reaction reagents were added, and the reaction was carried out at room temperature in the dark with shaking for 2-4 h. The click reaction reagents were prepared in the following order: TAMRA-azide (dissolved in DMSO, 5 mM stock solution, 50 μM final concentration); NaVc (dissolved in ddH2O, freshly prepared, 100 mM stock solution, 1 mM final concentration), THPTA (dissolved in DMSO, 100 mM, 100 μM final concentration), CuSO4 (dissolved in ddH2O, 100 mM stock solution, 1 mM final concentration), and vortexed for a few seconds after each reagent was added;
[0143] (3) Add pre-cooled acetone (-20℃) and incubate at -20℃ for 1 h or overnight; then centrifuge (15000 rpm, 4℃, 10 min) to collect the precipitated protein. Dissolve the sample in 1× loading buffer by sonication and heat at 95℃ for 10 min;
[0144] (4) Incubate the supernatant with streptavidin beads at room temperature for 4 hours or overnight at 4°C;
[0145] (5) Wash the beads with PBS containing 1% SDS (3×5 mL), 0.1% SDS (3×5 mL) and 6 mol / L urea (3×5 mL);
[0146] (6) To enrich proteins, add 1× loading buffer to the beads and heat at 95°C for 10 min, then perform SDS-PAGE (10%).
[0147] 4.2 Identification of target proteins
[0148] The enriched proteins were separated on a 10% SDS-PAGE gel and then stained with Coomassie brilliant blue (CBB).
[0149] (1) Cut the specific band into small particles, then dissolve them in ammonium bicarbonate buffer (25 mM, ABB) and 50% acetonitrile in ammonium bicarbonate buffer (25 mM) until the blue color completely disappears; dehydrate the gel particles with 500 μL of acetonitrile for 5-10 min. The gel particles turn white;
[0150] (2) Completely remove ACN, and dry with VACspin for 20-60 min;
[0151] (3) Prepare a 1 M dithiothreitol (DTT) stock solution, dilute it to 10 mM with 25 mM ABB buffer, add 0.5-0.85 mL of the diluted DTT solution to each test tube, and incubate in a 60°C water bath for 60 min. The volume of the solution should be sufficient to submerge all the particles. Completely remove the DTT solution.
[0152] (4) Prepare 0.5 M IAA iodoacetamide with water, dilute the solution to 50 mM with 25 mM ABB, add 600-850 μL of the diluted solution to each test tube, and incubate at room temperature in the dark for 45 min.
[0153] (5) Remove the IAA solution and wash the gel particles 2-3 times alternately with buffers A and B at 300 rpm / min and 37°C.
[0154] (6) Dehydrate the particles with ACN for 5-10 minutes, then dry them in Speedvac for 20-30 minutes to ensure complete removal of water.
[0155] (7) Prepare trypsin using a special solution for preparing trypsin, so that the final concentration of trypsin is 0.5 μg / μl. Add trypsin at a ratio of 1:30 (1:30 = trypsin: protein in gel), incubate for 30 min, and then check whether there is still solution in the test tube. If the gel particles are dry, add 25 mM ABB solution to submerge the gel particles, and then incubate the mixture at 37°C overnight.
[0156] (8) The next day, transfer the solution from the digestion tube to a new 1.5 mL test tube and wash the gel particles twice with 400 μL of 50% ACN 0.1% TFA solution. Combine the washes and completely evaporate the solvent in a speedvac. Dissolve the peptides in 200 μL of 0.1% TFA.
[0157] (9) First wash with 200 μL methanol, then 200 μL ACN, C18 column (50 mg), and then wash with 400 μL 0.1% TFA.
[0158] (10) Add 200 μL of sample to the C18 column and slowly push out the solution, one drop every 2 seconds. Repeat this process 4-6 times. The peptide will be absorbed by the C18 column.
[0159] (11) Desalting: Wash the column with 0.1% TFA 6-8 times to remove salt from the sample.
[0160] (12) Elute the peptide to 1 mL with 60% ACN 0.1% TFA H2O solution, wash once with the eluent, and then rinse once with 200 μL 60% ACN 0.1% TFA solution. Evaporate the eluent in a speedvac. Dissolve in 100 mM TEAB, label with TMT, and identify by LC-MS / MS tandem mass spectrometry (Thermo Fisher).
[0161] 5. Target screening
[0162] Based on the TMT quantitative proteomics data of the experimental groups (DMSO control group, BetAa treatment group, and BetA+BetAa competition group), we first calculated the protein abundance ratio of the BetAa treatment group relative to the DMSO control group, and used a Fold change > 1.2 and P < 0.05 as the initial screening threshold to screen candidate proteins that may be specifically bound by BetAa. Subsequently, combined with the results of the competition experiment of the parent drug BetA, we further screened proteins with significantly decreased signals in the BetA+BetAa competition group as high-confidence potential binding targets. Based on this screening criterion, we found that betulinic acid binds strongly to SERPINE1 protein in living cells (…). Figure 5 (As shown in B in the diagram).
[0163] Example 5: Multidimensional mutual evidence of the binding of betulinic acid to SERPINE1 protein
[0164] 1. Surface plasmon resonance (SPR):
[0165] The interaction between betulinic acid (BetA) and SERPINE1 protein was analyzed using the Biacore 3000, a novel biomolecular interaction analysis instrument from Amersham Biosciences based on the surface plasmon resonance (SPR) principle. Recombinantly expressed active SERPINE1 protein (Abcam, ab282405) was covalently coupled to the FC2 channel of the CM5 sensor chip using a standard amino-coupling method (pH 4.6). A working buffer of 5% DMSO in PBS buffer (pH 7.4) was used. Different concentrations of BetA (0.25, 0.5, 1, 2.5, 5 μM) were dissolved in the working buffer, centrifuged, and automatically injected for 60 s at a flow rate of 10 µL / min. Dissociation was performed for 120 s. Solvent correction was performed according to the manufacturer's instructions. Experimental data were analyzed using BIA Evaluation 3.0 software in a 1:1 binding mode. Molecular interaction experiments showed that betulinic acid can directly bind to the SERPINE1 protein, with a binding constant KD of 1.46 μM. Figure 5 (as shown in C).
[0166] 2. Cell thermal migration analysis (CETSA):
[0167] HepAD38 cells (2×10) 5 Cells were seeded into 6-well plates (number of cells / well). After cell adhesion, betulinic acid (Yuanye Biotechnology, catalog number: B20041) (1 μM) was added and co-cultured for 3 h. After trypsin digestion, the cells were centrifuged, the supernatant was discarded, and the cells were resuspended in PBS containing 1% protease inhibitor. After mixing, the cells were evenly distributed into PCR tubes. The cell suspension was treated at six different temperatures (37-67 ℃) for 3 min in the PCR instrument, and then incubated at room temperature for 3 min. After centrifugation at 3000 r·min⁻¹, the supernatant was discarded, and an equal volume of RIPA lysis buffer was added to each tube for sonication lysis to prepare Western blotting (WB) samples (experiments were performed in triplicate). WB analysis was performed, and finally, grayscale analysis was performed using Image J2.
[0168] Experimental results showed that betulinic acid, at a low concentration (1 μM), significantly inhibited the temperature-induced instability of SERPINE1 protein (the residual SERPINE1 protein signal intensity in the betulinic acid-treated groups at 49℃ and 53℃ was approximately 1.2 times and 2 times that of the control group, respectively (p<0.05)), indicating that betulinic acid has a direct binding effect on SERPINE1 at the cellular level. Figure 5 (as shown in D in the diagram).
[0169] 3. Molecular docking simulation:
[0170] The crystal structure of SERPINE1 protein (PDB ID: 3UT3) was downloaded from the RCSB PDB database, and the mol format file of betulinic acid was downloaded from PubChem. Both were uploaded to the CB-Dock online service website (http: / / clab.labshare.cn / cb-dock / ) for automatic docking. The conformation with the highest Vina score was selected, and a protein-ligand complex interaction diagram and a binding pocket surface topology diagram were generated. The results showed that the docking score of betulinic acid and SERPINE1 was -6.8 kcal / mol, indicating a good direct binding interaction between the two. Figure 5 (As shown in E).
[0171] Example 6: Verification of the in vivo and in vitro anti-hepatitis B virus activity of betulinic acid
[0172] 1. Cell viability assay:
[0173] HepG2.2.15 and HepAD38 cells in logarithmic growth phase were selected, and an appropriate amount of Trypsin-EDTA digestion solution was added. Digestion was carried out at room temperature until the adherent cells completely detached. The digestion reaction was then terminated by adding DMEM complete medium containing 10% fetal bovine serum (FBS). The resulting cell suspension was centrifuged at 600 rpm for 3 minutes at room temperature, the supernatant was discarded, and the cell pellet was resuspended in fresh medium. Cells were seeded at a density of 3,000 cells per well in 96-well plates and pre-cultured at 37°C with 5% CO2 for 24 hours to ensure proper adhesion. After adhesion, cells were treated with different concentration gradients of betulinic acid (0–40 μM) and incubated under the same conditions for another 48 hours. After treatment, 10% CCK-8 working solution was prepared using serum-free DMEM basal medium, and 100 μl of the working solution was added to each well. The cells were incubated at 37°C in the dark for 1 hour. After incubation, the absorbance (OD value) of each well was measured at a wavelength of 450 nm using a microplate reader to assess cell viability.
[0174] Experimental results: such as Figure 6 As shown in A, after 48 h of treatment with betulinic acid, both hepatitis B cell lines, HepG2.2.15 and HepAD38, showed a decrease in viability at a concentration of 40 μM (viability decreased by about 25%, p<0.001), suggesting that to avoid cytotoxicity, the maximum effective concentration in subsequent efficacy experiments should be 20 μM.
[0175] 2. Hepatitis B antigen and HBV DNA testing
[0176] Cells in the logarithmic growth phase were digested with trypsin-EDTA and resuspended in complete culture medium (basal medium + 10% FBS) containing 10% fetal bovine serum to form a single-cell suspension, and cell counts were performed. Cells were then seeded in 96-well plates at 5,000 cells per well, with different treatment conditions set according to experimental groups. After cell adhesion and stabilization, different concentration gradients of betulinic acid solution (0–20 μM) were added for treatment, and the cells were incubated at 37°C, 5% CO2 for 48 hours. After 48 hours of drug treatment, the cell culture supernatant was collected from each well, and the levels of HBsAg and HBeAg in the supernatant were detected according to the ELISA kit instructions. Simultaneously, the HBV DNA content in the cell culture supernatant was detected according to the HBV DNA quantification kit (Sansure Biotech) instructions to assess the effect of betulinic acid on HBV replication and antigen secretion.
[0177] Experimental results: After treatment with betulinic acid, the levels of HBsAg, HBeAg, and HBV DNA in the supernatant of both hepatitis B cell lines decreased significantly, and the effect showed a clear dose-dependent relationship (inhibition rate of approximately 40%-70%, p<0.0001). Figure 6 (As shown in B, C, and D).
[0178] 3. Detection of intracellular hepatitis B transcription level and HBcAg content
[0179] Cells in logarithmic growth phase were digested with trypsin-EDTA, resuspended, and seeded in 6-well plates. After cell attachment, cells were treated with 10 μM and 20 μM betulinic acid solutions, respectively, and incubated for 48 hours. After treatment, total RNA was extracted from the cells, and cDNA was synthesized via reverse transcription for subsequent qPCR analysis of related gene expression levels. Simultaneously, a portion of the treated cells was lysed with RIPA lysis buffer to extract total protein. Protein quantification was performed using the BCA method, followed by Western blotting to assess intracellular HBcAg protein expression levels.
[0180] Experimental results: such as Figure 6 As shown in E and F, the transcriptional levels of 3.5kb RNA and Total RNA in the two hepatitis B cells were significantly reduced after betulinic acid treatment (approximately 0.5-fold, p<0.01), and intracellular HBcAg expression was also significantly inhibited (inhibition rate approximately 40%, p<0.01).
[0181] 4. Verification of the in vivo anti-hepatitis B activity and safety of betulinic acid
[0182] Based on relevant references, we selected 5–6 week old male transgenic hepatitis B virus mice and randomly divided them into three groups (n=6 per group): a blank control group (physiological saline), a betulinic acid group (20 mg / kg), and an entecavir group (30 mg / kg). The betulinic acid group and the control group were administered the drug via intraperitoneal injection once daily, while the entecavir group received continuous administration of the drug dissolved in the mice's drinking water. The control group received an equal volume of physiological saline via intraperitoneal injection. During the administration period, the mice's mental state, activity level, food intake, and coat luster were observed and recorded daily, and any abnormalities were recorded. Every week, serum was collected via orbital vein blood collection for the detection of various biochemical and virological indicators. After 28 days of continuous administration, the mice were sacrificed, and serum was collected via ocular blood collection to detect HBsAg and HBV DNA levels, as well as liver function-related biochemical indicators (such as ALT and AST). Simultaneously, the liver and major organs such as the heart, spleen, lungs, and kidneys were removed, fixed in paraformaldehyde, embedded in paraffin, and prepared into tissue sections. Tissue sections were subjected to immunohistochemical staining (IHC) and hematoxylin-eosin staining (HE) to observe the expression of hepatitis B virus antigens (HBsAg, HBcAg) and the pathological morphological changes of each tissue, so as to systematically evaluate the anti-HBV efficacy of betulinic acid and its toxicity to major organs.
[0183] Experimental results: Compared with the control group, the serum HBsAg level in mice treated with betulinic acid was significantly reduced (by approximately 60%, p<0.0001), and the reduction was significantly greater than that in the positive control entecavir group. Figure 6 (As shown in G in the figure). Simultaneously, HBV DNA was also inhibited (inhibition rate approximately 9%, p < 0.05). Figure 6 (H in the figure). Immunohistochemical staining results showed that the expression levels of HBsAg and HBcAg in liver tissue varied across groups in a trend consistent with serum detection results. Figure 6 As shown in Figure I), this further suggests that betulinic acid has definite anti-hepatitis B virus activity, and its efficacy is superior to entecavir in some indicators. Meanwhile, no significant differences were observed in the serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and creatinine among the different groups of mice. Figure 6 As shown in K), betulinic acid has no significant toxic effects on liver and kidney function. Furthermore, HE staining results showed no significant morphological abnormalities or pathological damage in the major organs (heart, liver, spleen, lungs, kidneys, etc.) of the mice in each group. Figure 6 As shown in J in the figure, this further demonstrates that the drug has good in vivo safety.
[0184] Example 7: Evidence of the anti-hepatitis B mechanism of betulinic acid mediated by SERPINE1
[0185] HepG2.2.15 and HepAD38 cells in logarithmic growth phase were evenly seeded in 6-well plates. After cell attachment, 20 μM betulinic acid was added to treat the cells for 48 hours. After treatment, cells were collected and subjected to qPCR and Western blotting experiments to detect the regulatory effect of betulinic acid on SERPINE1 expression and to assess its effect on the expression level of the SERPINE1 interacting protein PIKfyve. Tiplaxtinin is a known SERPINE1-specific inhibitor. To clarify the involvement of SERPINE1 in the anti-hepatitis B effect of betulinic acid, we set up a combined treatment group: cells were first treated with 20 μM betulinic acid for 48 hours, followed by incubation with 20 μM Tiplaxtinin, a SERPINE1-specific inhibitor, for another 24 hours. After treatment, cell supernatants were collected to detect HBsAg secretion levels. Simultaneously, cells were collected for Western blotting to detect intracellular HBcAg expression, and the results were compared with those of the betulinic acid-only treatment group to evaluate the functional contribution of SERPINE1 in the anti-HBV effect of betulinic acid.
[0186] Experimental results: After treatment with betulinic acid, the expression level of SERPINE1 protein increased significantly (approximately 1.4-fold, p<0.05). Figure 7 The results (A and B) suggest that betulinic acid has a positive regulatory effect on SERPINE1. Simultaneously, this small molecule compound also increased the expression level of PIKfyve (approximately 2-fold, p < 0.05). Figure 7 (As shown in E in the figure). Furthermore, compared to the betulinic acid alone treatment group, the combined Tiplaxtinin treatment significantly reversed the inhibitory effect of betulinic acid on HBsAg secretion (inhibition rate decreased from 30% to 16%, p<0.05). Figure 7 (As shown in C) and the reducing effect of intracellular HBcAg expression (Western Blot band grayscale analysis showed that the reduction from 40% to 10%, p<0.05) Figure 7 As shown in D in the figure, the anti-HBV effect of betulinic acid mainly depends on its activation of SERPINE1.
[0187] Example 8: Validation of the superiority and synergistic effect of betulinic acid combined with entecavir in the treatment of hepatitis B.
[0188] HepG2.2.15 cells in logarithmic growth phase were uniformly seeded in 96-well plates. The following experimental groups were established: a blank control (DMSO) group, a betulinic acid (20 μM) monotherapy group, an entecavir (10 nM) monotherapy group, and a combination of betulinic acid (20 μM) and entecavir (10 nM) treatment group. After cell attachment, the corresponding drugs were added for 48 hours. After treatment, the cell supernatant was collected, and HBsAg levels were detected by ELISA and HBV DNA levels were detected by qPCR.
[0189] To quantitatively evaluate the nature of the combined effect of the two drugs, the Chou-Talalay Combination Index (CI) method was used for data analysis. CalcuSyn software (Biosoft, UK) was used to process the dose-response data. CI <1, =1, or >1 indicate synergistic, additive, or antagonistic effects, respectively.
[0190] Experimental results: such as Figure 8 As shown in Figures A and B, compared with the single-drug group, the combination therapy group showed significantly enhanced inhibitory effects on both HBsAg and HBV DNA (p<0.0001). Analysis using the Chou-Talalay combination index method indicated that the combination of betulinic acid and entecavir had a synergistic effect on the inhibition of HBsAg and HBV DNA, with combination indices of 0.65 and 0.78, respectively (CI < 1).
[0191] Data from Examples 1, 2, and 3 demonstrate that this invention confirms the anti-hepatitis B virus function and mechanism of SERPINE1: In HepG2.2.15 and HepAD38 cell models containing the complete HBV genome, overexpression of SERPINE1 reduced the level of HBsAg in the cell supernatant (up to a maximum reduction of approximately 50%, p<0.0001) and decreased the expression of intracellular HBcAg (a decrease of approximately 50%, p<0.01). In the AAV-HBV mouse model, overexpression of SERPINE1 reduced serum HBsAg levels by approximately 80% (p<0.01) and HBV DNA levels by approximately 10% (p<0.05), while simultaneously inhibiting the expression of HBcAg (inhibition rate approximately 65%, p<0.05) and HBsAg (inhibition rate approximately 88%, p<0.01) in liver tissue, without observing significant toxicity. Mechanistic studies revealed that SERPINE1 can enhance lysosomal function and promote autophagy flux by interacting with phosphatidylinositol kinase PIKfyve, thereby counteracting the inhibitory effect of HBV on autophagy. These effects were verified by Western blotting, the mCherry-GFP-LC3 dual-fluorescent labeling system, and transmission electron microscopy.
[0192] Data from Examples 4 and 5 demonstrate that this invention provides multi-dimensional evidence for the binding and regulatory effects between SERPINE1 and betulinic acid: Photoaffinity molecular probe combined with mass spectrometry analysis showed that betulinic acid can stably bind to SERPINE1. Cell thermal migration assay (CETSA) further indicated that the thermal stability of SERPINE1 was improved under 1 μM betulinic acid treatment, with protein residues at 49℃ and 53℃ being 1.2 times and 2 times that of the control, respectively (p<0.05). Surface plasmon resonance (SPR) analysis showed that betulinic acid has a high binding affinity to SERPINE1 protein, with a KD value of 1.46 μM. Molecular docking simulation results showed a binding energy of -6.8 kcal / mol, suggesting that betulinic acid can embed itself into the SERPINE1 protein binding pocket. These results indicate that betulinic acid can directly bind to SERPINE1.
[0193] Data from Examples 6 and 7 demonstrate that this invention clarifies the anti-HBV effect of betulinic acid and its potential mechanism: In a hepatitis B cell model, betulinic acid can inhibit HBsAg secretion and HBV DNA replication in a dose-dependent manner (inhibition rate approximately 40–70%, p<0.0001), and significantly reduce intracellular HBcAg expression levels (reduction of approximately 40%). In an HBV transgenic mouse model, betulinic acid (20 mg / kg, intraperitoneal injection for 4 weeks) can reduce serum HBsAg levels by approximately 60% (p<0.0001), an effect superior to the control drug entecavir, and no significant toxic reactions were observed. Furthermore, treatment with the SERPINE1-specific inhibitor Tiplaxtinin significantly reversed the inhibitory effect of betulinic acid on HBsAg and HBcAg (p<0.05), suggesting that the anti-HBV effect of betulinic acid depends on the activation of the SERPINE1 protein.
[0194] Data from Example 8 demonstrates that the present invention reveals a synergistic effect when betulinic acid and entecavir are used in combination. Betulinic acid inhibits HBsAg secretion and HBV DNA replication by binding to and activating the SERPINE1 protein; while entecavir selectively inhibits HBV reverse transcriptase activity, blocking DNA generation. Experimental data show that the inhibitory effect of the combination therapy group on HBsAg and HBV DNA is significantly better than that of the single-drug group (p<0.0001), and the synergistic effect is confirmed by CI calculation (CI<1). This combination strategy not only comprehensively inhibits viral replication through the complementarity of different mechanisms of action, but may also reduce the risk of drug resistance, laying a solid foundation for developing more effective combination therapy regimens.
[0195] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
[0196] SEQ ID NO:1:
[0197]
[0198] SEQ ID NO:2 :
[0199]
[0200] SEQ ID NO:3 :
[0201]
[0202] SEQ ID NO:4:
[0203]
[0204] SEQ ID NO:5:
[0205] ACCGCAACGTGGTTTTCTCA。
[0206] SEQ ID NO:6:
[0207] TTGAATCCCATAGCTGCTTGAAT。
Claims
1. Application of SERPINE1 protein or its encoding gene in the preparation of drugs that inhibit hepatitis B virus.
2. The application according to claim 1, characterized in that, The drug works by inhibiting the expression of hepatitis B surface antigen (HBsAg), hepatitis B virus core antigen (HBcAg), and hepatitis B virus e antigen (HBeAg), and / or reducing HBV DNA levels.
3. The application according to claim 1, characterized in that, The drug can achieve one or more of the following effects: (1) Promotes autophagosome-lysosome fusion; (2) Enhance autophagy flux.
4. The application according to claim 3, characterized in that, The enhanced autophagy flux is achieved through the interaction between the SERPINE1 protein and the phosphatidylinositol kinase PIKfyve protein.
5. Application of betulinic acid combined with entecavir in the preparation of drugs that inhibit hepatitis B virus.
6. A drug for inhibiting hepatitis B virus, characterized in that, The drug includes betulinic acid, entecavir, and pharmaceutically acceptable carriers.