Application of TMEM43 inhibitor in preparation of anti-gastric cancer drugs

Abstract

The invention relates to the technical field of biological medicine, in particular to application of a TMEM43 inhibitor in preparation of an anti-gastric cancer drug. According to the application disclosed by the invention, the expression profiles of the gastric cancer primary lesion and the peritoneal metastasis lesion are compared and analyzed through a single cell sequencing technology, and the TMEM43 is found to be abnormally high in expression in the peritoneal metastasis lesion. A further research proves that after the expression of the TMEM43 gene in the human gastric cancer cells is knocked down, the migration ability and the clone formation ability of the cells are obviously reduced; meanwhile, the expression levels of various markers related to the intracellular epithelial-mesenchymal transition (EMT) process also present different degrees of down-regulation (N-Cadherin, Snail, Twist1 and TMEM43 up-regulation) or up-regulation (E-cadherin up-regulation), and finally, the therapeutic effect of inhibiting the gastric cancer progress can be exerted. The key effect of TMEM43 in occurrence and development of gastric cancer is defined, and brand new theoretical guidance and technical direction are provided for research and development of gastric cancer treatment drugs.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to the application of TMEM43 inhibitor in the preparation of anti-gastric cancer drugs. BACKGROUND

[0002] Chemotherapy is still the main treatment method for advanced gastric cancer. The first-line drugs are mostly cytotoxic drugs such as fluorouracil, platinum and paclitaxel. Compared with simple surgery, perioperative chemotherapy can significantly improve the prognosis of patients with resectable gastric cancer. However, gastric cancer patients with peritoneal metastasis have high tumor invasiveness and resistance to traditional systemic treatment. Therefore, finding specific targets for gastric cancer peritoneal metastasis and exploring new strategies for gastric cancer treatment are key issues that need to be addressed in gastric cancer-related research.

[0003] Transmembrane protein 43 (TMEM43) is a member of the TMEM subfamily, NCBI Gene ID: 79188. TMEM43 is a highly conserved gene widely expressed in most species from bacteria to humans. TMEM43 contains four transmembrane domains of alpha-helix, mainly located in the endoplasmic reticulum membrane and nuclear membrane. Studies have shown that TMEM43 is a non-selective cation channel protein that can permeate Na + , K + and Cs + ions. Studies have shown that TMEM43 interacts with gap junction protein subunits Connexin26 and Connexin30, leading to non-syndromic hearing deafness. In addition, the (p.Ser358Leu) mutation of TMEM43 can enhance the NF-κB-TGF β signal cascade, leading to arrhythmogenic right ventricular cardiomyopathy. The prior art also relates to the use of TMEM43 siRNA for treating cardiomyopathy. Studies have shown that TMEM43 regulates sideroblastic anemia by reducing the expression of P53.

[0004] However, the relationship between TMEM43 and gastric cancer is not clear, and the specific mechanism has not been revealed. SUMMARY

[0005] (I) Technical problems to be solved In view of the above shortcomings and deficiencies of the prior art, the present application provides the application of TMEM43 inhibitor in the preparation of anti-gastric cancer drugs, which provides a new direction for the treatment of gastric cancer and the development of targeted drugs.

[0006] (II) Technical solutions The technical solutions adopted by the present application are as follows: In a first aspect, the present application provides the application of TMEM43 inhibitor in the preparation of anti-gastric cancer drugs.

[0007] Preferably, the TMEM43 inhibitor is a small molecule nucleotide targeting silencing or knockdown of TMEM43 expression.

[0008] Preferably, the small molecule nucleotide is shRNA, and the shRNA is any one of the following double-stranded oligonucleotides: TMEM43-shRNA1 Sense strand: CCGGCCTTATGACACGGATCCTCTACTCG AGTAGAGGATCCGTGTCATAAGGTTTTTG (SEQ ID NO. 1); Antisense strand: AATTCAAAAACCTTATGACACGGATCCTC TACTCGAGTAGAGGATCCGTGTCATAAGG (SEQ ID NO. 2); TMEM43-shRNA2 Sense strand: CCGGCCTTTGTCCAAATTGGCAGGTCTCGA GACCTGCCAATTTGGACAAAGGTTTTTG (SEQ ID NO. 3); Antisense strand: AATTCAAAAACCTTTGTCCAAATTGGCAGG TCTCGAGACCTGCCAATTTGGACAAAGG (SEQ ID NO. 4); TMEM43-shRNA3 Sense strand: CCGGGAGGTGTTTCATAGAGAACTACTCGA GTAGTTCTCTATGAAACACCTCTTTTTG (SEQ ID NO. 5); Antisense strand: AATTCAAAAAGAGGTGTTTCATAGAGAACT ACTCGAGTAGTTCTCTATGAAACACCTC (SEQ ID NO. 6).

[0009] Preferably, the drug comprises an active ingredient which is a small molecule nucleotide targeting silencing or knockdown of TMEM43 expression, and a carrier which is a lentiviral vector.

[0010] Preferably, the lentiviral vector is pHBLV™.

[0011] Preferably, the medicine further comprises a helper vector, the helper vector comprising pSPAX2 and pMD2G.

[0012] In a second aspect, the present application provides an anti-gastric cancer medicine, comprising an active ingredient and a carrier, the active ingredient being a small molecule nucleotide targeting silencing or knocking down TMEM43 expression, and the carrier being a lentivirus vector.

[0013] Preferably, the small molecule nucleotide is shRNA, and the shRNA is any one of the following double-stranded oligonucleotides: TMEM43-shRNA1 Sense strand: CCGGCCTTATGACACGGATCCTCTACTCG AGTAGAGGATCCGTGTCATAAGGTTTTTG (SEQ ID NO. 1); Antisense strand: AATTCAAAAACCTTATGACACGGATCCTC TACTCGAGTAGAGGATCCGTGTCATAAGG (SEQ ID NO. 2); TMEM43-shRNA2 Sense strand: CCGGCCTTTGTCCAAATTGGCAGGTCTCGA GACCTGCCAATTTGGACAAAGGTTTTTG (SEQ ID NO. 3); Antisense strand: AATTCAAAAACCTTTGTCCAAATTGGCAGG TCTCGAGACCTGCCAATTTGGACAAAGG (SEQ ID NO. 4); TMEM43-shRNA3 Sense strand: CCGGGAGGTGTTTCATAGAGAACTACTCGA GTAGTTCTCTATGAAACACCTCTTTTTG (SEQ ID NO. 5); Antisense strand: AATTCAAAAAGAGGTGTTTCATAGAGAACT ACTCGAGTAGTTCTCTATGAAACACCTC (SEQ ID NO. 6).

[0014] Preferably, the lentivirus vector is pHBLVTM.

[0015] Preferably, the pharmaceutical also comprises a helper vector, which includes pSPAX2 and pMD2G.

[0016] (III) Beneficial Effects The present application compares and analyzes the expression profiles of gastric cancer primary foci and peritoneal metastasis foci by single cell sequencing technology, finds that TMEM43 is abnormally highly expressed in peritoneal metastasis foci. After further research, it is confirmed that when the expression of TMEM43 gene in human gastric cancer cells is knocked down, the migration ability and clonogenicity of the cells are significantly reduced; at the same time, the expression levels of various markers related to the epithelial-mesenchymal transition (EMT) process in the cells also present different degrees of down-regulation (N-Cadherin, Snail, Twist1, TMEM43 up-regulation) or up-regulation (E-cadherin up-regulation), which can ultimately exert a therapeutic effect of inhibiting the progression of gastric cancer.

[0017] Based on the above findings, the present application further suggests that TMEM43 can be used as a new molecular target for the treatment of gastric cancer. Accordingly, targeted treatment methods can be developed, such as silencing or knocking down the expression of TMEM43 by small molecule nucleotides (such as small interfering RNA siRNA, short hairpin RNA shRNA), or developing small molecule compounds, protein antibodies, etc. targeting TMEM43, thereby providing a new intervention strategy for the treatment of gastric cancer. The research results not only clarify the key role of TMEM43 in the occurrence and development of gastric cancer, but also provide a new theoretical guidance and technical direction for the research and development of gastric cancer treatment drugs. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 Comparison of the expression of TMEM43 in gastric cancer tissue samples and control tissue samples.

[0019] Figure 2 Fluorescence map of gastric cancer cells transfected with TMEM43 interfering lentivirus vector.

[0020] Figure 3 WB detection of the relative expression level of TMEM43 protein in each group of cells.

[0021] Figure 4 qRT-PCR detection of the mRNA transcription level of TMEM43 in each group of cells.

[0022] Figure 5 Show the changes of the migration ability (A) and clonogenicity (B) of human gastric cancer cells after knocking down the expression of TMEM43 in gastric cancer cells.

[0023] Figure 6 Show the expression of EMT-related markers in human gastric cancer cells after knocking down the expression of TMEM43. DETAILED DESCRIPTION

[0024] For better explanation, in order to facilitate understanding, the present application is described in detail below by specific embodiments in combination with the drawings.

[0025] Example 1

[0026] The expression of TMEM43 in gastric cancer tissue samples and healthy control tissue samples was compared using single-cell sequencing technology. The experimental method is as follows: I. Preparation of experimental samples 1. Gastric cancer tissue samples: Patients diagnosed as primary gastric cancer by pathological diagnosis (clinical stages cover I-IV, excluding preoperative radiotherapy and chemotherapy, combined with other malignant tumors or serious underlying diseases), intraoperative acquisition of cancer tissue (avoiding necrotic area, taking mixed tissue of tumor core and marginal area, about 100 mg per case), a total of n≥15 biological repeat samples were included.

[0027] Healthy control tissue samples: Patients undergoing surgical treatment for benign diseases (such as gastric ulcer, gastric polyp) in the same period were selected, and normal gastric mucosa tissue (verified by pathology without epithelial dysplasia or cancer) was obtained from the lesion site ≥5 cm, a total of n≥10 biological repeat samples were included.

[0028] All samples were obtained with the informed consent of the patients, and the samples were immediately placed in 1% penicillin-streptomycin-containing ice tissue preservation solution after sampling, and transported to the laboratory for processing within 30 min.

[0029] 2. Matching of sample clinical information The clinical characteristics of the patients corresponding to the two groups of samples, such as age (mainly 50-70 years old), gender (balanced male to female ratio), gastric mucosa lesion site (gastric antrum, gastric body, etc.), were recorded, and the influence of confounding factors on the results was reduced by propensity score matching.

[0030] II. Preparation of single-cell suspension 1. Tissue dissociation (avoiding cell damage and cross contamination) Fresh tissue was rinsed three times with pre-cooled PBS (containing 1% penicillin and antibiotics) to remove blood, mucus, and other impurities. The tissue was then minced using a sterile scalpel to a homogenate size of less than 1 mm³. 5 mL of tissue dissociation buffer (containing 0.2% collagenase I, 0.1% hyaluronidase, and 0.05% DNase I, in serum-free DMEM / F12 medium) was added, and the mixture was incubated at 37°C with 5% CO2 and shaken for 40 min, gently pipetting every 10 min. Cell dispersion was observed under a microscope. After dissociation, an equal volume of DMEM / F12 medium containing 10% fetal bovine serum (FBS) was added. Terminate the reaction with 12 culture medium, then filter sequentially through 70μm and 40μm cell sieves to remove undissociated tissue fragments and cell clusters; next, centrifuge at 1200 rpm and 4℃ for 5 min, discard the supernatant, resuspend the cells in pre-chilled PBS, add trypan blue staining solution (final concentration 0.4%), and count the percentage of viable cells under an inverted microscope, ensuring a viable cell rate ≥85% (viable cells appear transparent, dead cells appear blue), and adjust the cell concentration to 1×10⁻⁶. 6 -1.5×10 6 cells / mL, for later use.

[0031] III. Single-cell sequencing library construction and sequencing 1. Single-cell capture and cDNA synthesis The 10x Genomics Chromium X single-cell sequencing platform was used, following the kit instructions (e.g., ChromiumSingle Cell 3' Reagent Kits v3.1): 10 μL of single-cell suspension, after concentration adjustment, was used to bind individual cells to reverse transcription primers containing unique cell barcodes and molecular identifiers (UMIs) via a microfluidic chip, forming water-in-oil droplets (GEMs). These GEMs were then placed in a PCR instrument for reverse transcription (reaction conditions: 50℃ for 90 min, 85℃ for 5 min, and incubation at 4℃) to convert intracellular mRNA into cDNA. After demulsification, all cDNA was collected and amplified by PCR (amplification conditions: 98℃ for 30 s, 15 cycles: 98℃ for 10 s, 63℃ for 30 s, 72℃ for 30 s, and a final 72℃ for 5 min) to obtain sufficient cDNA product.

[0032] 2. Library Construction and Quality Inspection The amplified cDNA was fragmented, end-repaired, A-tailed and adapter-ligated, and the library fragments with TMEM43 gene-related sequences were enriched by PCR (primer design reference TMEM43 gene NM_001130822.2 sequence, upstream primer: 5'-ggcagctggctggatgg-3', downstream primer: 5'-atgttgaccaggtctcggaa-3'); the library fragment size (target fragment range 200-600 bp) was detected by Agilent 2100 Bioanalyzer, and the library concentration (≥2 nM) was detected by Qubit 4.0 Fluorometer to ensure that the library quality met the sequencing requirements.

[0033] 3. High-throughput sequencing The qualified library was loaded into the Illumina NovaSeq 6000 sequencing platform, PE150 (double-end 150 bp) sequencing mode was used, and the sequencing depth was set to ≥50,000 reads per cell (to ensure coverage of the transcript of the TMEM43 gene); the sequencing quality was monitored in real time during sequencing, and the proportion of Q30 (error rate ≤0.1%) bases was required to be ≥90% to avoid interference of adapter contamination or low-quality data.

[0034] Four, bioinformatics analysis (focus on TMEM43 expression difference) 1. Raw data preprocessing The Cell Ranger (10x Genomics software, v6.1.2) was used for quality control of the raw sequencing data (FASTQ file): removing reads containing adapter sequences and low-quality bases (Phred score <20), distinguishing different cells through Cell Barcode, correcting PCR amplification bias through UMI, and obtaining the gene expression matrix of each cell (row: gene, column: cell, value: UMI count); cell-level quality control: filtering out the following cells to reduce noise: ① gene detection number <200 or >6000 (excluding dead cells, doublets or low-quality cells); ② mitochondrial gene proportion >15% (excluding stress-damaged cells); ③ cells with TMEM43 gene UMI count of 0 (not included in subsequent gene expression analysis).

[0035] 2. Cell clustering and cell type annotation The cell expression matrix after quality control was standardized (Normalize Data function, using Log Normalize method), feature selection (Find Variable Features function, screening high variable genes) and principal component analysis (PCA) by Seurat software (v4.0.5, R language package); based on the PCA results, the dimensionality was reduced by t-SNE (t-distributed Stochastic Neighbor Embedding) or UMAP (Uniform Manifold Approximation and Projection), cell clustering was performed by Find Clusters function (resolution was set to 0.8) to obtain different cell subpopulations; referring to known gastric tissue cell type markers (such as epithelial cells: CDH1, KRT19; immune cells: CD45, CD3D; fibroblasts: COL1A1, FAP), the marker genes of each cluster were identified by Find Markers function to complete cell type annotation (with emphasis on gastric epithelial cell subpopulation, as TMEM43 is mainly expressed in epithelial cells).

[0036] 3. TMEM43 expression difference analysis The TMEM43 gene UMI counts of each cell type in the gastric cancer group and the healthy control group were extracted, and the "UMI count per 10,000 transcripts (TP10K)" standardization was used to eliminate the influence of cell sequencing depth difference on expression amount; the expression levels of TMEM43 in the two groups were compared by cell type: the difference significance was calculated by Wilcoxon rank sum test (one-sided test), and the screening standard was set as |log2(gastric cancer group TP10K / healthy control group TP10K)|>1 and corrected p value (padj)<0.05, which was determined as significant differential expression of TMEM43; and the expression distribution of TMEM43 in each cell type in the two groups was shown by Violin Plot. The experimental results are shown in Figure 1 The expression of TMEM43 in the gastric cancer tissue sample was significantly higher than that in the healthy control tissue sample.

[0037] Example 2

[0038] In this embodiment, siRNA target points for TMEM43 gene were designed, and corresponding shRNA sequences were synthesized. The siRNA sequences and shRNA sequences are shown in Tables 1-2. The specific steps are as follows: 1. Enzymatic digestion of lentiviral vector Take the lentiviral vector plasmid pHBLVTM, use restriction enzymes BamHI and EcoRI for double enzyme digestion reaction (reaction system contains vector plasmid, BamHI, EcoRI, enzyme digestion buffer, etc.), incubate at 37℃ for 4h. After enzyme digestion, the product is separated by agarose gel electrophoresis, and the linearized pHBLVTM vector fragment (remove the uncut circular plasmid) is recovered.

[0039] 2. Preparation of shRNA insert Two complementary single-stranded DNA oligonucleotides (about 70 nt in length) were artificially synthesized: both single strands carried shRNA coding sequences targeting the target gene (TMEM43), and both ends were designed with BamHI, EcoRI restriction enzyme recognition sites and sticky end complementary sequences matching the vector.

[0040] Mix the two single-stranded DNAs in equal molar ratio and perform annealing reaction (procedure: heat at 95℃ for 5min, then slowly cool to room temperature to allow single-stranded complementary double-stranded formation), finally obtain shRNA double-stranded insert with sticky ends.

[0041] 3. Connection and transformation identification of recombinant vector The shRNA double-stranded insert obtained by annealing was connected with the pHBLVTM vector recovered by BamHI / EcoRI double enzyme digestion using T4 DNA ligase at 16℃ overnight to construct a recombinant lentiviral vector.

[0042] The ligation product was transformed into DH5α competent cells by heat shock method (after thawing the competent cells on ice, add the ligation product, ice bath for 30min; 42℃ heat shock for 90s, quickly ice bath for 2min; after recovery in antibiotic-free medium, inoculate on LB plate containing ampicillin). After single colony growth, positive colonies were picked and expanded, plasmid was extracted and verified by sequencing (using vector universal primers or specific primers) to confirm the sequence accuracy and correct direction of the insert.

[0043] 4. Lentivirus packaging, concentration and titer determination Plasmid extraction: a large amount of recombinant pHBLVTM vector and helper plasmids pSPAX2 (provides viral structural proteins and regulatory factors), pMD2G (provides envelope protein VSVG) verified by sequencing were extracted.

[0044] Cell transfection: Lipofectamine 3000 was used for co-transfection of recombinant pHBLVTM, pSPAX2, pMD2G into 293T packaging cells (ensure cell confluence of 70%-80% before transfection, and in good condition).

[0045] Virus collection: 24h, 48h, 72h after transfection, the supernatant of cell culture was collected respectively, and all supernatants were combined.

[0046] Virus concentration: the virus particles were concentrated by removing part of the culture medium components using ultracentrifugation method (25,000 rpm, 4℃ centrifugation for 2h) or PEG precipitation method.

[0047] Titer determination: the concentrated virus solution was gradiently diluted and then infected target cells (such as 293T cells) by fluorescence quantitative method (using the fluorescence reporter gene GFP carried by the vector) or limiting dilution method. After culture, the proportion of fluorescent positive cells was detected by flow cytometry, and the virus titer (unit: TU / mL, transduction unit per milliliter) was calculated combined with the dilution factor to ensure that the titer was ≥1×10 8 TU / mL, which met the subsequent experimental requirements.

[0048] Through the above steps, the recombinant lentivirus vector targeting the target gene can be constructed, packaged and activity verified, and the tool virus for subsequent gene interference experiments is provided.

[0049] Table 1: siRNA sequence

[0050] Table 2: shRNA sequence ; After TMEM43-shRNA is cleaved by Dicer enzyme in cells, corresponding siRNA with double-stranded structure is generated. siRNA is the “end product” of shRNA after enzyme cleavage, and then it exerts the effect of silencing the target gene TMEM43.

[0051] Example 3

[0052] In this example, the gastric cancer cells were infected with the lentivirus constructed in Example 2 to investigate the inhibitory effect of the lentivirus on TMEM43 in gastric cancer cells, and the experimental steps were as follows: 1. Gastric cancer cell culture and inoculation Logarithmic growth phase human gastric cancer cells (such as HGC27, NUGC3; which are lymph node metastases of undifferentiated gastric cancer tissue and primary cancer tissue of gastric adenocarcinoma, respectively) were selected, resuspended with RPMI-1640 culture medium containing 10% fetal bovine serum (FBS), and the cell density was adjusted to (2×10^5) cells / mL. 2mL of cell suspension was added to each well of a 6-well plate and incubated in a 37℃, 5% CO2 incubator for 24h. When the cells adhered and the confluence reached 70%, lentivirus infection was performed.

[0053] 2. Lentivirus infection and grouping test Control group (shCtrl): complete medium with lentivirus carrying TMEM43-shNC; shRNA1 group: complete medium with lentivirus carrying TMEM43-shRNA1; shRNA2 group: complete medium with lentivirus carrying TMEM43-shRNA2; shRNA3 group: complete medium with lentivirus carrying TMEM43-shRNA3; Each of the above lentiviruses carries a GFP fluorescent marker.

[0054] The multiplicity of infection (MOI) of each group was determined to be 10 according to the pre-experiment, and then the mixture was gently mixed and continued to be cultured.

[0055] 3. Observation of lentivirus transfection efficiency After 48h of infection of NUGC3 cells, the green fluorescence (GFP) expression of cells in each group was observed under a fluorescence inverted microscope, 5 fields of view were randomly selected, and the number of "fluorescent positive cells" and "total cells" was counted respectively, and the transfection efficiency was calculated (transfection efficiency = fluorescent positive cell number / total cell number x 100%); after 72h of infection, GFP expression was observed again and photographed (transfection effect see Figure 2 ), and each lentivirus showed good transfection effect on gastric cancer cells.

[0056] 4. Western Blot (WB) detection of TMEM43 protein expression level After 72h of infection, the cells in each group were collected, and total protein was extracted with RIPA lysis buffer containing protease inhibitors; after determining the protein concentration by BCA protein quantification kit, equal amount of protein (about 30μg) was subjected to SDS-PAGE electrophoresis, and then transferred to PVDF membrane. Block the membrane with 5% skim milk at room temperature for 2h; add the primary antibody (rabbit anti-human TMEM43 polyclonal antibody, 1:1000 dilution; mouse anti-human Actin monoclonal antibody, 1:5000 dilution), incubate at 4℃ overnight; after washing the membrane, add HRP-labeled secondary antibody (goat anti-rabbit IgG or goat anti-mouse IgG, 1:5000 dilution), incubate at room temperature for 1h. Finally, develop by ECL chemiluminescence kit, and quantitatively analyze the band gray value by ImageJ software, taking Actin as the internal reference, and calculating the relative expression of TMEM43 protein (experimental results see Figure 3 ). The figure shows that compared with the shCtrl group, the three groups of lentivirus carrying TMEM43-shRNA can effectively knock down the expression of TMEM43 protein in gastric cancer cells NUGC3.

[0057] 5. qRT-PCR detection of TMEM43 mRNA transcription level (1) Total RNA extraction and genomic DNA removal: 72 h after infection, cells from each group were collected, and total RNA was extracted using Trizol reagent; RNA concentration and purity were measured (OD value required). 260 / OD 280 (Between 1.8 and 2.0). Take 1 μg of total RNA and perform genomic DNA removal reaction using DNase I (incubate at 37°C for 30 min, then heat at 65°C for 10 min to inactivate the enzyme).

[0058] (2) cDNA synthesis: Using total RNA after removing genomic DNA as a template, cDNA was synthesized using a reverse transcription kit (such as PrimeScript RT Master Mix). The reaction conditions were: 37℃ for 15 min, 85℃ for 5 s, and stored at 4℃.

[0059] (3) The qPCR reaction was performed using the SYBR Green real-time PCR kit. The reaction system was 20 μL (containing 10 μL of 2×SYBR Green PCR Master Mix, 0.5 μL each of upstream and downstream primers, 2 μL of cDNA template, and 7 μL of RNase-free H2O).

[0060] Reaction program: 95℃ pre-denaturation for 30s; 95℃ denaturation for 5s, 60℃ annealing for 30s, for a total of 40 cycles; finally, melting curve analysis was performed (95℃, 15s, 60℃, 1min, 95℃, 15s).

[0061] Each sample was configured with 3 replicates, using Actin as an internal reference, and analyzed using Method 2. -ΔΔCt Calculate the relative expression level of TMEM43 mRNA (see experimental results). Figure 4 ).

[0062] The primer sequences used for qRT-PCR are as follows: TMEM43 primers: upstream primer (5'-{ggcagctggctggatgg}-3'), downstream primer (5'-{atgttgaccaggtctcggaa}-3').

[0063] Internal control Actin primers: forward primer (5'-{CATGTACGTTGCTATCCAGGC}-3'), reverse primer (5'-{CTCCTTAATGTCACGCACGAT}-3').

[0064] like Figure 4 As shown, compared to the shCtrl group, all three lentiviral transfection experiments carrying TMEM43-shRNA effectively inhibited the mRNA transcription level of TMEM43 in gastric cancer cells NUGC3.

[0065] As shown in Figure 5 Figure 22, changes in gastric cancer cells observed under SEM after infection of gastric cancer cells HGC27 and NUGC3 with lentivirus carrying TMEM43-shRNA1 and lentivirus carrying TMEM43-shRNA2. Among them, the number of HGC27 and NUGC3 was significantly reduced compared with the shCtrl group, which indicated that knocking down the expression level of TMEM43 in gastric cancer cells could reduce the migration ability (A) and clonogenic ability (B) of human gastric cancer cells.

[0066] As shown in Figure 6 Figure 23, the expression of various gastric cancer markers (E-Cadherin, N-Cadherin, Snail, Twist1, TMEM43) in HGC27 cells infected with lentivirus carrying TMEM43-shRNA1 and lentivirus carrying TMEM43-shRNA2 was detected by Olink neurology panel (95801). Among them, with TUBULIN as a reference, the expression levels of gastric cancer markers N-Cadherin, Snail, Twist1, TMEM43, etc. in HGC27 cells were significantly down-regulated after successful lentivirus transfection, which meant that the motility and invasiveness of cancer cells decreased; at the same time, the expression level of E-Cadherin increased, which meant that the migration and invasion of tumor cells were inhibited.

[0067] The experiments of this embodiment proved that by designing shRNA or siRNA targeting to knock down TMEM43, the motility and invasiveness of gastric cancer cells could be reduced, and the migration ability and clonogenic ability of the cells could be inhibited.

[0068] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the present application, and not to limit them; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacement for part or all of the technical features; and these modifications or replacements, or in the case of technical features in the above embodiments do not conflict with each other, can be combined in the manner recorded in the embodiments, and these modifications, replacements or combinations do not make the essence of the corresponding technical solution deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. Use of a TMEM43 inhibitor in the preparation of a drug for resisting gastric cancer.

2. Use according to claim 1, characterized in that, The TMEM43 inhibitor is a small molecule nucleotide targeting silencing or knockdown of TMEM43 expression.

3. Use according to claim 2, characterized in that, The small molecule nucleotide is shRNA, and the shRNA is any one of the following double-stranded oligonucleotides: TMEM43-shRNA1, whose sense strand is shown as SEQ ID NO. 1 and antisense strand is shown as SEQ ID NO. 2; TMEM43-shRNA2, whose sense strand is shown as SEQ ID NO. 3 and antisense strand is shown as SEQ ID NO. 4; TMEM43-shRNA3, whose sense strand is shown as SEQ ID NO. 5 and antisense strand is shown as SEQ ID NO.

6.

4. Use according to claim 3, characterized in that, The drug comprises an active ingredient which is a small molecule nucleotide targeting silencing or knockdown of TMEM43 expression and a carrier which is a lentivirus vector.

5. Use according to claim 4, characterized in that, The lentivirus vector is pHBLVTM.

6. An anti-stomach cancer drug, characterized by, The drug comprises an active ingredient which is a small molecule nucleotide targeting silencing or knockdown of TMEM43 expression and a carrier which is a lentivirus vector.

7. The anti-stomach cancer drug according to claim 6, wherein The small molecule nucleotide is shRNA, and the shRNA is any one of the following double-stranded oligonucleotides: TMEM43-shRNA1, whose sense strand is shown as SEQ ID NO. 1 and antisense strand is shown as SEQ ID NO. 2; TMEM43-shRNA2, whose sense strand is shown as SEQ ID NO. 3 and antisense strand is shown as SEQ ID NO. 4; TMEM43-shRNA3, whose sense strand is shown as SEQ ID NO. 5 and antisense strand is shown as SEQ ID NO.

6.

8. The anti-stomach cancer drug according to claim 7, wherein The lentivirus vector is pHBLVTM.

9. The anti-stomach cancer drug according to claim 8, wherein The drug further comprises a helper vector, and the helper vector comprises pSPAX2 and pMD2G.

Images