2apos; -alpha-ethynyl-beta-fluoronucleoside compound, composition and preparation and application of-alpha-ethynyl-beta-fluoronucleoside compound

By designing 2'-α-ethynyl-β-fluoronucleoside compounds targeting the viral RdRP structure, the problems of drug resistance to existing antiviral drugs and the lack of effective drugs for small RNA viruses have been solved, achieving broad-spectrum inhibition and efficient treatment of RNA viruses.

CN121159611APending Publication Date: 2025-12-19NANKAI UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511103391.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-07
Publication Date
2025-12-19

AI Technical Summary

Technical Problem

Existing antiviral drugs have high targeting specific viruses, but long-term use can easily lead to drug resistance. Furthermore, there is a lack of effective small molecule drugs for small RNA viruses, and the development of broad-spectrum antiviral drugs is costly and time-consuming.

Method used

We designed and synthesized 2'-α-ethynyl-β-fluoronucleoside compounds to broadly inhibit RNA viruses, including Bunyavirus, microRNA virus, and coronavirus, targeting the structural features of viral RdRP.

Benefits of technology

It provides broad-spectrum inhibition against a variety of RNA viruses, avoiding drug resistance issues and reducing research and development costs and time requirements.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention discloses a 2 '-alpha-ethynyl-beta-fluoronucleoside compound which has a structure as shown in a formula I, and pharmaceutically acceptable salts or various optical isomers, solvates or prodrugs thereof, and is a compound targeting a new structure of RNA (Ribonucleic Acid) virus polymerase. The invention also discloses a preparation method of the compound, a composition containing the compound and application of the compound in preparation of drugs for treating virus infection diseases. The 2 '-alpha-ethynyl-beta-fluoronucleoside compound obtained by the invention shows a remarkable chain termination intervention effect in a CCHFV polymerase system, an SARS-CoV-2 polymerase system and an EV71 polymerase system. The result of a cellular level inhibition experiment shows that the 2 '-alpha-ethynyl-beta-fluoronucleoside compound has an obvious inhibition effect on CCHFV on an HUVEC cell.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of pharmaceutical chemistry, and particularly relates to a 2'-alpha-ethynyl-beta-fluoro nucleoside compound, a composition and preparation and application thereof. BACKGROUND

[0002] Viruses are individual micro, simple structure and specific parasitic cell subcellular infection media composed of nucleic acid and protein. The core of the virus is nucleic acid (DNA or RNA), and the protein surrounds the nucleic acid to form a capsid. Some viruses also have an envelope outside the capsid. Viruses parasitize host cells to reproduce offspring in the form of replication. Diseases caused by viral infection are an important threat to public health safety.

[0003] Coronaviruses (CoVs) are RNA viruses with high mutation ability. There are currently seven types of CoVs that can infect humans. In recent years, the novel coronavirus that caused the global coronavirus disease 2019 (COVID-19) pandemic is also known as severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which is one of them. SARS-CoV-2 and SARS-CoV belong to the same family of coronaviruses. The single-stranded genome of the viruses in this family is 26-32 kb (kilobase) in length. Similar to other RNA viruses, the replication process of the coronavirus genome is dominated by the virus-encoded RNA-dependent RNA polymerase (RdRP). Since the host itself does not encode an RdRP that can synthesize long-chain nucleic acids, viral RdRP is one of the most ideal targets for anti-RNA virus drugs. As an analog of nucleoside triphosphate (NTP), the substrate of RdRP, nucleoside / nucleotide analogs (NAs) are an important class of antiviral small molecules, accounting for about half of antiviral small molecule drugs. Although remdesivir and molnupiravir have been approved for the treatment of COVID-19, their efficacy still needs to be further evaluated. Bunyaviruses belong to segmented negative-strand RNA viruses and are the most numerous RNA viruses. Studies have shown that many bunyaviruses can cause human infections, which can manifest as high fever, hemorrhage, meningitis, and even death. Among them, Crimean-Congo hemorrhagic fever virus (CCHFV) is widely distributed in more than 30 countries in Asia, Africa, and Europe and is the second most widely distributed arbovirus after dengue virus. Its infection can cause Crimean-Congo hemorrhagic fever (CCHF), the main symptoms of which are fever and hemorrhage, with a mortality rate of up to 40%. Therefore, CCHFV is listed by the World Health Organization as a highly infectious pathogen that can cause public health emergencies.

[0004] For the current infection of bunyavirus patients, the treatment method is mainly symptomatic treatment or broad-spectrum nucleoside antiviral drugs. At present, ribavirin and favipiravir are the most commonly used broad-spectrum antiviral drugs for treatment options. However, when using ribavirin for treatment, delayed nervous system diseases will occur, and only when the two are used together can the quality of life be improved. Although a number of chemical entities with inhibitory activity against bunyaviruses have been discovered, there is still a lack of efficient anti-bunyavirus drugs.

[0005] Small RNA viruses are a class of small positive-strand RNA viruses, and the diameter of the virion is about 22-32 nm. The replication of the genome is completed in the cytoplasm of the infected cells. Small RNA viruses include a variety of viruses that can cause human diseases, such as poliovirus (PV) that can cause poliomyelitis, human rhinovirus (HRV) that causes common cold, hepatitis A virus (HAV) that causes hepatitis, and enterovirus 71 (EV71) that causes hand, foot and mouth disease in infants. At present, there is no small molecule drug for small RNA viruses.

[0006] At present, antiviral drugs mainly target functional proteins of viruses, that is, specific drugs need to be developed for each virus. Although such antiviral drugs can achieve high specificity and selectivity, long-term and large-scale use often leads to drug resistance, and the development cost is high and time-consuming, and lacks foresight. As a parasitic organism, viruses must rely on the resources of host cells for reproduction. Therefore, there is an urgent need in the art to design small molecule drugs targeting the host cells on which viruses survive in order to obtain broad-spectrum antiviral drugs. SUMMARY

[0007] The present application provides a 2'-alpha-ethynyl-beta-fluoro nucleoside compound for viral infection diseases.

[0008] The present application also provides a preparation method and application of the above-mentioned compound.

[0009] The present application relates to the application of the nucleoside compound of formula I and / or pharmaceutically acceptable salt and / or hydrate in preparing drugs for treating viral infection diseases. The present application includes not only the synthesis of such compounds, but also the pharmaceutical composition of such compounds, the method for preparing them and the use of the compounds in various medical applications. The present application is a new structure of compound designed and synthesized on the basis of the structural characteristics of viral RdRP, which can inhibit RNA viruses in a broad spectrum, and thus can be used as a potential drug for preventing and treating RNA virus infections such as bunyavirus, small RNA virus and coronavirus.

[0010] More specifically, a compound of formula I and / or its enantiomers and / or diastereomers and / or racemates and / or pharmaceutically acceptable salts and / or pharmaceutically acceptable esters and / or hydrates and / or solvates:

[0011]

[0012] R 1 selected from the group consisting of hydrogen, halogen-substituted benzyl, benzyl, -C(=O)R 11 , -C(=O)OR 12 , R 13 , R 14 , and R 15 substituted silicon group, R 11 is selected from the group consisting of C1-C12 alkyl, 3-7 membered cycloalkyl, 3-7 membered heterocycloalkyl, 5-7 membered aromatic ring, 5-7 membered heteroaromatic ring; R 12 is selected from the group consisting of C2-C5 alkyl, C2-C5 unsaturated alkyl, 5-7 membered aromatic ring, 5-7 membered aromatic ring substituted methylene; R 13 , R 14 , and R 15 are each independently selected from the group consisting of C1-C5 alkyl; the aromatic ring can be further substituted with one or more substituents selected from the group consisting of halogen, halogen-substituted C1-C3 alkyl, C1-C3 alkoxy;

[0013] R 2 selected from the group consisting of hydrogen, halogen-substituted benzyl, benzyl, -C(=O)R 21 , -C(=O)OR 22 , R 23 , R 24 , and R 25 substituted silicon group, trimeric phosphonic acid group; R 21 is selected from the group consisting of C1-C12 alkyl, 3-7 membered cycloalkyl, 3-7 membered heterocycloalkyl, 5-7 membered aromatic ring, 5-7 membered heteroaromatic ring; R 22 is selected from the group consisting of C2-C5 alkyl, C2-C5 unsaturated alkyl, 5-7 membered aromatic ring, 5-7 membered aromatic ring substituted methylene; R 23 , R 24 , and R 25 are each independently selected from the group consisting of C1-C5 alkyl; the aromatic ring can be further substituted with one or more substituents selected from the group consisting of halogen, halogen-substituted C1-C3 alkyl, C1-C3 alkoxy;

[0014] or R 2 is selected from the group consisting of:

[0015]

[0016] AA (aminio acid) represents an amino acid segment;

[0017] B is selected from the group consisting of 5-9 membered heteroaryl, which heteroaryl can be further substituted by any one or two of amino, oxo.

[0018] As a preference, the general formula I is represented by the structure of general formula II-1 or general formula II-2:

[0019]

[0020] As a preference, R 1 is selected from the group consisting of hydrogen, 2,4-dichlorobenzyl, benzyl, acetyl, propionyl, 2-methylpropionyl, valeryl, pivaloyl, octanoyl, cyclohexylcarbonyl, 4-oxacyclohexylcarbonyl, benzoyl, furan-1- formyl, p-trifluoromethylbenzoyl, p-methoxybenzoyl, 2,4-dichlorobenzoyl, trimethylsilyl, tert-butyldimethylsilyl, propyloxycarbonyl, isopropyloxycarbonyl, allyloxycarbonyl, phenoxycarbonyl, benzyloxycarbonyl, trimethylphosphono.

[0021] As a preference, R 2 is selected from the group consisting of hydrogen, 2,4-dichlorobenzyl, benzyl, acetyl, propionyl, 2-methylpropionyl, valeryl, pivaloyl, octanoyl, cyclohexylcarbonyl, 4-oxacyclohexylcarbonyl, benzoyl, furan-1- formyl, p-trifluoromethylbenzoyl, p-methoxybenzoyl, 2,4-dichlorobenzoyl, trimethylsilyl, tert-butyldimethylsilyl, propyloxycarbonyl, isopropyloxycarbonyl, allyloxycarbonyl, phenoxycarbonyl, benzyloxycarbonyl, trimethylphosphono.

[0022] As a preference, R 2 is a phosphoramidate prodrug side chain in the Protide strategy, which structure is represented by the above formula II-1.

[0023] As a preference, AA represents an amino acid segment, which is obtained from one or more amino acids selected from the group consisting of glycine, L-leucine, D-leucine, L-valine, D-valine, L-alanine, D-alanine, L-phenylalanine, D-phenylalanine, L-tryptophan, D-tryptophan, L-isoleucine, D-isoleucine, L-proline, D-proline, L-serine, D-serine, L-methionine, D-methionine, L-cysteine, D-cysteine, L-tyrosine, D-tyrosine, L-threonine and D-threonine.

[0024] As a preference, B is selected from the group consisting of any of the following structures:

[0025]

[0026] In embodiments of the present invention, the compound represented by Formula I may be: the compound represented by Formula I or its enantiomers, diastereomers, racemates, pharmaceutically acceptable salts, pharmaceutically acceptable esters, hydrated compounds or solvates.

[0027] Furthermore, in this embodiment of the invention, R 1 Preferred components include hydrogen, 2,4-dichlorobenzyl, acetyl, propionyl, 2-methylpropionyl, valeryl, p-valeryl, octanoyl, cyclohexylformyl, 4-oxacyclohexylformyl, benzoyl, furan-1-formyl, p-trifluoromethylbenzoyl, p-methoxybenzoyl, 2,4-dichlorobenzoyl, tert-butyldimethylsilyl, propoxycarbonyl, isopropoxycarbonyl, allyloxycarbonyl, phenoxycarbonyl, and benzyloxycarbonyl.

[0028] In an embodiment of the present invention, R 2 Preferred components include hydrogen, 2,4-dichlorobenzyl, acetyl, propionyl, 2-methylpropionyl, valeryl, p-valeryl, octanoyl, cyclohexylformyl, 4-oxacyclohexylformyl, benzoyl, furan-1-formyl, p-trifluoromethylbenzoyl, p-methoxybenzoyl, 2,4-dichlorobenzoyl, tert-butyldimethylsilyl, propoxycarbonyl, isopropoxycarbonyl, allyloxycarbonyl, phenoxycarbonyl, benzyloxycarbonyl, and tripolyphosphate.

[0029] In embodiments of the present invention, AA is preferably an amino acid chain segment composed of one or more of glycine, L-alanine, D-alanine, L-leucine, D-leucine, L-phenylalanine, D-phenylalanine, L-tryptophan, D-tryptophan, L-methionine, and D-methionine.

[0030] The nucleoside compounds of this invention can exist in free form or as salts. Many pharmaceutically acceptable salts of various compound types and methods for their preparation are known to those skilled in the art. Pharmaceutically acceptable salts include conventional, non-toxic salts, including quaternary ammonium salts formed from bases of such compounds with inorganic or organic acids.

[0031] The compounds of the present invention can form hydrates or solvates. Those skilled in the art know methods for forming hydrates by freeze-drying the compounds together with water or for forming solvates by concentrating them in solution with a suitable organic solvent.

[0032] As used herein, the terminology, unless otherwise specified, shall be subject to the following definitions: The term "pharmaceutically acceptable ester," used alone or in combination with another substituent, means an ester of formula I, wherein any carboxyl functional group, preferably a carboxyl terminus, of that molecule is replaced by an alkoxycarbonyl functional group.

[0033]

[0034] wherein the R moiety is selected from alkyl (e.g., methyl, ethyl, propyl, butyl, hexyl); alkoxyalkyl (e.g., methoxyethyl); alkoxyacyl (e.g., acetyloxymethyl); aralkyl (e.g., benzyl); aryloxyalkyl (e.g., phenoxyethyl); aryl (e.g., phenyl). Optionally substituted with halogen, C1-4alkyl or C1-4alkoxy. Other suitable prodrug esters are listed herein by reference. Such pharmaceutically acceptable esters are typically hydrolyzed in the mammalian organism to form the form of the compound of Formula I.

[0035] With respect to the esters described above, any alkyl moieties present advantageously contain from 1 to 6 carbon atoms, particularly 1 to 6 carbon atoms, unless otherwise specified. Any aryl moieties present in the esters advantageously include phenyl groups.

[0036] The term "pharmaceutically acceptable salt" as used herein refers to salts of the compounds of Formula I which are suitable for use in normal medical therapy and which are not toxic, injurious, allergenic, etc. to the tissues of humans and animals at the dosages recommended for use. They are usually water or oil-soluble or dispersible, and are effective for use. The term includes pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts.

[0037] The term "pharmaceutically acceptable acid addition salt" means a salt with an inorganic acid such as sulfuric, nitric, phosphoric, hydrochloric, hydrobromic, sulfamic, and organic acids such as acetic, trifluoroacetic, trichloroacetic, cinnamic, citric, maleic, adipic, alginic, ascorbic, aspartic, benzoic, benzenesulfonic, glycolic, malic, lactic, malonic, oxalic, nicotinic, succinic, salicylic, stearic, tartaric, p-aminobenzoic, trimethylbenzenesulfonic, p-toluenesulfonic, mandelic, emic, picric, propionic, and the like.

[0038] The term "pharmaceutically acceptable base addition salt" refers to those salts which retain the biological effectiveness and properties of the free acids and of which the components are non-toxic at the concentrations employed. These salts are prepared from inorganic acids such as acetic, benzenesulfonic, camphorsulfonic, citric, ethanesulfonic, fumaric, hydrochloric, hydrobromic, lactic, maleic, mandelic, methanesulfonic, nitric, p-toluenesulfonic, sulfamic, succinic or tartaric acids, or from organic acids such as anthranilic, benzylic, cinnamic, citric, cyclamic, fumaric, glutamic, isethionic, lactic, malic, mandelic, nicotinic, oleic, orotic, propionic, pyroglutamic, salicylic, stearic, or trifluoroacetic acids. Preferred are ammonium, potassium, sodium, calcium, and magnesium salts. Base addition salts of pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as arginine, betaine, caffeine, chloroprocaine, choline, N,N'-dibenzylethylenediamine, diethylamine, diethylaminoethanol, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, isopropylamine, methylglucamine, morpholine, N-methylmorpholine, N-methylpiperidine, piperazine, piperidine, polyamine resins, procaine, pyrrolidine, pyrrolidine, trolamine, and triethylamine. Particularly preferred organic non-toxic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.

[0039] In a second aspect, the present application provides a method for preparing a compound of formula I. According to an embodiment of the present application, the method comprises the following steps:

[0040] reacting a compound of formula 1a with bis(2-methoxyethyl)aminosulfur trifluoride in the presence of pyridine to obtain a compound of formula 2a;

[0041] reacting a compound of formula 2a with acetic anhydride under catalysis of sulfuric acid to obtain a compound of formula 3a;

[0042] glycosylating a compound of formula 3a with silylated benzoyl cytidine under catalysis of tin tetrachloride to obtain a mixture of isomers of formula 4a;

[0043] reacting a compound of formula 4a with boron trichloride at -78°C, and isolating and purifying to obtain a compound of formula 6a;

[0044] reacting a compound of formula 6a with boron tribromide at room temperature to obtain a compound of formula 9a;

[0045] reacting a compound of formula 9a with tert-butyldimethylsilyl chloride to obtain a compound of formula 12a;

[0046] selectively removing the tert-butyldimethylsilyl protecting group from the 5'-hydroxyl group of a compound of formula 12a under catalysis of trichloroacetic acid to obtain a compound of formula 13a;

[0047] heating the compound of formula 13a in ammonia in methanol to obtain the compound of formula 14a;

[0048] reacting the compound of formula 14a with compound of formula 18a under t- butyl magnesium chloride condition to obtain the compound of formula 19a;

[0049] removing the t-butyldimethylsilyl protecting group at 3'-OH of compound of formula 19a under 6M hydrochloric acid condition to obtain the compound of formula I-A;

[0050] or, glycosidating the compound of formula 3a with uracil under trimethylsilyl triflate condition to obtain the compound of formula 5a;

[0051] reacting the compound of formula 5a with p-methoxybenzyl chloride to introduce PMB group, separation of isomers to obtain the compound of formula 7a;

[0052] removing the PMB group of compound of formula 7a under cerium ammonium nitrate condition to obtain the compound of formula 8a;

[0053] reacting the compound of formula 8a with boron trichloride at room temperature to obtain the compound of formula 10a;

[0054] reacting the compound of formula 10a with compound of formula 18a under t- butyl magnesium chloride condition to obtain the compound of formula I-B.

[0055] heating the compound of formula 9a in ammonia in methanol to obtain the compound of formula 11a;

[0056] or, heating the compound of formula 12a in ammonia in methanol to obtain the compound of formula 15a;

[0057] reacting the compound of formula 15a with N-t-butoxycarbonylimidazole under 1,8-diazabicycloundec-7-ene condition to obtain the compound of formula 16a;

[0058] removing the two t-butyldimethylsilyl protecting groups from hydroxyl group of compound of formula 16a under tetrabutylammonium fluoride condition to obtain the compound of formula 17a;

[0059] reacting the compound of formula 17a with corresponding acid chloride, anhydride or chloroformate under basic condition to obtain the compound of formula 20a;

[0060] removing the t-butoxycarbonyl protecting group from base of compound of formula 20a under trifluoroacetic acid condition to obtain the compound of formula I-C;

[0061] reacting a compound shown in formula 10a with a corresponding acyl chloride, acid anhydride or chloroformate under basic conditions to obtain a uridine compound shown in formula I-D;

[0062]

[0063]

[0064] The inventors have found that the method of the present application can quickly and efficiently prepare the compound shown in formula I, and has the advantages of short synthesis route, environmental friendliness, high yield and purity of target product, easy availability of raw materials, simple operation and post-treatment, and suitability for industrial production. In the present application, the specific synthesis route of the compound shown in formula I is as follows.

[0065] Specific synthesis routes of different phosphoramidate prodrugs shown in compounds formula I-A and I-B:

[0066]

[0067]

[0068] Specific synthesis routes of different 3',5'-bis ester prodrugs shown in compounds formula I-C and I-D:

[0069] The general method for preparing the compound shown in formula I used in the present application is described as follows: I. Preparation of the compound shown in general formula I-A:

[0070] (A-1) Preparation of the compound shown in formula 2a

[0071] reacting the compound shown in formula 1a with bis(2-methoxyethyl)amino sulfur trifluoride in the presence of pyridine to obtain the compound shown in formula 2a;

[0072] Specifically, the compound shown in formula 1a is weighed into a single-neck flask and dissolved with ethyl acetate, bis(2-methoxyethyl)amino sulfur trifluoride and pyridine are sequentially added under ice bath conditions, and the addition is completed dropwise. After stirring at room temperature for 0.5 h, the reaction flask is placed in an oil bath to heat to 78°C and reflux. The reaction is monitored by thin layer chromatography for 4.5 h until completion. Saturated sodium bicarbonate solution is slowly added under ice bath conditions to quench the reaction. Dichloromethane is added to dilute the reaction system, which is washed with saturated sodium bicarbonate solution and saturated brine, respectively. The organic phase is dried over anhydrous sodium sulfate, and the crude product after concentration is purified by silica gel column separation to obtain the compound shown in formula 2a.

[0073] (A-2) Preparation of the compound shown in formula 3a

[0074] reacting a compound shown in formula 2a with acetic anhydride under catalysis of sulfuric acid to obtain a compound shown in formula 3a;

[0075] Specifically, the compound shown in formula 2a and acetic anhydride are added into a single-neck flask and dissolved with acetic acid, concentrated sulfuric acid is slowly added dropwise under ice bath condition, and after the dropwise addition is completed, the reaction flask is stirred for 0.5 h, and then is moved to room temperature for continuous stirring. The reaction is completely monitored by thin layer chromatography for 5 h, saturated sodium bicarbonate solution is slowly added dropwise into the reaction system under ice bath condition until the system is weakly alkaline. After being fully extracted with dichloromethane, the organic phase is dried with anhydrous sodium sulfate, and the crude product after concentration is purified by silica gel column separation to obtain the compound shown in formula 3a.

[0076] (A-3) Preparation of a compound shown in formula 4a

[0077] reacting the compound shown in formula 3a with formula 14a under glycosidation reaction of tin tetrachloride to obtain an isomer mixture shown in formula 4a;

[0078] Specifically, the compound shown in formula 3a and the silylated benzoyl-protected cytidine are weighed into a three-neck flask and dissolved with acetonitrile, argon is exchanged, and tin tetrachloride is added dropwise under ice bath condition. After stirring for 0.5 h, the reaction flask is moved to an 80°C oil bath for reflux, and the reaction is completely monitored by thin layer chromatography for 6 h. The solvent is removed by concentration under reduced pressure, and after being diluted with dichloromethane, the mixture is washed with water, saturated sodium bicarbonate solution and saturated brine respectively. The organic phase is dried with anhydrous sodium sulfate, and the crude product after concentration is purified by silica gel column separation to obtain the isomer mixture shown in formula 4a.

[0079] (A-4) Preparation of a compound shown in formula 6a

[0080] reacting the compound shown in formula 4a with boron trichloride under the condition of-75°C to-85°C, and after separation and purification to obtain the compound shown in formula 6a;

[0081] Specifically, the compound shown in formula 4a is weighed into a three-neck flask and dissolved with anhydrous dichloromethane, and after argon is exchanged, boron trichloride is slowly added dropwise under the condition of-75°C to-85°C. After the dropwise addition is completed, the stirring is continued, and the reaction is completely monitored by thin layer chromatography for 2 h. Methanol is slowly added dropwise under the condition to quench the reaction, the solvent is removed by concentration under reduced pressure, and the obtained crude product is purified by silica gel column separation to obtain the compound shown in formula 6a.

[0082] (A-5) Preparation of a compound shown in formula 9a

[0083] reacting the compound shown in formula 6a with boron tribromide at room temperature to obtain the compound shown in formula 9a;

[0084] Specifically, the compound shown in formula 6a is weighed into a three-necked flask and dissolved with anhydrous dichloromethane, after argon is replaced, a solution of boron tribromide is slowly added dropwise under ice-bath condition, after the addition is completed, the temperature is raised to room temperature and stirring is continued. TLC monitoring shows that the reaction is completed in 2.5 h, methanol is slowly added dropwise under ice-bath condition to quench the reaction. The solvent is removed by concentration under reduced pressure, and the obtained crude product is purified by silica gel column separation to obtain the compound shown in formula 9a.

[0085] (A-6) Preparation of the compound shown in formula 11a

[0086] The compound shown in formula 9a is heated in an ammonia methanol solution to obtain the cytidine nucleus shown in formula 11a;

[0087] Specifically, the compound shown in formula 9a is dissolved with a 7M ammonia methanol solution and stirred in a 40°C oil bath. TLC monitoring shows that the reaction is completed in 2.5 h, the solvent is removed by concentration under reduced pressure, and the obtained crude product is purified by silica gel column separation to obtain the cytidine nucleus compound shown in formula 11a.

[0088] (A-7) Preparation of the compound shown in formula 12a

[0089] The compound shown in formula 9a is reacted with tert-butyldimethylsilyl chloride to obtain the compound shown in formula 12a;

[0090] Specifically, the compound shown in formula 9a and imidazole are weighed into a three-necked flask and dissolved with N,N-dimethylformamide, after argon is replaced, a solution of tert-butyldimethylsilyl chloride in N,N-dimethylformamide is slowly added dropwise under ice-bath condition, after the addition is completed, the temperature is raised to room temperature and stirring is continued. TLC monitoring shows that the reaction is completed in 48 h, a sodium bicarbonate solution is added dropwise to quench the reaction, the reaction system is diluted with dichloromethane, washed with saturated brine, the organic phase is dried with anhydrous sodium sulfate, and the obtained crude product is purified by silica gel column separation to obtain the compound shown in formula 12a.

[0091] (A-8) Preparation of the compound shown in formula 13a

[0092] The compound shown in formula 12a is selectively removed from the TBS protecting group on the 5'-hydroxyl group of ribose under the condition of trichloroacetic acid to obtain the compound shown in formula 13a;

[0093] Specifically, the compound shown in formula 12a is weighed into a single-necked flask and dissolved with a mixed solvent of tetrahydrofuran and water, trichloroacetic acid is slowly added dropwise at 0°C in a cold trap, and the temperature of the cold trap is raised to 10°C and stirring is continued. TLC monitoring shows that the reaction is completed in 9 h. The reaction system is diluted with dichloromethane, washed with water and saturated brine, the organic phase is dried with anhydrous sodium sulfate, and the obtained crude product is purified by silica gel column separation to obtain the compound shown in formula 13a.

[0094] (A-9) Preparation of the compound shown in formula 14a

[0095] The compound shown in formula 13a is heated in an ammonia methanol solution to obtain the compound shown in formula 14a;

[0096] Specifically, the compound shown in formula 13a is weighed in a single-neck flask and dissolved with an ammonia methanol solution, and the reaction flask is moved to an oil bath for stirring at 40°C. TLC monitoring shows that the reaction is complete after 2.5 h, the solvent is removed by concentration under reduced pressure, and the crude product is separated and purified by silica gel column to obtain the compound shown in formula 14a.

[0097] (A-10) Preparation of the compound shown in formula 19a

[0098] The compound shown in formula 14a is reacted with the compound shown in formula 18a under the condition of tert-butyl magnesium chloride to obtain the compound shown in formula 19a;

[0099] Specifically, the compound shown in formula 14a is weighed in a three-neck flask and dissolved with tetrahydrofuran. Under ice bath condition, tert-butyl magnesium chloride tetrahydrofuran solution is slowly added dropwise, and after stirring for 0.5 h, the compound shown in formula 18a tetrahydrofuran solution is added dropwise, and after the addition is completed, the reaction is continued to stir at room temperature. TLC monitoring shows that the reaction is complete after 12 h, and the reaction is quenched by adding saturated ammonium chloride solution under ice bath condition, the reaction system is diluted with dichloromethane, washed with saturated brine, and the organic phase is dried with anhydrous sodium sulfate. The crude product after concentration is separated and purified by silica gel column to obtain the compound shown in formula 19a.

[0100] (A-11) Preparation of the cytidine phosphoramidate compound shown in formula I-A

[0101] The compound shown in formula 19a is removed from the tert-butyl dimethyl silyl protecting group on the 3'-hydroxyl group under the condition of 6M hydrochloric acid to obtain the cytidine phosphoramidate compound shown in formula I-A;

[0102] Specifically, the compound shown in formula 19a is weighed in a single-neck flask and dissolved with methanol, and 6M hydrochloric acid solution is slowly added dropwise under ice bath condition, and the reaction flask is moved to room temperature for continuous stirring. TLC monitoring shows that the reaction is complete after 12 h, the reaction system is diluted with dichloromethane, and sequentially washed with saturated sodium bicarbonate solution and saturated brine. The organic phase is dried with anhydrous sodium sulfate, and the crude product after concentration is separated and purified by silica gel column to obtain the compound shown in formula I-A.

[0103] II. Preparation of the compound shown in general formula I-B:

[0104] (B-1) Preparation of the compound shown in formula 5a

[0105] The compound shown in formula 3a is glycosylated with uracil under the condition of trimethylsilyl trifluoromethanesulfonate to obtain the compound shown in formula 5a;

[0106] Specifically, the uracil was weighed into a three-necked flask and dissolved with acetonitrile, argon was replaced, BSA was added dropwise under ice bath, after stirring for 0.5 h, 3a was added and placed in an 80 °C oil bath to reflux, TLC was used to monitor the reaction for 6 h until the reaction was completed. The solvent was removed under reduced pressure, diluted with dichloromethane, washed with water, saturated sodium bicarbonate solution and saturated brine respectively, the organic phase was dried with anhydrous sodium sulfate, the crude product after concentration was purified by silica gel column to obtain the compound shown as formula 5a.

[0107] (B-2) Preparation of the compound shown as formula 7a

[0108] The compound shown as formula 5a was reacted with p-methoxybenzyl chloride under the condition of 1,8-diazabicycloundec-7-ene (DBU) to obtain the compound shown as formula 7a;

[0109] Specifically, the compound shown as formula 5a was weighed into a three-necked flask and dissolved with anhydrous acetonitrile, argon was replaced, 1,8-diazabicycloundec-7-ene and p-methoxybenzyl chloride were added dropwise at room temperature, the temperature was raised to 80 °C, and TLC was used to monitor the reaction until the reaction was completed. Methanol was added to quench the reaction, the solvent was removed by concentration to obtain a crude product, which was purified by silica gel column to obtain the compound shown as formula 7a.

[0110] (B-3) Preparation of the compound shown as formula 8a

[0111] The compound shown as formula 7a was removed from PMB group under the condition of cerium ammonium nitrate to obtain the compound shown as formula 8a;

[0112] Specifically, the compound shown as formula 7a was weighed into a single-necked flask and dissolved with acetonitrile and water (3:1), cerium ammonium nitrate was added, and stirring was continued at room temperature. TLC was used to monitor the reaction for 2.5 h until the reaction was completed. Methanol was added to quench the reaction, the solvent was removed by concentration to obtain a crude product, which was purified by silica gel column to obtain the compound shown as formula 8a.

[0113] (B-4) Preparation of the compound shown as formula 10a

[0114] The compound shown as formula 8a was reacted with boron trichloride to obtain the compound shown as formula 10a;

[0115] Specifically, the compound shown as formula 8a was weighed into a three-necked flask and dissolved with super-dry dichloromethane, boron trichloride was slowly added dropwise under ice bath, and stirring was continued at room temperature. TLC was used to monitor the reaction for 12 h until the reaction was completed. Methanol solution was added dropwise under ice bath to quench the reaction, the reaction system was diluted with dichloromethane, washed with saturated brine, the organic phase was dried with anhydrous sodium sulfate, the crude product after concentration was purified by silica gel column to obtain the compound shown as formula 10a.

[0116] Preparation of the uridine phosphoramidate compound represented by formula I-B

[0117] The compound represented by formula 10a is reacted with the compound represented by formula 18a using tert-butyl magnesium chloride as a base to obtain the compound represented by formula I-B;

[0118] Specifically, the compound represented by formula 10a is weighed into a three-necked flask and dissolved with tetrahydrofuran. Tetrahydrofuran solution of tert-butyl magnesium chloride is slowly added dropwise under ice bath, and tetrahydrofuran solution of the compound represented by formula 18a is added dropwise after stirring for 0.5 h, and stirring is continued at room temperature. TLC monitoring shows that the reaction is completed in 12 h, saturated ammonium chloride solution is added dropwise to quench the reaction, diluted with dichloromethane, washed with saturated brine, and the organic phase is dried over anhydrous sodium sulfate. The crude product after concentration is separated and purified by silica gel column to obtain the uridine phosphoramidate compound represented by formula I-B.

[0119] III. Preparation of the compound represented by general formula I-C:

[0120] (C-1) Preparation of the compound represented by formula 15a

[0121] The compound represented by formula 12a is heated in the ammonia methanol solution to obtain the compound represented by formula 15a;

[0122] Specifically, the compound represented by formula 12a is weighed into a single-necked flask and dissolved with ammonia methanol solution, and the reaction flask is moved to the oil bath for reaction at 40°C. TLC monitoring shows that the reaction is completed in 2.5 h, and the solvent is removed by concentration under reduced pressure. The crude product is separated and purified by silica gel column to obtain the compound represented by formula 15a.

[0123] (C-2) Preparation of the compound represented by formula 16a

[0124] The compound represented by formula 15a is reacted with N-tert-butoxycarbonylimidazole under 1,8-diazabicycloundec-7-ene condition to obtain the compound represented by formula 16a;

[0125] Specifically, the compound represented by formula 15a is weighed into a single-necked flask and dissolved with acetonitrile, and N-tert-butoxycarbonylimidazole and 1,8-diazabicycloundec-7-ene are sequentially added, and then the reaction flask is moved to the oil bath for reaction at 45°C. TLC monitoring shows that the reaction is completed in 24 h. The reaction system is diluted with dichloromethane, sequentially washed with citric acid solution, saturated sodium bicarbonate solution and saturated brine, and the organic phase is dried over anhydrous sodium sulfate. The solvent is removed by concentration under reduced pressure, and the crude product is separated and purified by silica gel column to obtain the compound represented by formula 16a.

[0126] (C-3) Preparation of the compound represented by formula 17a

[0127] removing the two tert-butyldimethylsilyl protecting groups on the hydroxyl group of the compound shown in Formula 16a under tetrabutylammonium fluoride conditions to obtain the compound shown in Formula 17a;

[0128] Specifically, the compound shown in Formula 16a is weighed into a single-neck flask and dissolved in tetrahydrofuran, and a solution of tetrabutylammonium fluoride in tetrahydrofuran is added dropwise under ice-bath conditions. The reaction flask is then moved to room temperature and stirring is continued. TLC monitoring is performed for 1 h to confirm that the reaction is complete. The reaction system is diluted with ethyl acetate, and then washed sequentially with water and saturated brine. The organic phase is dried over anhydrous sodium sulfate. The solvent is removed by concentration under reduced pressure, and the crude product is purified by silica gel column separation to obtain the compound shown in Formula 17a.

[0129] (C-4) Preparation of the compound shown in Formula 20a

[0130] reacting the compound shown in Formula 17a with the corresponding acyl chloride, acid anhydride or chloroformate under basic conditions to obtain the compound shown in Formula 20a;

[0131] Specifically, the compound shown in Formula 17a is weighed into a single-neck flask and dissolved in tetrahydrofuran. The corresponding acyl chloride, acid anhydride or chloroformate, 4-dimethylaminopyridine and triethylamine are then added sequentially under ice-bath conditions. The reaction flask is then moved to room temperature and stirring is continued. TLC monitoring is performed for 3 h to confirm that the reaction is complete. The reaction system is diluted with dichloromethane, and then washed sequentially with water, saturated citric acid solution, saturated sodium bicarbonate solution and saturated brine. The organic phase is dried over anhydrous sodium sulfate. The crude product after concentration is purified by silica gel column separation to obtain the compound shown in Formula 20a.

[0132] (C-5) Preparation of the cytidine 3', 5'-bis ester compound shown in Formula I-C

[0133] removing the tert-butyloxycarbonyl protecting group on the base of the compound shown in Formula 19a under trifluoroacetic acid conditions to obtain the cytidine 3', 5'-bis ester compound shown in Formula I-C;

[0134] Specifically, the compound shown in Formula 19a is weighed into a single-neck flask and dissolved in dichloromethane. Trifluoroacetic acid is then added slowly dropwise under ice-bath conditions. The reaction flask is then moved to room temperature and stirring is continued. TLC monitoring is performed for 4 h to confirm that the reaction is complete. The solvent is removed by concentration under reduced pressure. The residue is dissolved in ethyl acetate and then washed sequentially with saturated sodium bicarbonate solution and saturated brine. The organic phase is dried over anhydrous sodium sulfate. The crude product after concentration is purified by silica gel column separation to obtain the cytidine 3', 5'-bis ester compound shown in Formula I-C.

[0135] IV. Preparation of the uridine 3', 5'-bis ester compound shown in Formula I-D

[0136] reacting the compound shown in Formula 10a with the corresponding acyl chloride, acid anhydride or chloroformate under basic conditions to obtain the uridine 3', 5'-bis ester compound shown in Formula I-D;

[0137] Specifically, the compound shown as 10a is taken into a single-mouth bottle and dissolved with anhydrous dichloromethane. The corresponding acid chloride, anhydride or chloroformate, 4-dimethylaminopyridine and triethylamine are added in turn under ice bath conditions, and the reaction bottle is moved to room temperature for continuous stirring. Thin layer chromatography is used to monitor the completion of the reaction for 3 hours. The reaction system is diluted with dichloromethane, and washed with water, saturated citric acid solution, saturated sodium bicarbonate solution and saturated brine respectively. The organic phase is dried over anhydrous sodium sulfate, and the crude product after concentration is purified by silica gel column separation to obtain the uridine 3', 5'-bis ester compound shown as formula I-D.

[0138] Construction of ribose 2'-beta-F: The present application relates to a class of 2'-alpha-ethynyl-2'-beta-fluoropyrimidine nucleoside compounds and a preparation method thereof, which are cytidine or uridine derivatives carrying alpha-configuration ethynyl and beta-configuration fluorine atoms at ribose 2'-position. In view of the difficulty in direct fluorination and low construction efficiency of 2'-deoxy-2'-beta-fluoropyrimidine nucleosides in the prior art due to the base ortho effect, the present patent adopts the strategy of "first modifying ribose and then coupling base": first introducing alpha-ethynyl-beta-fluoro substituent at ribose 2'-position, and then selectively splicing with cytosine or uracil base, so as to efficiently and controllably realize the synthesis of 2'-alpha-ethynyl-2'-beta-fluorinated nucleoside analogs, and improve the application potential of the fluorinated nucleosides in the development of anticancer, antiviral drugs and functional probe molecules.

[0139] The 2'-alpha-ethynyl-beta-fluorinated nucleoside compounds obtained by the present application exhibit a significant chain termination intervention effect in the CCHFV polymerase system, the SARS-CoV-2 polymerase system and the EV71 polymerase system. And the cell level inhibition experiment results show that the 2'-alpha-ethynyl-beta-fluorinated nucleoside compounds have obvious inhibition effect on CCHFV on HUVEC cells. BRIEF DESCRIPTION OF DRAWINGS

[0140] Figure 1 Enzymatic characterization of NUSC001-TP intervention in CCHFV RdRP synthesis of RNA.A) Template (T38) / primer T38 (P3) RNA for enzymatic characterization and possible products synthesized under different NTP substrate combinations.B) Gel electrophoresis diagram of NUSC001-TP intervention in CCHFV RdRP synthesis of RNA.

[0141] Figure 2 Enzymatic characterization of NUSC001-TP intervention in SARS-CoV-2 RdRP synthesis of RNA (I).A) Template (V10-15) / primer (P10*3) RNA for enzymatic characterization and possible products synthesized under different NTP substrate combinations.B) Gel electrophoresis diagram of NUSC001-TP intervention in SARS-CoV-2 RdRP synthesis of RNA.

[0142] Figure 3 Enzymatic characterization of NUSC001-TP intervention on SARS-CoV-2 RdRP synthesizing RNA (II). A) Template (V10-15-1) / primer (P10*3) RNA used for enzymatic characterization and possible products synthesized under different NTP substrate combinations. B) Gel electrophoresis of NUSC001-TP intervention on SARS-CoV-2 RdRP synthesizing RNA.

[0143] Figure 4 Enzymatic characterization of Sofosbuvir-TP intervention on SARS-CoV-2 RdRP synthesizing RNA. A) Template (V10-1) / primer (P10*3) RNA used for enzymatic characterization and possible products synthesized under different NTP substrate combinations. B) Gel electrophoresis of Sofosbuvir-TP intervention on SARS-CoV-2 RdRP synthesizing RNA.

[0144] Figure 5 Enzymatic characterization of NUSC001-TP intervention on EV71 RdRP synthesizing RNA (I). A) Template (V5-1-F) / primer (P10) RNA used for enzymatic characterization and possible products synthesized under different NTP substrate combinations. B) Gel electrophoresis of NUSC001-TP intervention on EV71 RdRP synthesizing RNA.

[0145] Figure 6 Enzymatic characterization of NUSC001-TP intervention on EV71 RdRP synthesizing RNA (II). A) Template (V5-5) / primer (P10) RNA used for enzymatic characterization and possible products synthesized under different NTP substrate combinations. B) Gel electrophoresis of NUSC001-TP intervention on EV71 RdRP synthesizing RNA. DETAILED DESCRIPTION

[0146] The following example synthesis methods can be used in the synthesis of the compounds of the present application, and in conjunction with the synthesis methods described below, provide a better understanding of the compounds and synthesis methods described herein. The following synthesis methods are described for illustrative purposes only and are not intended to limit the application in any way.

[0147] All parameters and other statements in the examples are based on mass unless otherwise stated. Temperatures are provided in degrees Celsius. Unless otherwise stated, solution percentages represent a weight-to-volume relationship, and solution ratios represent a volume-to-volume relationship. Silica gel column chromatography was performed using silica gel unless otherwise stated. Nuclear magnetic resonance (NMR) spectra were recorded on a Bruker 400 MHz spectrometer; chemical shifts (δ) are expressed in parts per million (ppm) and are referenced to internal deuterated reagents.

[0148] Example 1: Preparation of compound (2S,3S,4R,5R)-4-((2,4-dichlorobenzyl)oxy)-5-(((2,4- dichlorobenzyl)oxy)methyl)-3-ethynyl-3-fluoro-2-methoxytetrahydrofuran (compound shown in Formula 2a)

[0149]

[0150] The compound (2S,3R,4R,5R)-4-((2,4-dichlorobenzyl)oxy)-5-(((2,4- dichlorobenzyl)oxy)methyl)-3-ethynyl-2-methoxytetrahydrofuran-3-ol (15.00 g, 29.63 mmol) was dissolved in super dry ethyl acetate (150 mL) and purged with argon for 3 times. Bis(2-methoxyethyl)aminosulfur trifluoride (BAST, 13.66 mL, 74.08 mmol) and pyridine (5.99 mL, 74.08 mmol) were added successively under ice bath condition. After the addition was completed, the reaction was stirred at room temperature for 0.5 h, and then heated to 78 °C. The reaction was monitored by thin layer chromatography (TLC) for 4.5 h until it was completed. The reaction was quenched by dropwise addition of saturated sodium bicarbonate solution under ice bath condition. The reaction was diluted with dichloromethane and washed with saturated sodium bicarbonate solution for 3 times and saturated brine for 1 time. The organic phase was dried over anhydrous sodium sulfate. The crude product after concentration was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 45 / 1) to give the product (2S,3S,4R,5R)-4-((2,4-dichlorobenzyl)oxy)-5-(((2,4-dichlorobenzyl)oxy)methyl)-3-ethynyl-3-fluoro-2-methoxytetrahydrofuran (5.90 g, 39.18%) as a white solid.

[0151] 1 H NMR (400 MHz, CDCl3) δ 7.44 (d, J = 8.3 Hz, 1H), 7.40 - 7.31 (m, 3H), 7.27 - 7.17 (m, 2H), 5.05 (d, J = 9.4 Hz, 1H), 5.00 - 4.72 (m, 2H), 4.59 (q, J = 13.2 Hz, 2H), 4.32 - 4.21 (m, 1H), 4.05 (dd, J = 21.8, 5.2 Hz, 1H), 3.70 (d, J = 4.6 Hz, 2H), 3.49 (s, 3H), 2.98 (d, J = 5.9 Hz, 1H).

[0152] 13C NMR (101 MHz, CDCI3) δ 134.29, 134.25, 133.97, 133.74, 133.60, 133.43, 130.50, 129.86, 129.20, 129.18, 127.24, 127.19, 106.74 (d, J = 39.2 Hz), 96.99 (d, J = 175.5 Hz), 84.93 (d, J = 31.5 Hz), 81.92, 81.14 (d, J = 9.5 Hz), 75.47 (d, J = 26.7 Hz), 70.11, 69.76, 55.52.

[0153] 19 F NMR (376 MHz, CDCI3) δ -141.62 (s).

[0154] Example 2: Preparation of (3S,4R,5R)-4-((2,4-dichlorobenzyl)oxy)-5-(((2,4- dichlorobenzyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl acetate (the compound shown in Formula 3a)

[0155]

[0156] (2S,3S,4R,5R)-4-((2,4-dichlorobenzyl)oxy)-5-(((2,4-dichlorobenzyl)oxy)methyl)-3- ethynyl-3-fluoro-2-methoxytetrahydrofuran (5.90 g, 11.61 mmol) was dissolved in glacial acetic acid (40 mL) and ethyl acetate (10 mL) and purged with argon 3 times. Acetic anhydride (8.72 mL, 92.88 mmol) and concentrated sulfuric acid (2.80 mL, 52.24 mmol) were added dropwise under ice bath condition and stirred at room temperature after the addition was completed. TLC monitoring showed that the reaction was completed after 5 h and saturated sodium bicarbonate solution was slowly added under ice bath condition until the system was weakly alkaline. It was extracted with dichloromethane 4 times, the organic phase was combined and washed with saturated sodium bicarbonate solution 3 times and saturated brine 1 time and dried over anhydrous sodium sulfate. After concentration, it was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 30 / 1) to obtain the product (3S,4R,5R)-4-((2,4-dichlorobenzyl)oxy)-5-(((2,4-dichlorobenzyl)oxy)methyl)-3-ethynyl-3- fluorotetrahydrofuran-2-yl acetate (2.36 g, 37.91%) as colorless oil.

[0157] Example 3: Compound N-(l-((3S,4R,5R)-4-((2,4-dichlorobenzyl)oxy)-5-(((2,4- dichlorobenzyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)-2-oxo-l,2- dihydropyrimidin-4-yl)benzamide

[0158]

[0159] N4-benzoylcytosine (1.42 g, 6.60 mmol), ammonium sulfate (8.72 mg, 66.00 mol) were dissolved with hexamethyldisilazane (HMDS, 12 mL) and purged with argon gas, then moved to an oil bath pot at 150 °C for 4.5 h. After natural cooling to room temperature, the solvent was removed by concentration under reduced pressure. (3S,4R,5R)-4-((2,4-dichlorobenzyl)oxy)-5-(((2,4-dichlorobenzyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl acetate (2.36 g, 4.40 mmol) was weighed and added to the reaction flask. After purging with argon gas 3 times, tin tetrachloride (1.41 mL, 11.00 mmol) was added dropwise under ice bath conditions, and after completion of the dropwise addition, it was stirred at room temperature for 0.5 h, and then the reaction flask was placed in an oil bath pot at 55 °C and stirred. The reaction was completed by TLC monitoring for 6 h. After removing the solvent by concentration under reduced pressure, it was diluted with dichloromethane and washed with saturated sodium bicarbonate solution 3 times and saturated brine solution 1 time, and dried over anhydrous sodium sulfate. After concentration, it was purified by silica gel column chromatography (dichloromethane / methanol = 80 / 1) to obtain N-(1-((3S,4R,5R)-4-((2,4-dichlorobenzyl)oxy)-5-(((2,4-dichlorobenzyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)-2-oxo-1,2-dihydropyrimidin-4-yl)benzamide (1.18 g, 38.78%) as a white solid.

[0160] Example 4: Preparation of N-(1-((2R,3S,4R,5R)-4-((2,4-dichlorobenzyl)oxy)-3-ethynyl-3-fluoro-5-(hydroxymethyl)tetrahydrofuran-2-yl)-2-oxo-1,2-dihydropyrimidin-4-yl)benzamide (compound represented by Formula 6a)

[0161]

[0162] A mixture of N-(l-((3S,4R,5R)-4-((2,4-dichlorobenzyl)oxy)-5-(((2,4- dichlorobenzyl)oxy)methyl)oxy)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)-2-oxo-l,2- dihydropyrimidin-4-yl)benzamide (5.00 g, 7.23 mmol) was dissolved in super dry dichloromethane (30 mL) and purged with argon 3 times. A solution of boron trichloride in dichloromethane (1.0 M, 72.32 mL, 72.32 mmol) was added slowly dropwise at -75 to -85 °C. The reaction was monitored by TLC at this temperature for 0.5 h and then slowly warmed to -45 °C. To the reaction mixture was added methanol slowly dropwise to quench the reaction and the solvent was removed under reduced pressure. The crude product was purified by silica gel column chromatography (dichloromethane / methanol = 40 / 1) to give the single configuration white solid product N-(l-((2R,3S,4R,5R)-4-((2,4-dichlorobenzyl)oxy)-3-ethynyl-3-fluoro-5- (hydroxymethyl)tetrahydrofuran-2-yl)-2-oxo-l,2-dihydropyrimidin-4-yl)benzamide (1.43 g, 37.14%).

[0163] 1 H NMR (400 MHz, CDCl3) δ 8.13 - 7.81 (m, 3H), 7.62 - 7.41 (m, 5H), 7.37 (d, J = 1.9 Hz, 1H), 7.27 - 7.21 (m, 1H), 6.60 (d, J = 13.0 Hz, 1H), 4.86 (dd, J = 89.3, 12.5 Hz, 2H), 4.32 (dd, J = 18.2, 5.9 Hz, 1H), 4.18 - 4.09 (m, 1H), 4.04 - 3.86 (m, 2H), 3.01 (d, J = 5.8 Hz, 1H).

[0164] 13 C NMR (101 MHz, CDCl3) δ 166.80, 162.76, 154.91, 146.16, 134.35, 133.54, 133.28, 132.83, 130.28, 129.18, 128.97, 127.72, 127.21, 97.13, 94.30 (d, J = 191.4 Hz), 87.36 (d, J = 19.2 Hz), 82.93 (d, J = 30.1 Hz), 82.39 (d, J = 9.6 Hz), 81.98 (d, J = 3.0 Hz), 74.60 (d, J = 30.3 Hz), 69.79, 60.74.

[0165] 19 F NMR (376 MHz, CDCl3) δ -154.64 (s).

[0166] Example 5: Preparation of N-(l-((2R,3S,4R,5R)-3-ethynyl-3-fluoro-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-2-yl)-2-oxo-l,2-dihydropyrimidin-4-yl)benzamide (the compound shown in Formula 9a)

[0167]

[0168] N-(l-((2R,3S,4R,5R)-4-((2,4-dichlorobenzyl)oxy)-3-ethynyl-3-fluoro-5- (hydroxymethyl)tetrahydrofuran-2-yl)-2-oxo-l,2-dihydropyrimidin-4-yl)benzamide (1.43 g, 2.69 mmol) was dissolved in super dry dichloromethane (30 mL) and purged with argon for 3 times. Boron tribromide (2.59 mL, 26.86 mmol) was added dropwise slowly under ice bath condition, then the reaction bottle was stirred at room temperature for 2.5 h until the reaction was completed by TLC monitoring. The reaction was quenched by adding methanol slowly dropwise under ice bath condition, and the solvent was removed by reduced pressure concentration. The obtained crude product was purified by silica gel column chromatography (dichloromethane / methanol = 20 / 1) to obtain white solid product N-(l-((2R,3S,4R,5R)-3-ethynyl-3-fluoro-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-2-yl)-2-oxo-l,2-dihydropyrimidin-4-yl)benzamide (0.43 g, 42.88%).

[0169] 1 H NMR (400 MHz, DMSO) δ 8.26 (d, J = 6.7 Hz, 1H), 8.01 (d, J = 7.3 Hz, 2H), 7.68 - 7.63 (m, 1H), 7.58 - 7.51 (m, 2H), 7.40 (d, J = 6.5 Hz, 1H), 6.45 - 6.37 (m, 1H), 4.25 (dd, J = 18.7, 5.7 Hz, 1H), 4.17 (d, J = 5.9 Hz, 1H), 3.96 - 3.88 (m, 1H), 3.78 - 3.64 (m, 2H).

[0170] 13 C NMR (101 MHz, DMSO) δ 167.86, 163.85, 154.78, 146.39, 133.36, 128.97, 128.92, 96.79, 95.96 (d, J = 188.7 Hz), 86.64 (d, J = 19.2 Hz), 84.77 (d, J = 9.2 Hz), 83.87 (d, J = 3.1 Hz), 76.17 (d, J = 30.4 Hz), 75.05 (d, J = 29.3 Hz), 60.02.

[0171] 19 F NMR (376 MHz, DMSO) δ -157.18 (s).

[0172] Example 6: Preparation of N-(l-((2R,3S,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-5-(((tert-butyldimethylsilyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)-2-oxo-l,2-dihydropyrimidin-4-yl)benzamide (the compound shown in Formula 12a)

[0173]

[0174] Compound N-(l-((2R,3S,4R,5R)-3-ethynyl-3-fluoro-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-2-yl)-2-oxo-l,2-dihydropyrimidin-4-yl)benzamide (5.60 g, 15.00 mmol) and imidazole (4.08 g, 60.00 mmol) were dissolved in N,N-dimethylformamide (110.00 mL), purged with argon for 3 times, then a solution of tert-butyldimethylsilyl chloride (TBSCl, 9.04 g, 60.00 mmol) in N,N-dimethylformamide (10.00 mL) was added dropwise slowly under ice bath condition, then moved to room temperature for stirring. TLC monitoring showed that the reaction was completed in 48 h, and the solvent was removed by concentration under reduced pressure. The obtained crude product was purified by silica gel column chromatography (dichloromethane / methanol = 60 / 1) to obtain the product N-(l-((2R,3S,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-5-(((tert-butyldimethylsilyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)-2-oxo-l,2-dihydropyrimidin-4-yl)benzamide (7.16 g, 79.31%) as a white solid.

[0175] 1 H NMR (400 MHz, CDC13) δ 8.04 (d, J = 7.1 Hz, 1H), 7.92 (d, J = 7.3 Hz, 2H), 7.63 - 7.57 (m, 1H), 7.56 - 7.45 (m, 3H), 6.58 (d, J = 11.8 Hz, 1H), 4.42 (dd, J = 17.7, 5.3 Hz, 1H), 4.00 - 3.94 (m, 1H), 3.94 - 3.79 (m, 2H), 2.92 (d, J = 5.8 Hz, 1H), 0.97 - 0.91 (m, 18H), 0.17 - 0.11 (m, 12H).

[0176] 13C NMR (101 MHz, CDC13) δ 162.30, 145.64, 133.16 (d, J = 25.7 Hz), 129.05, 127.72, 96.62, 95.20 (d, J = 191.5 Hz), 87.06 (d, J = 19.1 Hz), 83.84 (d, J = 3.8 Hz), 81.82 (d, J = 9.6 Hz), 75.95 (d, J = 30.0 Hz), 75.32 (d, J = 30.5 Hz), 60.97, 25.90, 25.67, 18.40, 18.01, -4.37, -4.92, -5.38, -5.42.

[0177] 19 F NMR (376 MHz, CDC13) δ -157.46 (s).

[0178] Example 9: Preparation of N-(l-((2R,3S,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-3- ethynyl-3-fluoro-5-(hydroxymethyl)tetrahydrofuran-2-yl)-2-oxo-l,2-dihydropyrimidin-4- yl)benzamide (the compound shown in Formula 13a)

[0179]

[0180] The compound N-(l-((2R,3S,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-5-(((tert- butyldimethylsilyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)-2-oxo-l,2- dihydropyrimidin-4-yl)benzamide (7.16 g, 11.90 mmol) was dissolved in a mixed solvent of tetrahydrofuran (96 mL) and water (24 mL), and trichloroacetic acid (54.42 g, 333.10 mmol) was slowly added at 0 °C. The reaction was stirred slowly while the temperature was increased to 10 °C, and thin layer chromatography was used to monitor the reaction for 9 h until it was complete. The reaction was diluted with dichloromethane, washed with water 3 times, washed with a saturated sodium bicarbonate solution 1 time, washed with saturated brine 1 time, and the solvent was removed under reduced pressure. The obtained crude product was purified by silica gel column chromatography (dichloromethane / methanol = 40 / 1) to obtain the product N-(l-((2R,3S,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-3-ethynyl-3-fluoro-5- (hydroxymethyl)tetrahydrofuran-2-yl)-2-oxo-l,2-dihydropyrimidin-4-yl)benzamide (4.76 g, 82.06%) as a white solid.

[0181] Example 10: Preparation of 4-amino-l-((2R,3S,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-3- ethynyl-3-fluoro-5-(hydroxymethyl)tetrahydrofuran-2-yl)pyrimidin-2(lH)-one (the compound shown in Formula 14a)

[0182]

[0183] The compound N-(l-((2R,3S,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-3-ethynyl-3- fluoro-5-(hydroxymethyl)tetrahydrofuran-2-yl)-2-oxo-l,2-dihydropyrimidin-4-yl)benzamide (4.76 g, 9.76 mmol) was dissolved with ammonia in methanol (7.0 M, 60 mL) and stirred at 40 °C in an oil bath. TLC was used to monitor the reaction for 3 h until it was complete. The solvent was removed by concentration under reduced pressure. The resulting crude product was purified by silica gel column chromatography (dichloromethane / methanol = 25 / 1) to obtain the product 4-amino-l-((2R,3S,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-3-ethynyl-3-fluoro-5- (hydroxymethyl)tetrahydrofuran-2-yl)pyrimidin-2(lH)-one (2.96 g, 79.07%) as a white solid.

[0184] 1 H NMR (400 MHz, DMSO) δ 7.61 (dd, J = 7.5, 2.3 Hz, 1H), 6.33 (d, J = 14.8 Hz, 1H), 5.78 (d, J = 7.6 Hz, 1H), 4.36 (dd, J = 17.9, 4.9 Hz, 1H), 4.18 (d, J = 5.9 Hz, 1H), 3.86 - 3.72 (m, 1H), 3.72 - 3.51 (m, 2H), 0.92 (s, 9H), 0.15 (s, 3H), 0.14 (s, 3H).

[0185] 13 C NMR (101 MHz, DMSO) δ 165.99, 155.12, 142.24 (d, J = 5.0 Hz), 95.90 (d, J = 187.6 Hz), 94.74, 86.05 (d, J = 18.7 Hz), 84.67 (d, J = 9.4 Hz), 83.87 (d, J = 2.9 Hz), 76.76 (d), 76.31 (d, J = 30.5 Hz), 59.97, 26.03, 18.18, -4.19, -4.46.

[0186] 19 F NMR (376 MHz, DMSO) δ -157.59 (s).

[0187] Example 11: Preparation of isopropyl ((S)-(((2R,3R,4S,5R)-5-(4-amino-2-oxo- pyrimidin-1 (2H)-yl)-3-((tert-butyldimethylsilyl)oxy)-4-ethynyl-4-fluorotetrahydrofuran- 2-yl)methoxy)(phenoxy)phosphoryl)-L-leucinate (compound shown in Formula 19a-1)

[0188]

[0189] Compound 4-amino-1-((2R,3S,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-3-ethynyl-3- fluoro-5-(hydroxymethyl)tetrahydrofuran-2-yl)pyrimidin-2(1 H)-one (100 mg, 260.76 μmol) was dissolved in super dry tetrahydrofuran (1.5 mL) and purged with argon 3 times. A solution of tert-butyllmagnesium chloride in tetrahydrofuran (1.0 M, 651.90 μL, 312.91 μmol) was added slowly dropwise under ice bath condition and the reaction was stirred at room temperature for 0.5 h. Then a solution of isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate (synthesis reference: J. Org. Chem. 201 1, 76, 831 1 -831 9) (155.01 mg, 312.91 μmol) in tetrahydrofuran (1 mL) was added slowly dropwise under ice bath condition and then the reaction was stirred at room temperature. The reaction was monitored by TLC for 12 h and quenched by dropwise addition of saturated ammonium chloride solution. The reaction mixture was diluted with ethyl acetate and washed with water once and saturated sodium chloride solution once and dried over anhydrous sodium sulfate. The crude product obtained after concentration under reduced pressure was purified by silica gel column chromatography (dichloromethane / methanol = 18 / 1 ) to give the product isopropyl ((S)-(((2R,3R,4S,5R)-5-(4-amino-2-oxopyrimidin-1 (2H)-yl)-3-((tert- butyldimethylsilyl)oxy)-4-ethynyl-4-fluorotetrahydrofuran-2-yl)methoxy)(phenoxy)phosphoryl)-L-leucinate (146.21 mg, 80.70%) as a white solid.

[0190] 1H NMR (400 MHz, MeOD) δ 7.62 - 7.54 (m, 1H), 7.38 - 7.28 (m, 2H), 7.26 - 7.14 (m, 3H), 6.47 (d, J = 16.7 Hz, 1H), 5.82 (d, J = 7.6 Hz, 1H), 4.96 - 4.88 (m, 1H), 4.39 - 4.32 (m, 1H), 4.32 - 4.18 (m, 2H), 4.10 - 4.01 (m, 1H), 3.84 - 3.73 (m, 1H), 3.57 - 3.49 (m, 1H), 1.76 - 1.64 (m, 1H), 1.53 - 1.45 (m, 2H), 1.20 - 1.15 (m, 6H), 0.91 (s, 9H), 0.89 - 0.83 (m, 7H), 0.14 (d, J = 9.9 Hz, 6H).

[0191] 13 C NMR (101 MHz, MeOD) δ 173.04 (d, J = 3.1 Hz), 166.12, 156.38, 150.83 (d, J = 6.7 Hz), 142.28 (d, J = 5.9 Hz), 129.51, 124.82, 119.87, 119.82, 95.16 (d, J = 187.6 Hz), 94.87, 86.68 (d, J = 18.1 Hz), 82.75 (d, J = 9.9 Hz), 82.64 (d, J = 10.9 Hz), 76.91 (d, J = 32.1 Hz), 74.75 (d, J = 29.4 Hz), 68.66, 64.72, 53.24, 42.76 (d, J = 7.0 Hz), 24.92, 24.24, 21.84, 20.80, 20.74, 20.61, 17.49, -5.55, -5.89.

[0192] 19 F NMR (376 MHz, MeOD) δ -159.41 (s).

[0193] 31 P NMR (162 MHz, MeOD) δ 3.87 (s).

[0194] Example 12: Preparation of isopropyl ((S)-(((2R,3R,4S,5R)-5-(4-amino-2-oxo- pyrimidin-1 (2H)-yl)-4-ethynyl-4-fluoro-3-hydroxytetrahydrofuran-2-yl)methoxy)(phenoxy) phosphoryl)-L-leucinate (the compound shown in Formula I-1)

[0195]

[0196] Compound isopropyl ((S)-(((2R,3R,4S,5R)-5-(4-amino-2-oxo- pyrimidin-1 (2H)-yl)-3-((tert-butyldimethylsilyl)oxy)-4-ethynyl-4-fluorotetrahydrofuran- 2-yl)methoxy)(phenoxy)phosphoryl)-L-leucinate (120 mg, 172.71 μmol) was dissolved in methanol (1.5 mL). Hydrogen chloride solution (6 M, 300.00 μL) was added slowly dropwise under ice bath condition, and the reaction was stirred at room temperature for 10 h after the addition was completed. The solvent was removed by concentration under reduced pressure, and the obtained crude product was purified by silica gel column chromatography (dichloromethane / methanol = 12 / 1) to obtain the product isopropyl ((S)-(((2R,3R,4S,5R)-5-(4-amino-2-oxopyrimidin-1 (2H)-yl)-4-ethynyl-4-fluoro-3- hydroxytetrahydrofuran-2-yl)methoxy)(phenoxy)phosphoryl)-L-leucinate (32.06 mg, 31.98%) as a white solid.

[0197] 1 H NMR (400 MHz, MeOD) δ 7.57 (dd, J = 7.6, 2.8 Hz, 1H), 7.40 - 7.31 (m, 2H), 7.28 - 7.16 (m, 3H), 6.47 (d, 1H), 5.83 (d, J = 7.6 Hz, 1H), 5.00 - 4.92 (m, 1H), 4.38 - 4.25 (m, 2H), 4.21 (dd, J = 17.6, 4.3 Hz, 1H), 4.12 - 4.05 (m, 1H), 3.83 (dd, J = 16.7, 7.5 Hz, 1H), 3.51 (d, J = 5.9 Hz, 1H), 1.79 - 1.67 (m, 1H), 1.57 - 1.47 (m, 2H), 1.27 - 1.16 (m, 6H), 0.96 - 0.81 (m, 6H).

[0198] 13C NMR (101 MHz, MeOD) δ 173.13 (d, J = 3.1 Hz), 166.11, 156.41, 150.82 (d, J = 6.8 Hz), 142.46 (d, J = 6.1 Hz), 129.44, 124.78, 119.95 (d, J = 4.7 Hz), 95.33 (d, J = 187.4 Hz), 94.66, 86.51 (d, J = 18.4 Hz), 82.30 (d, J = 9.4 Hz), 81.90 (d, J = 7.6 Hz), 75.81 (d, J = 31.4 Hz), 74.18 (d, J = 29.8 Hz), 68.65, 65.17 (d, J = 5.0 Hz), 53.22, 42.72 (d, J = 7.4 Hz), 24.21, 21.76, 20.59 (d, J = 12.2 Hz).

[0199] 19 F NMR (376 MHz, MeOD) δ -159.65 (s).

[0200] 31 P NMR (162 MHz, MeOD) δ 4.00 (s).

[0201] Using the synthesis method of compound 19a-1 and compound I-1, respectively, 19a-2 and I-2 can be prepared by replacing "isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate" with "isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-D-leucinate".

[0202]

[0203]

[0204] 1 H NMR (400 MHz, MeOD) δ 7.68 - 7.58 (m, 1H), 7.39 - 7.32 (m, 2H), 7.26 - 7.17 (m, 3H), 6.49 (d, J = 15.4 Hz, 1H), 5.93 (d, J = 7.6 Hz, 1H), 5.00 - 4.93 (m, 1H), 4.43 - 4.32 (m, 2H), 4.32 - 4.23 (m, 1H), 4.13 - 4.05 (m, 1H), 3.91 - 3.78 (m, 1H), 3.59 (d, J = 5.9 Hz, 1H), 1.80 - 1.71 (m, 1H), 1.59 - 1.51 (m, 2H), 1.24 - 1.19 (m, 6H), 0.94 (s, 9H), 0.93 - 0.88 (m, 6H), 0.16 (d, J = 13.6 Hz, 6H). ​

[0205] 13 C NMR (101 MHz, MeOD) δ 174.43 (d, J = 2.5 Hz), 166.92, 157.07, 152.14 (d, J = 6.7 Hz), 143.68 (d, J = 5.5 Hz), 130.79, 126.14, 121.20 (d, J = 5.0 Hz), 96.57 (d, J = 188.4 Hz), 96.21, 88.09 (d, J = 18.5 Hz), 84.24 (d, J = 9.5 Hz), 83.55 (d, J = 8.5 Hz), 78.01 (d, J = 31.8 Hz), 76.15 (d, J = 29.7 Hz), 70.03, 65.77, 54.53, 44.12 (d, J = 7.3 Hz), 26.23, 25.57, 23.18, 22.08, 22.05, 21.93, 18.80, -4.19, -4.59.

[0206] 19 F NMR (376 MHz, MeOD) δ -158.41 (s).

[0207] 31 P NMR (162 MHz, MeOD) δ 3.54 (s).

[0208]

[0209] 1 H NMR (400 MHz, MeOD) δ 7.63 (dd, J = 7.6, 2.7 Hz, 1H), 7.44 - 7.33 (m, 2H), 7.33 - 7.17 (m, 3H), 6.52 (d, J = 16.4 Hz, 1H), 5.94 - 5.85 (m, 1H), 5.06 - 4.96 (m, 1H), 4.45 - 4.29 (m, 2H), 4.23 (dd, J = 17.6, 4.5 Hz, 1H), 4.18 - 4.09 (m, 1H), 3.96 - 3.83 (m, 1H), 3.54 (d, J = 5.9 Hz, 1H), 1.86 - 1.73 (m, 1H), 1.57 (td, J = 7.2, 1.3 Hz, 2H), 1.25 (d, J = 6.3 Hz, 6H), 1.02 - 0.89 (m, 6H).

[0210] 13C NMR (101 MHz, MeOD) δ 173.20 (d, J = 3.0 Hz), 166.13, 156.40, 150.85 (d, J = 7.2 Hz), 142.37 (d, J = 5.9 Hz), 129.38, 124.73, 119.89, 119.84, 95.35 (d, J = 187.6 Hz), 94.64, 86.59 (d, J = 18.3 Hz), 82.27 (d, J = 9.6 Hz), 81.72 (d, J = 6.2 Hz), 75.75 (d, J = 31.0 Hz), 74.23 (d, J = 29.9 Hz), 68.72, 65.14 (d, J = 4.4 Hz), 53.22, 42.76 (d, J = 7.4 Hz), 24.22, 21.76, 20.64, 20.62, 20.53.

[0211] 19 F NMR (376 MHz, MeOD) δ -159.37 (s).

[0212] 31 P NMR (162 MHz, MeOD) δ 3.67 (s).

[0213] Using “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-valinate” instead of “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate”, 19a-3 and I-3 were prepared, respectively:

[0214]

[0215] 1 H NMR (400 MHz, MeOD) δ 7.66 (d, J = 7.3 Hz, 1H), 7.36 - 7.31 (m, 2H), 7.27 - 7.22 (m, 2H), 7.20 - 7.16 (m, 1H), 6.49 (d, J = 15.3 Hz, 1H), 5.94 (d, J = 6.4 Hz, 1H), 5.00 - 4.94 (m, 1H), 4.46 - 4.39 (m, 1H), 4.39 - 4.33 (m, 1H), 4.33 - 4.24 (m, 1H), 4.14 - 4.07 (m, 1H), 3.69 - 3.62 (m, 1H), 3.59 (d, J = 5.9 Hz, 1H), 2.16 - 1.97 (m, 1H), 1.24 - 1.19 (m, 6H), 0.98 - 0.91 (m, 15H), 0.16 (d, J = 12.7 Hz, 6H).

[0216] 13C NMR (101 MHz, MeOD) δ 173.31 (d, J = 3.5 Hz), 165.27, 155.09, 152.09 (d, J = 6.8 Hz), 144.48 (d, J = 4.6 Hz), 130.80, 126.17, 121.25 (d, J = 4.6 Hz), 96.45 (d, J = 187.9 Hz), 96.28, 88.04 (d, J = 18.3 Hz), 84.46 (d), 84.28 (d, J = 8.0 Hz), 78.11 (d, J = 31.8 Hz), 75.85 (d, J = 29.4 Hz), 70.00, 66.05, 61.96, 33.16 (d, J = 6.5 Hz), 26.23, 22.05 (d, J = 9.3 Hz), 19.58, 18.79, 18.36, -4.40 (d, J = 35.1 Hz).

[0217] 19 F NMR (376 MHz, MeOD) δ -158.95 (s).

[0218] 31 P NMR (162 MHz, MeOD) δ 4.58 (s).

[0219]

[0220] 1 H NMR (400 MHz, MeOD) δ 7.98 - 7.86 (m, 1H), 7.42 - 7.33 (m, 2H), 7.28 - 7.18 (m, 3H), 6.39 (d, J = 16.0 Hz, 1H), 6.11 (d, J = 7.8 Hz, 1H), 5.00 - 4.96 (m, 1H), 4.46 - 4.33 (m, 2H), 4.30 (dd, J = 17.1, 3.8 Hz, 1H), 4.23 - 4.16 (m, 1H), 3.63 (d, J = 5.7 Hz, 1H), 3.63 - 3.58 (m, 1H), 2.12 - 1.95 (m, 1H), 1.26 - 1.19 (m, 6H), 0.97 - 0.90 (m, 6H).

[0221] 13C NMR (101 MHz, MeOD) δ 172.10 (d, J = 3.4 Hz), 159.78, 150.76 (d, J = 7.1 Hz), 147.00, 145.52 (d, J = 5.6 Hz), 129.49, 124.88, 120.04 (d, J = 4.7 Hz), 95.22 (d, J = 188.0 Hz), 93.81, 86.58 (d, J = 18.3 Hz), 83.09 (d, J = 9.2 Hz), 82.94 (d, J = 7.3 Hz), 75.69, 75.39, 73.61, 73.32, 68.73, 65.10, 60.70, 31.83 (d, J = 6.7 Hz), 20.69 (d, J = 7.6 Hz), 18.20, 17.03.

[0222] 19 F NMR (376 MHz, MeOD) δ -159.26 (s).

[0223] 31 P NMR (162 MHz, MeOD) δ 4.76 (s).

[0224] Using “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-D-valinate” instead of “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate”, 19a-4 and I-4 were prepared, respectively:

[0225]

[0226] 1 H NMR (400 MHz, MeOD) δ 7.51 (d, J = 7.3 Hz, 1H), 7.22 - 7.17 (m, 2H), 7.11 - 7.07 (m, 2H), 7.06 - 7.02 (m, 1H), 6.34 (d, J = 15.3 Hz, 1H), 5.80 (d, J = 6.4 Hz, 1H), 4.86 - 4.79 (m, 1H), 4.29 - 4.20 (m, 2H), 4.18 - 4.10 (m, 1H), 4.00 - 3.92 (m, 1H), 3.52 - 3.47 (m, 1H), 3.45 (d, J = 5.9 Hz, 1H), 1.97 - 1.85 (m, 1H), 1.08 - 1.04 (m, 6H), 0.82 - 0.77 (m, 15H), 0.03 (s, 3H), 0.00 (s, 3H).

[0227] 13C NMR (101 MHz, MeOD) δ 172.08 (d, J = 3.1 Hz), 165.31, 155.41, 150.78 (d, J = 7.1 Hz), 142.52, 129.44, 124.83, 119.98 (d, J = 4.9 Hz), 95.24 (d, J = 188.5 Hz), 94.93, 86.79 (d, J = 18.3 Hz), 82.98 (d, J = 9.3 Hz), 82.30 (d, J = 5.9 Hz), 76.67 (d, J = 31.7 Hz), 74.81 (d, J = 29.6 Hz), 68.73, 64.56, 60.52, 31.85 (d, J = 6.9 Hz), 24.92, 20.74 (d, J = 6.2 Hz), 18.29, 17.48, 16.95, -5.49, -5.90.

[0228] 19 F NMR (376 MHz, MeOD) δ -158.35 (s).

[0229] 31 P NMR (162 MHz, MeOD) δ 4.30 (s).

[0230]

[0231] 1 H NMR (400 MHz, MeOD) δ 7.61 (dd, J = 7.6, 2.7 Hz, 1H), 7.38 - 7.28 (m, 2H), 7.28 - 7.20 (m, 2H), 7.20 - 7.12 (m, 1H), 6.48 (d, J = 16.4 Hz, 1H), 5.86 (d, J = 7.6 Hz, 1H), 5.03 - 4.90 (m, 1H), 4.43 - 4.26 (m, 2H), 4.22 (dd, J = 17.6, 4.5 Hz, 1H), 4.15 - 4.07 (m, 1H), 3.68 - 3.59 (m, 1H), 3.50 (d, J = 5.9 Hz, 1H), 2.11 - 1.97 (m, 1H), 1.26 - 1.15 (m, 6H), 1.02 - 0.87 (m, 6H).

[0232] 13C NMR (101 MHz, MeOD) δ 172.16 (d, J = 3.5 Hz), 165.95, 156.18, 150.82 (d, J = 7.0 Hz), 142.47 (d, J = 6.0 Hz), 129.38, 124.75, 119.97 (d, J = 5.0 Hz), 95.36 (d, J = 187.6 Hz), 94.69, 86.60 (d, J = 18.4 Hz), 82.34 (d, J = 9.5 Hz), 81.78 (d, J = 7.5 Hz), 75.75 (d, J = 31.0 Hz), 74.24 (d, J = 29.8 Hz), 68.74, 65.23 (d, J = 4.8 Hz), 60.56, 31.85 (d, J = 6.7 Hz), 20.67 (d, J = 4.3 Hz), 18.20, 16.92.

[0233] 19 F NMR (376 MHz, MeOD) δ -159.32 (s).

[0234] 31 P NMR (162 MHz, MeOD) δ 4.41 (s).

[0235] Using "2-ethylbutyl ((R)-(perfluorophenoxy)phosphoryl)-L-alaninate" instead of "isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate", 19a-5 and I-5 were prepared, respectively:

[0236]

[0237] 1 H NMR (400 MHz, MeOD) δ 7.64 (dd, J = 7.6, 2.7 Hz, 1H), 7.46 - 7.38 (m, 2H), 7.34 - 7.22 (m, 3H), 6.55 (d, J = 16.6 Hz, 1H), 5.90 (d, J = 7.6 Hz, 1H), 4.47 - 4.40 (m, 1H), 4.40 - 4.28 (m, 2H), 4.15 - 3.96 (m, 4H), 3.59 (d, J = 6.0 Hz, 1H), 1.58 - 1.51 (m, 1H), 1.44 - 1.38 (m, 7H), 1.01 - 0.97 (m, 9H), 0.94 (t, J = 7.5 Hz, 6H), 0.23 (d, J = 3.1 Hz, 3H), 0.20 (d, J = 2.9 Hz, 3H).

[0238] 13C NMR (101 MHz, MeOD) δ 173.51 (d, J = 4.9 Hz), 166.15, 156.37, 150.78 (d, J = 6.9 Hz), 142.21 (d, J = 5.9 Hz), 129.52, 124.90, 119.97 (d, J = 4.9 Hz), 95.18 (d, J = 187.6 Hz), 94.87, 86.73 (d, J = 18.2 Hz), 82.73 (d, J = 9.7 Hz), 82.64 (d, J = 9.3 Hz), 76.98 (d, J = 31.9 Hz), 74.80 (d, J = 29.4 Hz), 66.87, 64.73, 50.26, 40.36, 24.95, 22.93 (d, J = 3.1 Hz), 19.28 (d, J = 6.6 Hz), 17.50, 10.08 (d, J = 4.8 Hz), -5.51, -5.87.

[0239] 19 F NMR (376 MHz, MeOD) δ -159.31 (s).

[0240] 31 P NMR (162 MHz, MeOD) δ 3.61 (s).

[0241]

[0242] 1 H NMR (400 MHz, MeOD) δ 7.59 (dd, J = 7.6, 2.8 Hz, 1H), 7.42 - 7.37 (m, 2H), 7.29 - 7.21 (m, 3H), 6.49 (d, J = 16.9 Hz, 1H), 5.86 (d, J = 7.6 Hz, 1H), 4.39 - 4.30 (m, 2H), 4.24 (dd, J = 17.7, 4.4 Hz, 1H), 4.14 - 4.10 (m, 1H), 4.10 - 4.02 (m, 2H), 4.02 - 3.94 (m, 1H), 3.51 (d, J = 5.9 Hz, 1H), 1.56 - 1.49 (m, 1H), 1.41 - 1.36 (m, 7H), 0.94 - 0.88 (m, 6H).

[0243] 13C NMR (101 MHz, MeOD) δ 173.66 (d, J = 4.9 Hz), 166.08, 156.33, 150.75 (d, J = 6.9 Hz), 142.43 (d, J = 6.1 Hz), 129.46, 124.86, 120.03 (d, J = 4.6 Hz), 95.31 (d, J = 187.4 Hz), 94.67, 86.53 (d, J = 18.4 Hz), 82.31 - 81.70 (m), 75.85 (d, J = 31.3 Hz), 74.15 (d, J = 29.7 Hz), 66.83, 65.18 (d, J = 4.9 Hz), 50.24, 40.34, 22.87, 22.85, 19.16 (d, J = 6.6 Hz), 9.97, 9.94.

[0244] 19 F NMR (376 MHz, MeOD) δ -159.62 (s).

[0245] 31 P NMR (162 MHz, MeOD) δ 3.71 (s).

[0246] Using "isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-methioninate" instead of "isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate", 19a-6 and I-6 were prepared, respectively:

[0247]

[0248] 1 H NMR (400 MHz, MeOD) δ 7.63 (dd, J = 7.6, 2.6 Hz, 1H), 7.42 - 7.36 (m, 2H), 7.34 - 7.28 (m, 2H), 7.25 - 7.19 (m, 1H), 6.53 (d, J = 15.2 Hz, 1H), 5.96 (d, J = 7.6 Hz, 1H), 5.08 - 4.96 (m, 1H), 4.50 - 4.41 (m, 1H), 4.36 (dd, J = 17.9, 4.7 Hz, 1H), 4.33 - 4.25 (m, 1H), 4.14 - 4.09 (m, 1H), 4.09 - 4.04 (m, 1H), 3.60 (d, J = 5.9 Hz, 1H), 2.59 (t, J = 7.1 Hz, 2H), 2.15 - 2.00 (m, 4H), 2.00 - 1.85 (m, 1H), 1.28 - 1.20 (m, 6H), 0.96 (s, 9H), 0.19 (s, 3H), 0.15 (s, 3H).

[0249] 13C NMR (101 MHz, MeOD) δ 172.41 (d, J = 3.6 Hz), 166.14, 156.33, 150.81 (d, J = 6.7 Hz), 142.08 (d, J = 5.4 Hz), 129.52, 124.91, 119.98 (d, J = 4.7 Hz), 95.31 (d, J = 188.5 Hz), 94.97, 86.74 (d, J = 18.7 Hz), 82.90 (d, J = 9.5 Hz), 81.95 (d, J = 2.9 Hz), 81.86 (d, J = 2.9 Hz), 76.64 (d, J = 31.8 Hz), 74.95 (d, J = 29.9 Hz), 69.02, 64.26 (d, J = 2.7 Hz), 53.31, 32.82 (d, J = 6.6 Hz), 29.63, 24.92 (d, J = 4.2 Hz), 20.73 (d, J = 2.6 Hz), 17.49, 13.88, -5.45, -5.87.

[0250] 19 F NMR (376 MHz, MeOD) δ -158.01 (s).

[0251] 31 P NMR (162 MHz, MeOD) δ 3.44 (s).

[0252]

[0253] 1 H NMR (400 MHz, MeOD) δ 7.63 (d, J = 7.5 Hz, 1H), 7.40 - 7.31 (m, 2H), 7.31 - 7.22 (m, 2H), 7.22 - 7.13 (m, 1H), 6.47 (d, J = 16.3 Hz, 1H), 5.90 (d, J = 7.6 Hz, 1H), 5.03 - 4.95 (m, 1H), 4.43 - 4.25 (m, 2H), 4.20 (dd, J = 17.7, 4.2 Hz, 1H), 4.14 - 4.07 (m, 1H), 4.07 - 3.96 (m, 1H), 3.51 (d, J = 5.7 Hz, 1H), 2.54 (t, J = 7.1 Hz, 2H), 2.11 - 1.94 (m, 4H), 1.95 - 1.80 (m, 1H), 1.28 - 1.17 (m, 6H).

[0254] 13C NMR (101 MHz, MeOD) δ 172.41 (d, J = 3.6 Hz), 165.69, 155.88, 150.82 (d, J = 6.8 Hz), 142.61 (d, J = 6.0 Hz), 129.42, 124.80, 119.93 (d, J = 5.0 Hz), 95.36 (d, J = 187.7 Hz), 94.75, 86.56 (d, J = 18.4 Hz), 82.37 (d, J = 9.5 Hz), 81.75 (d, J = 7.6 Hz), 75.68 (d, J = 31.0 Hz), 74.20 (d, J = 29.9 Hz), 69.01, 65.09, 53.40, 32.82 (d, J = 6.7 Hz), 29.55, 20.61, 13.76.

[0255] 19 F NMR (376 MHz, MeOD) δ -159.21 (s).

[0256] 31 P NMR (162 MHz, MeOD) δ 3.63 (s).

[0257] Using “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-D-methioninate” instead of “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate”, 19a-7 and I-7 were prepared, respectively:

[0258]

[0259] 1 H NMR (400 MHz, MeOD) δ 7.64 (dd, J = 7.6, 2.6 Hz, 1H), 7.43 – 7.37 (m, 2H), 7.35 – 7.28 (m, 2H), 7.27 – 7.20 (m, 1H), 6.56 (d, J = 16.8 Hz, 1H), 5.92 (d, J = 7.6 Hz, 1H), 5.07 – 4.98 (m, 1H), 4.45 – 4.37 (m, 2H), 4.37 – 4.29 (m, 1H), 4.16 – 4.10 (m, 1H), 4.09 – 4.01 (m, 1H), 3.58 (d, J = 5.9 Hz, 1H), 2.67 – 2.41 (m, 2H), 2.05 (s, 4H), 2.00 – 1.85 (m, 1H), 1.26 (d, J = 6.2 Hz, 6H), 0.98 (s, 9H), 0.22 (s, 3H), 0.19 (s, 3H).

[0260] 13C NMR (101 MHz, MeOD) δ 172.28 (d, J = 3.9 Hz), 166.14, 156.38, 150.82 (d, J = 6.8 Hz), 142.28 (d, J = 6.1 Hz), 129.55, 124.89, 119.95 (t, J = 6.0 Hz), 95.18 (d, J = 187.5 Hz), 94.94, 86.69 (d, J = 18.2 Hz), 82.71 (t, J = 8.3 Hz), 76.95 (d, J = 31.9 Hz), 74.78 (d, J = 29.3 Hz), 68.99, 64.85, 53.54, 32.86 (d, J = 6.5 Hz), 29.61, 24.97, 20.75 (d, J = 7.0 Hz), 17.51, 13.91, -5.48, -5.80.

[0261] 19 F NMR (376 MHz, MeOD) δ -159.35 (s).

[0262] 31 P NMR (162 MHz, MeOD) δ 3.81 (s).

[0263]

[0264] 1 H NMR (400 MHz, MeOD) δ 7.59 (dd, J = 7.6, 2.8 Hz, 1H), 7.44 - 7.35 (m, 2H), 7.33 - 7.26 (m, 2H), 7.25 - 7.19 (m, 1H), 6.50 (d, J = 17.0 Hz, 1H), 5.87 (d, J = 7.6 Hz, 1H), 5.04 - 4.96 (m, 1H), 4.43 - 4.30 (m, 2H), 4.25 (dd, J = 17.6, 4.3 Hz, 1H), 4.16 - 4.09 (m, 1H), 4.07 - 3.96 (m, 1H), 3.52 (d, J = 5.9 Hz, 1H), 2.59 - 2.47 (m, 2H), 2.09 - 1.85 (m, 5H), 1.29 - 1.20 (m, 6H).

[0265] 13C NMR (101 MHz, MeOD) δ 172.36 (d, J = 4.1 Hz), 166.15, 156.43, 150.79 (d, J = 7.1 Hz), 142.47 (d, J = 6.2 Hz), 129.48, 124.85, 119.98 (d, J = 5.0 Hz), 95.34 (d, J = 187.4 Hz), 94.75, 86.52 (d, J = 18.4 Hz), 82.34 (d, J = 9.3 Hz), 81.90 (d, J = 7.3 Hz), 76.01, 75.70, 74.34, 74.05, 69.03, 65.31 (d, J = 4.5 Hz), 53.57, 32.88 (d, J = 6.7 Hz), 29.54, 20.67, 20.61, 13.81.

[0266] 19 F NMR (376 MHz, MeOD) δ -159.54 (s).

[0267] 31 P NMR (162 MHz, MeOD) δ 3.92 (s).

[0268] Using "isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-phenylalaninate" instead of "isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate", 19a-8 and I-8 were prepared, respectively:

[0269]

[0270] 1 H NMR (400 MHz, MeOD) δ 7.58 (dd, J = 7.6, 2.4 Hz, 1H), 7.37 - 7.31 (m, 2H), 7.30 - 7.25 (m, 2H), 7.25 - 7.14 (m, 6H), 6.53 (d, J = 17.0 Hz, 1H), 5.92 - 5.85 (m, 1H), 4.95 - 4.89 (m, 1H), 4.32 (dd, J = 16.4, 3.2 Hz, 1H), 4.17 - 3.97 (m, 4H), 3.55 (d, J = 5.9 Hz, 1H), 3.13 - 2.87 (m, 2H), 1.19 (d, J = 6.2 Hz, 3H), 1.10 (d, J = 6.2 Hz, 3H), 0.95 (s, 9H), 0.19 (s, 3H), 0.15 (s, 3H).

[0271] 13C NMR (101 MHz, MeOD) δ 172.02 (d, J = 3.8 Hz), 166.14, 156.38, 150.68 (d, J = 7.1 Hz), 142.26 (d, J = 6.1 Hz), 136.76, 129.48, 129.25, 128.19, 126.59, 124.84, 119.97 (d, J = 5.0 Hz), 95.13 (d, J = 187.4 Hz), 94.89, 86.64 (d, J = 18.0 Hz), 82.74 (d, J = 9.7 Hz), 82.65 (d, J = 8.2 Hz), 76.94 (d, J = 32.0 Hz), 74.73 (d, J = 29.3 Hz), 68.84, 64.55, 56.48, 39.78 (d, J = 7.2 Hz), 24.95, 20.75, 20.56, 17.49, -5.51, -5.84.

[0272] 19 F NMR (376 MHz, MeOD) δ -159.48 (s).

[0273] 31 P NMR (162 MHz, MeOD) δ 3.64 (s).

[0274]

[0275] 1 H NMR (400 MHz, MeOD) δ 7.52 (dd, J = 7.6, 2.8 Hz, 1H), 7.34 - 7.11 (m, 10H), 6.46 (d, J = 17.2 Hz, 1H), 5.81 (d, J = 7.6 Hz, 1H), 4.93 - 4.88 (m, 1H), 4.15 (dd, J = 17.6, 3.8 Hz, 1H), 4.12 - 3.95 (m, 4H), 3.49 (d, J = 5.9 Hz, 1H), 3.11 - 2.83 (m, 2H), 1.18 (d, J = 6.3 Hz, 3H), 1.10 (d, J = 6.3 Hz, 3H).

[0276] 13C NMR (101 MHz, MeOD) δ 172.10 (d, J = 3.6 Hz), 166.12, 156.41, 150.68 (d, J = 7.2 Hz), 142.42 (d, J = 6.3 Hz), 136.77, 129.32 (d, J = 16.5 Hz), 128.18, 126.57, 124.78, 120.04 (d, J = 4.5 Hz), 95.32 (d, J = 187.3 Hz), 94.67, 86.45 (d, J = 18.3 Hz), 82.30 (d, J = 9.4 Hz), 81.88 (d, J = 7.6 Hz), 75.83 (d, J = 31.3 Hz), 74.17 (d, J = 29.5 Hz), 68.86, 64.99 (d, J = 4.1 Hz), 56.46, 39.70 (d, J = 7.1 Hz), 20.65, 20.48.

[0277] 19 F NMR (376 MHz, MeOD) δ -159.68 (s).

[0278] 31 P NMR (162 MHz, MeOD) δ 3.75 (s).

[0279] Using "isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-D-phenylalaninate" instead of "isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate", 19a-9 and I-9 were prepared, respectively:

[0280]

[0281] 1 H NMR (400 MHz, MeOD) δ 7.56 (dd, J = 7.6, 2.2 Hz, 1H), 7.34 - 7.12 (m, 10H), 6.51 (d, J = 15.7 Hz, 1H), 5.88 (d, J = 7.6 Hz, 1H), 4.97 - 4.89 (m, 1H), 4.28 (dd, J = 17.1, 3.6 Hz, 1H), 4.16 - 3.97 (m, 4H), 3.57 (d, J = 5.9 Hz, 1H), 3.15 - 2.87 (m, 2H), 1.19 (d, J = 6.2 Hz, 3H), 1.12 (d, J = 6.2 Hz, 3H), 0.95 (s, 9H), 0.18 (s, 3H), 0.14 (s, 3H).

[0282] 13C NMR (101 MHz, MeOD) δ 172.08 (d, J = 3.4 Hz), 166.13, 156.36, 150.67 (d, J = 6.8 Hz), 142.05 (d, J = 5.5 Hz), 136.79, 129.37 (d, J = 13.8 Hz), 128.20, 126.61, 124.81, 119.98 (d, J = 4.6 Hz), 95.19 (d, J = 188.2 Hz), 94.86, 86.69 (d, J = 18.4 Hz), 82.81 (d, J = 9.5 Hz), 82.14 (dd, J = 8.5, 2.1 Hz), 76.67 (d, J = 31.8 Hz), 74.84 (d, J = 29.7 Hz), 68.90, 64.15 (d, J = 2.3 Hz), 56.42, 39.78 (d, J = 7.2 Hz), 24.93, 20.65 (d, J = 17.5 Hz), 17.48, -5.48, -5.85.

[0283] 19 F NMR (376 MHz, MeOD) δ -158.81 (s).

[0284] 31 P NMR (162 MHz, MeOD) δ 3.31 (s).

[0285]

[0286] 1 H NMR (400 MHz, MeOD) δ 7.69 (dd, J = 7.7, 2.3 Hz, 1H), 7.33 - 7.21 (m, 7H), 7.19 - 7.08 (m, 3H), 6.43 (d, J = 16.4 Hz, 1H), 5.98 (d, J = 7.5 Hz, 1H), 4.94 - 4.91 (m, 1H), 4.17 - 3.98 (m, 5H), 3.56 (d, J = 5.9 Hz, 1H), 3.11 - 2.84 (m, 2H), 1.19 (d, J = 6.2 Hz, 3H), 1.12 (d, J = 6.2 Hz, 3H).

[0287] 13C NMR (101 MHz, MeOD) δ 172.16 (d, J = 3.3 Hz), 163.58, 153.26, 150.65 (d, J = 7.2 Hz), 143.55 (d, J = 5.3 Hz), 136.79, 129.40, 129.29, 128.21, 126.64, 124.79, 120.00 (d, J = 4.8 Hz), 95.22 (d, J = 187.7 Hz), 94.77, 86.56 (d, J = 18.3 Hz), 82.68 (d, J = 9.4 Hz), 82.26 (d, J = 7.5 Hz), 75.58 (d, J = 31.0 Hz), 73.91 (d, J = 29.6 Hz), 68.97, 64.88 (d, J = 2.5 Hz), 56.48, 39.68 (d, J = 7.1 Hz), 20.68, 20.52.

[0288] 19 F NMR (376 MHz, MeOD) δ -159.41 (s).

[0289] 31 P NMR (162 MHz, MeOD) δ 3.59 (s).

[0290] Using “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-tryptophan ester” instead of “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucine ester”, 19a-10 and I-10 were prepared, respectively:

[0291]

[0292] 1 H NMR (400 MHz, MeOD) δ 7.53 (dd, J = 7.6, 3.2 Hz, 2H), 7.35 - 7.27 (m, 3H), 7.19 - 7.14 (m, 1H), 7.12 - 7.07 (m, 4H), 7.04 - 6.99 (m, 1H), 6.47 (d, J = 16.7 Hz, 1H), 5.81 (d, J = 7.6 Hz, 1H), 4.93 - 4.89 (m, 1H), 4.27 (dd, J = 16.6, 3.6 Hz, 1H), 4.21 - 4.14 (m, 1H), 4.11 - 3.98 (m, 2H), 3.97 - 3.92 (m, 1H), 3.53 (d, J = 5.9 Hz, 1H), 3.27 - 3.05 (m, 2H), 1.15 (d, J = 6.2 Hz, 3H), 1.04 (d, J = 6.3 Hz, 3H), 0.93 (s, 9H), 0.15 (s, 3H), 0.11 (s, 3H).

[0293] 13 C NMR (101 MHz, MeOD) δ 172.64 (d, J = 4.1 Hz), 166.11, 156.40, 150.67 (d, J = 6.7 Hz), 142.24 (d, J = 5.7 Hz), 136.65, 129.39, 127.36, 124.74, 123.46, 121.10, 119.85 (d, J = 4.7 Hz), 118.49, 117.90, 111.03, 109.30, 95.08 (d, J = 187.7 Hz), 94.81, 86.63 (d, J = 18.2 Hz), 82.57 (t, J = 8.3 Hz), 76.85 (d, J = 31.8 Hz), 74.74 (d, J = 29.2 Hz), 68.75, 64.41, 55.84, 29.87 (d, J = 7.0 Hz), 24.87, 20.67, 20.39, 17.44, -5.62, -5.93.

[0294] 19 F NMR (376 MHz, MeOD) δ -159.49 (s).

[0295] 31 P NMR (162 MHz, MeOD) δ 3.64 (s).

[0296]

[0297] 1 H NMR (400 MHz, MeOD) δ 7.55 - 7.44 (m, 2H), 7.34 - 7.25 (m, 3H), 7.18 - 7.04 (m, 5H), 7.04 - 6.96 (m, 1H), 6.42 (d, J = 16.9 Hz, 1H), 5.75 (d, J = 7.6 Hz, 1H), 4.88 - 4.87 (m, 1H), 4.19 - 3.92 (m, 5H), 3.48 (d, J = 5.9 Hz, 1H), 3.25 - 3.03 (m, 2H), 1.14 (d, J = 6.3 Hz, 3H), 1.03 (d, J = 6.3 Hz, 3H).

[0298] 13C NMR (101 MHz, MeOD) δ 172.69 (d, J = 4.1 Hz), 166.10, 156.40, 150.67 (d, J = 6.8 Hz), 142.42 (d, J = 6.0 Hz), 136.63, 129.33, 127.34, 124.70, 123.44, 121.07, 119.96 (d, J = 4.6 Hz), 118.47, 117.87, 110.96, 109.28, 95.27 (d, J = 187.5 Hz), 94.61, 86.47 (d, J = 18.3 Hz), 82.26, 82.19 - 81.59 (m), 75.79 (d, J = 31.1 Hz), 74.19 (d, J = 29.6 Hz), 68.74, 64.90 (d, J = 4.1 Hz), 55.81, 29.82 (d, J = 7.4 Hz), 20.60, 20.34.

[0299] 19 F NMR (376 MHz, MeOD) δ -159.68 (s).

[0300] 31 P NMR (162 MHz, MeOD) δ 3.75 (s).

[0301] Using "isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-D-tryptophan ester" instead of "isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucine ester", 19a-11 and I-11 were prepared, respectively:

[0302]

[0303] 1 H NMR (400 MHz, MeOD) δ 7.58 - 7.49 (m, 2H), 7.37 - 7.33 (m, 1H), 7.30 - 7.24 (m, 2H), 7.17 - 7.02 (m, 6H), 6.47 (d, J = 15.6 Hz, 1H), 5.81 (d, J = 7.6 Hz, 1H), 4.93 - 4.89 (m, 1H), 4.26 - 4.15 (m, 2H), 4.07 - 3.95 (m, 2H), 3.95 - 3.90 (m, 1H), 3.55 (d, J = 5.9 Hz, 1H), 3.29 - 3.05 (m, 2H), 1.15 (d, J = 6.2 Hz, 3H), 1.05 (d, J = 6.2 Hz, 3H), 0.92 (s, 9H), 0.15 (s, 3H), 0.10 (s, 1H).

[0304] 13C NMR (101 MHz, MeOD) δ 172.67 (d, J = 3.9 Hz), 166.13, 156.41, 150.62 (d, J = 6.7 Hz), 142.09 (d, J = 5.6 Hz), 136.64, 129.33, 127.41, 124.72, 123.54, 121.11, 119.88 (d, J = 4.6 Hz), 118.52, 117.90, 111.07, 109.29, 95.15 (d, J = 188.3 Hz), 94.80, 86.68 (d, J = 18.5 Hz), 82.71 (d, J = 9.4 Hz), 82.08 (d, J = 5.8 Hz), 76.59 (d, J = 31.7 Hz), 74.85 (d, J = 29.9 Hz), 68.78, 64.01, 55.76, 29.90 (d, J = 7.0 Hz), 24.85, 20.68, 20.42, 17.43, -5.57, -5.94.

[0305] 19 F NMR (376 MHz, MeOD) δ -158.69 (s).

[0306] 31 P NMR (162 MHz, MeOD) δ 3.37 (s).

[0307]

[0308] 1 H NMR (400 MHz, MeOD) δ 7.53 (dd, J = 10.2, 5.3 Hz, 2H), 7.37 - 7.33 (m, 1H), 7.30 - 7.24 (m, 2H), 7.17 - 7.01 (m, 6H), 6.46 (d, J = 16.5 Hz, 1H), 5.78 (d, J = 7.6 Hz, 1H), 4.92 (d, J = 6.2 Hz, 1H), 4.23 - 4.15 (m, 1H), 4.08 (dd, J = 17.4, 3.9 Hz, 1H), 4.04 - 3.94 (m, 3H), 3.50 (d, J = 5.9 Hz, 1H), 3.28 - 3.05 (m, 2H), 1.16 (d, J = 6.2 Hz, 3H), 1.06 (d, J = 6.2 Hz, 3H).

[0309] 13C NMR (101 MHz, MeOD) δ 172.76 (d, J = 3.8 Hz), 166.08, 156.39, 150.64 (d, J = 6.8 Hz), 142.34 (d, J = 5.7 Hz), 136.61, 129.29, 127.40, 124.68, 123.52, 121.10, 119.91 (d, J = 4.6 Hz), 118.51, 117.89, 111.03, 109.29, 95.24 (d, J = 187.9 Hz), 94.66, 86.54 (d, J = 18.3 Hz), 82.25 (d, J = 9.5 Hz), 81.66 (d, J = 7.8 Hz), 75.65 (d, J = 31.0 Hz), 74.22 (d, J = 29.8 Hz), 68.81, 64.79 (d, J = 3.7 Hz), 55.80, 29.81 (d, J = 7.4 Hz), 20.61, 20.39.

[0310] 19 F NMR (376 MHz, MeOD) δ -159.50 (s).

[0311] 31 P NMR (162 MHz, MeOD) δ 3.56 (s).

[0312] Example 13: Preparation of l-((3S,4R,5R)-4-((2,4-dichlorobenzyl)oxy)-5-(((2,4- dichlorobenzyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)pyrimidine- 2,4(lH,3H)-dione (compound shown in Formula 5a)

[0313]

[0314] Uracil (1.20 g, 5.28 mmol) was weighed into a two-necked flask and dissolved in acetonitrile (5 mL) and argon was bubbled through the solution for 3 times. N,O-bis(trimethylsilyl)-acetamide (2.15 g, 10.56 mmol) was added dropwise under ice-bath condition and the stirring was continued for 0.5 h. The reaction mixture was transferred to an ice-bath and compound 3a (2.36 g, 4.40 mmol) and trimethylsilyl triflate (2.93 g, 13.20 mmol) were added. The stirring was continued at reflux for 3 h and the reaction was monitored by TLC. The reaction mixture was cooled to room temperature and the solvent was removed by rotary evaporation. The oily residue was dissolved in dichloromethane and washed with water for 3 times and saturated sodium bicarbonate for 3 times. The organic phase was dried over anhydrous sodium sulfate and the solvent was removed by rotary evaporation. The crude product was purified by column chromatography on silica gel (dichloromethane / ethyl acetate = 5 / 1) to give 1-((3S,4R,5R)-4-(2,4-dichlorobenzyl)oxy)-5-(((2,4-dichlorobenzyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)pyrimidine-2,4(lH,3H)-dione (1.37 g, 52.89%) as a yellowish oil.

[0315] Example 14: Preparation of 1-((2R,3S,4R,5R)-4-((2,4-dichlorobenzyl)oxy)-5-(((2,4-dichlorobenzyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)-3-(4-methoxybenzyl)pyrimidine-2,4(lH,3H)-dione (compound shown in Formula 7a)

[0316]

[0317] Dissolve 1-((3S,4R,5R)-4-(2,4-dichlorobenzyl)oxy)-5-(((2,4- dichlorobenzyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)pyrimidine- 2,4(lH,3H)-dione (1.37 g, 2.33 mmol) in super-dry acetonitrile (2 mL), and replace with argon 3 times, then add 1,8-diazabicycloundec-7-ene (709.14 mg, 4.66 mmol) and p-methoxybenzyl chloride (PMBC1, 729.49 mg, 4.66 mmol) in sequence. Warm the reaction system to 80 °C and stir for 6 h, monitor the reaction completion by thin layer chromatography. Dilute the reaction system with water, extract with dichloromethane 3 times, dry the organic phase with anhydrous sodium sulfate, remove the solvent under reduced pressure, and purify the obtained crude product by silica gel column chromatography (petroleum ether / ethyl acetate = 10 / 1) to obtain the product 1-((2R,3S,4R,5R)-4-((2,4-dichlorobenzyl)oxy)-5-(((2,4- dichlorobenzyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)-3-(4- methoxybenzyl)pyrimidine-2,4(lH,3H)-dione (1.02 g, 62.81%) as colorless oil.

[0318] 1 H NMR (400 MHz, CDC13) δ 7.41 - 7.37 (m, 2H), 7.33 - 7.32 (m, 2H), 7.25 (d, J = 8.3 Hz, 2H), 7.20 (d, J = 0.9 Hz, 1H), 7.15 (dd, J = 8.3, 2.0 Hz, 1H), 6.78 - 6.74 (m, 2H), 6.43 (d, J = 13.1 Hz, 1H), 5.68 (d, J = 8.2 Hz, 1H), 5.06 - 4.94 (m, 2H), 4.81 (d, J = 12.5 Hz, 1H), 4.69 (d, J = 12.5 Hz, 1H), 4.53 (s, 2H), 4.30 (dd, J = 13.9, 3.9 Hz, 1H), 3.72 (s, 3H), 3.65 - 3.58 (m, 2H), 2.67 (d, J = 5.6 Hz, 1H), 1.20 (s, 2H).

[0319] 13C NMR (101 MHz, CDC13) δ 162.40, 159.12, 150.97, 137.60, 134.81, 134.24, 133.96, 133.69 (d, J = 6.7 Hz), 132.67, 130.83, 130.54, 129.91, 129.45, 129.29, 128.96, 127.25 (d, J = 3.2 Hz), 113.62, 101.64, 98.06 (d, J = 185.9 Hz), 90.82, 90.41, 84.09, 83.76 (d, J = 9.7 Hz), 83.21, 82.92, 73.43 (d, J = 29.4 Hz), 70.14, 69.96, 69.26 (d, J = 3.3 Hz), 55.26, 43.66, 29.70 (d, J = 3.9 Hz).

[0320] 19 F NMR (376 MHz, CDC13) δ -143.23.

[0321] Example 15: Preparation of l-((2R,3S,4R,5R)-4-(2,4-dichlorobenzyl)oxy)-5-(((2,4- dichlorobenzyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)pyrimidine-2,4(lH,3H)-dione (compound shown in Formula 8a)

[0322]

[0323] Example 15: Preparation of l-((2R,3S,4R,5R)-4-(2,4-dichlorobenzyl)oxy)-5-(((2,4- dichlorobenzyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)pyrimidine-2,4(lH,3H)-dione (compound shown in Formula 8a)

[0324] 1H NMR (400 MHz, MeOD) δ 7.69 (dd, J = 8.2, 2.2 Hz, 1H), 7.49 - 7.41 (m, 3H), 7.44 - 7.36 (m, 3H), 7.29 (ddd, J = 13.1, 8.3, 2.1 Hz, 2H), 6.34 (d, J = 12.2 Hz, 1H), 5.57 (d, J = 8.2 Hz, 1H), 4.93 (d, J = 12.7 Hz, 1H), 4.75 (d, J = 12.7 Hz, 1H), 4.61 (q, J = 12.5, 11.6 Hz, 2H), 4.32 (dd, J = 17.7, 5.9 Hz, 1H), 4.22 - 4.14 (m, 1H), 4.09 (q, J = 7.1 Hz, 1H), 3.90 - 3.81 (m, 1H), 3.77 (dd, J = 10.8, 4.0 Hz, 1H), 3.71 (d, J = 5.8 Hz, 1H).

[0325] 13 C NMR (101 MHz, MeOD) δ 164.19, 150.50, 140.98 (d, J = 4.5 Hz), 134.19, 134.07, 133.70 (d, J = 9.8 Hz), 133.49, 130.72, 130.47, 128.85, 128.77, 126.99, 101.27, 94.55 (d, J = 190.6 Hz), 86.48 (d, J = 19.7 Hz), 83.11 (d, J = 9.7 Hz), 82.34 (d, J = 29.6 Hz), 80.09, 74.39 (d, J = 30.5 Hz), 69.58, 69.16, 68.14.

[0326] 19 F NMR (376 MHz, MeOD) δ -155.60.

[0327] Example 16: Preparation of l-((2R,3S,4R,5R)-3-ethynyl-3-fluoro-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(lH,3H)-dione (compound shown in Formula 10a)

[0328]

[0329] (2R,3S,4R,5R)-4-(2,4-dichlorobenzyl)oxy)-5-(((2,4-dichlorophenyl)methyl)-3- ethynyl-3-fluorotetrahydrofuran-2-yl)pyrimidine-2,4(lH,3H)-dione (789 mg, 1.34 mmol) was dissolved in super dry dichloromethane and boron trichloride (4.71 g, 40.24 mmol) was added slowly dropwise at -78 °C and stirring was continued at room temperature for 12 h, thin layer chromatography was used to monitor the completion of the reaction. The reaction was quenched by slow dropwise addition of methanol under ice bath and the solvent was removed under reduced pressure to get the crude product which was purified by silica gel column chromatography (eluent / dichloromethane / methanol = 10 / 1) to get the product 1-((2R,3S,4R,5R)-3-ethynyl-3-fluoro-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(lH,3H)-dione (178 mg, 46.79%) as a white solid.

[0330] 1 H NMR (400 MHz, MeOD) δ 7.78 (dd, J = 8.2, 2.6 Hz, 1H), 6.30 (d, J = 15.0 Hz, 1H), 5.68 (d, J = 8.2 Hz, 1H), 4.22 (dd, J = 18.3, 5.0 Hz, 1H), 3.93 - 3.89 (m, 1H), 3.84 - 3.72 (m, 2H), 3.54 (d, J = 5.9 Hz, 1H).

[0331] 13 C NMR (101 MHz, MeOD) δ 164.39, 150.63, 141.79 (d, J = 5.7 Hz), 100.99, 95.71 (d, J = 187.7 Hz), 85.93 (d, J = 18.7 Hz), 84.00 (d, J = 3.1 Hz), 82.30 (d, J = 9.7 Hz), 75.29 (d, J = 30.5 Hz), 74.41 (d, J = 30.5 Hz), 60.33.

[0332] 19 F NMR (376 MHz, MeOD) δ -159.65.

[0333] Example 17: Preparation of isopropyl ((S)-(((2R,3R,4S,5R)-5-(2,4-dioxo-3,4- dihydropyrimidin-l(2H)-yl)-4-ethynyl-4-fluoro-3-hydroxytetrahydrofuran-2-yl)methoxy)(phenoxy) phosphoryl)-L-leucinate (compound of Formula I-12)

[0334]

[0335] Compound 1-((2R,3S,4R,5R)-3-ethynyl-3-fluoro-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(lH,3H)-dione (100 mg, 260.76 pmol) was dissolved in super dry tetrahydrofuran (1.5 mL) and purged with argon for 3 times. The solution of tert-butylmagnesium chloride in tetrahydrofuran (1 M, 651.90 pL, 312.91 pmol) was added dropwise slowly under ice bath, and the mixture was stirred at room temperature for 0.5 h after the addition was completed. Then the solution of isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate (synthesis reference J. Org. Chem. 2011, 76, 8311-8319) (155.01 mg, 312.91 pmol) in tetrahydrofuran (1 mL) was added dropwise slowly under ice bath, and the mixture was stirred at room temperature subsequently. The reaction was monitored by TLC for 12 h, and the reaction was quenched by adding saturated ammonium chloride solution dropwise. The reaction mixture was diluted with ethyl acetate, washed with water for 3 times, and saturated sodium chloride solution for 1 time. The organic phase was dried over anhydrous sodium sulfate. The crude product obtained after concentration under reduced pressure was purified by silica gel column chromatography (dichloromethane / methanol = 18 / 1) to give the product isopropyl ((S)-(((2R,3R,4S,5R)-5-(2,4-dioxo-3,4-dihydropyrimidin-l(2H)-yl)-4-ethynyl-4-fluoro-3- hydroxytetrahydrofuran-2-yl)methoxy)(phenoxy)phosphoryl)-L-leucinate as a white solid (126.21 mg, 70.70%).

[0336] 1 H NMR (400 MHz, MeOD) d 7.59 (dd, J = 8.2, 2.8 Hz, 1H), 7.38 - 7.33 (m, 2H), 7.24 - 7.17 (m, 3H), 6.34 (d, J = 16.9 Hz, 1H), 5.61 (d, J = 8.2 Hz, 1H), 4.98 - 4.92 (m, 1H), 4.37 - 4.27 (m, 2H), 4.23 (dd, J = 17.4, 4.2 Hz, 1H), 4.12 - 4.08 (m, 1H), 3.84 - 3.78 (m, 1H), 3.56 (d, J = 5.9 Hz, 1H), 1.76 - 1.69 (m, 1H), 1.53 - 1.49 (m, 2H), 1.22 - 1.19 (m, 6H), 0.90 - 0.85 (m, 6H).

[0337] 13C NMR (101 MHz, MeOD) δ 173.11, 164.23, 150.81 (d, J = 7.4 Hz), 150.56, 141.80 (d, J = 6.4 Hz), 129.44, 124.78, 119.94, 119.89, 101.25, 95.45 (d, J = 187.4 Hz), 85.92 (d, J = 18.3 Hz), 82.57 (d, J = 9.8 Hz), 82.27 (d, J = 8.5 Hz), 75.62 (d, J = 31.5 Hz), 73.72, 68.64, 65.11, 53.23, 42.72 (d, J = 7.6 Hz), 29.36, 24.21, 21.73, 20.64, 20.51.

[0338] 19 F NMR (376 MHz, MeOD) δ -159.64.

[0339] 31 P NMR (162 MHz, MeOD) δ 4.02.

[0340] Using the synthetic method of Compound I-12, “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-D-leucinate” replaces “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate” therein, Compound I-13 can be prepared.

[0341]

[0342] 1 H NMR (400 MHz, MeOD) δ 7.60 (dd, J = 8.2, 2.8 Hz, 1H), 7.37 - 7.31 (m, 2H), 7.25 - 7.15 (m, 3H), 6.34 (d, J = 16.4, 2.9 Hz, 1H), 5.65 (d, 1H), 4.99 - 4.92 (m, 1H), 4.37 - 4.25 (m, 2H), 4.20 (dd, J = 17.5, 4.3 Hz, 1H), 4.13 - 4.08 (m, 1H), 3.86 - 3.79 (m, 1H), 3.56 (d, J = 5.9 Hz, 1H), 1.77 - 1.70 (m, 1H), 1.54 - 1.48 (m, 2H), 1.23 - 1.19 (m, 6H), 0.92 - 0.87 (m, 6H).

[0343] 13C NMR (101 MHz, MeOD) δ 173.16 (d, J = 3.1 Hz), 164.23, 150.83 (d, J = 6.6 Hz), 150.55, 141.74 (d, J = 6.4 Hz), 129.40, 124.74, 119.89, 119.85, 101.27, 95.45 (d, J = 187.5 Hz), 85.95 (d, J = 18.5 Hz), 82.60 (d, J = 9.7 Hz), 82.08 (d, J = 7.8 Hz), 75.54 (d, J = 31.0 Hz), 73.91 (d, J = 29.8 Hz), 68.68, 65.04 (d, J = 5.4 Hz), 53.19, 42.71 (d, J = 7.6 Hz), 29.37, 24.21, 21.78, 20.62, 20.54.

[0344] 19 F NMR (376 MHz, MeOD) δ -159.42.

[0345] 31 P NMR (162 MHz, MeOD) δ 3.72.

[0346] Using the synthetic method of Compound I-12, “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-valinate” instead of “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate” therein, Compound I-13 can be prepared.

[0347]

[0348] 1 H NMR (400 MHz, MeOD) δ 8.82 (dd, J = 8.2, 2.9 Hz, 1H), 8.60 - 8.54 (m, 2H), 8.47 - 8.39 (m, 3H), 7.56 (d, J = 16.8 Hz, 1H), 6.84 (d, J = 8.2 Hz, 1H), 6.21 - 6.15 (m, 1H), 5.57 - 5.53 (m, 1H), 5.47 (dd, J = 17.5, 4.2 Hz, 1H), 5.36 - 5.31 (m, 1H), 4.87 - 4.80 (m, 2H), 4.78 (d, J = 5.9 Hz, 1H), 2.44 - 2.41 (m, 6H), 2.27 - 2.20 (m, 1H), 2.16 - 2.12 (m, 6H).

[0349] 13C NMR (101 MHz, MeOD) δ 172.10 (d, J = 3.4 Hz), 164.23, 150.79 (d, J = 6.7 Hz), 141.79 (d, J = 6.4 Hz), 129.42, 124.79, 120.03, 119.99, 101.26, 95.46 (d, J = 187.5 Hz), 85.93 (d, J = 18.2 Hz), 82.60 (d, J = 9.6 Hz), 82.24 (d, J = 7.8 Hz), 75.63 (d, J = 31.4 Hz), 73.88 (d, J = 30.4 Hz), 68.67, 66.74, 65.17 (d, J = 5.3 Hz), 60.62, 31.83 (d, J = 7.1 Hz), 20.69, 20.61, 18.18, 16.96.

[0350] 19 F NMR (376 MHz, MeOD) δ -159.58.

[0351] 31 P NMR (162 MHz, MeOD) δ 4.45.

[0352] Using the synthetic method of Compound I-12, “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-D-valinate” replaces “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate” therein, Compound I-13 can be prepared.

[0353]

[0354] 1 H NMR (400 MHz, MeOD) δ 7.57 (dd, J = 8.2, 2.9 Hz, 1H), 7.35 - 7.30 (m, 2H), 7.23 - 7.15 (m, 3H), 6.32 (d, J = 16.8 Hz, 1H), 5.60 (d, J = 8.2 Hz, 1H), 4.97 - 4.92 (m, 1H), 4.33 - 4.29 (m, 1H), 4.23 (dd, J = 17.5, 4.2 Hz, 1H), 4.11 - 4.07 (m, 1H), 3.64 - 3.57 (m, 2H), 3.54 (d, J = 5.9 Hz, 1H), 2.02 - 1.97 (m, 1H), 1.20 - 1.16 (m, 6H), 0.92 - 0.86 (m, 6H).

[0355] 13C NMR (101 MHz, MeOD) δ 172.10 (d, J = 3.4 Hz), 164.23, 150.82, 141.79 (d, J = 6.3 Hz), 129.42, 124.79, 120.03, 119.99, 101.26, 95.46 (d, J = 187.5 Hz), 85.93 (d, J = 18.2 Hz), 82.60 (d, J = 9.6 Hz), 82.24 (d, J = 7.8 Hz), 75.63 (d, J = 31.4 Hz), 73.88 (d, J = 30.4 Hz), 68.67, 65.17 (d, J = 5.3 Hz), 60.62, 31.83 (d, J = 7.1 Hz), 20.69, 20.61, 18.18, 16.95.

[0356] 19 F NMR (376 MHz, MeOD) δ -159.59.

[0357] 31 P NMR (162 MHz, MeOD) δ 4.68.

[0358] Using the synthetic method of Compound I-12, “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-alaninate” replaces “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate” therein, Compound I-13 can be prepared.

[0359]

[0360] 1 H NMR (400 MHz, MeOD) δ 7.57 (d, J = 8.3, 2.9 Hz, 1H), 7.38 – 7.32 (m, 2H), 7.26 – 7.16 (m, 3H), 6.33 (d, J = 16.8 Hz, 1H), 5.61 (d, J = 8.2 Hz, 1H), 4.95 (dd, J = 12.2, 6.0 Hz, 1H), 4.37 – 4.28 (m, 2H), 4.27 – 4.20 (m, 1H), 4.13 – 4.07 (m, 1H), 3.94 – 3.84 (m, 1H), 3.55 (d, J = 5.8 Hz, 1H), 1.32 (d, J = 7.2 Hz, 3H), 1.23 – 1.18 (m, 6H).

[0361] 13C NMR (101 MHz, MeOD) δ 172.98 (d, J = 5.4 Hz), 164.23, 150.76 (d, J = 6.6 Hz), 141.75 (d, J = 6.5 Hz), 129.46, 124.85, 120.04 (d, J = 4.6 Hz), 101.26, 95.45 (d, J = 187.7 Hz), 85.91 (d, J = 18.4 Hz), 82.59 (d, J = 9.6 Hz), 82.27 (d, J = 7.7 Hz), 75.64 (d, J = 31.1 Hz), 73.88 (d, J = 29.5 Hz), 68.77, 50.28, 20.61, 20.51, 19.10 (d, J = 6.5 Hz).

[0362] 19 F NMR (376 MHz, MeOD) δ -159.74.

[0363] 31 P NMR (162 MHz, MeOD) δ 3.83.

[0364] Using the synthetic method of Compound I-12, “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-alaninate” replaces “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate” therein, Compound I-13 can be prepared.

[0365]

[0366] 1 H NMR (400 MHz, MeOD) δ 7.57 (dd, J = 8.3, 2.9 Hz, 1H), 7.38 - 7.32 (m, 2H), 7.26 - 7.16 (m, 3H), 6.33 (d, J = 16.8 Hz, 1H), 5.61 (d, J = 8.2 Hz, 1H), 4.98 - 4.92 (m, 1H), 4.37 - 4.28 (m, 2H), 4.23 (dd, J = 17.8, 4.0 Hz, 1H), 4.14 - 4.08 (m, 1H), 3.93 - 3.84 (m, 1H), 3.55 (d, J = 5.8 Hz, 1H), 1.32 (d, J = 7.2 Hz, 3H), 1.23 - 1.18 (m, 6H).

[0367] 13C NMR (101 MHz, MeOD) δ 172.98 (d, J = 5.4 Hz), 164.23, 150.76 (d, J = 7.2 Hz), 141.75 (d, J = 6.4 Hz), 129.46, 124.85, 120.04 (d, J = 4.5 Hz), 101.26, 95.45 (d, J = 187.5 Hz), 85.91 (d, J = 18.4 Hz), 82.59 (d, J = 9.6 Hz), 82.27 (d, J = 7.7 Hz), 75.64 (d, J = 31.4 Hz), 73.88 (d, J = 29.4 Hz), 68.77, 65.04 (d, J = 5.2 Hz), 50.28, 20.61, 20.51, 19.10 (d, J = 6.5 Hz).

[0368] 19 F NMR (376 MHz, MeOD) δ -159.74.

[0369] 31 P NMR (162 MHz, MeOD) δ 3.83.

[0370] 31 P NMR (162 MHz, MeOD) δ 4.00.

[0371] Using the synthetic method of Compound I-12, “isopropyl ((R)- (perfluorophenoxy)(phenoxy)phosphoryl)-L-methioninate” instead of “isopropyl ((R)- (perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate” therein, Compound I-13 can be prepared.

[0372]

[0373] 1 H NMR (400 MHz, MeOD) δ 7.61 (dd, J = 8.2, 2.8 Hz, 1H), 7.37 - 7.32 (m, 2H), 7.27 - 7.24 (m, 2H), 7.20 - 7.16 (m, 1H), 6.33 (d, J = 16.2 Hz, 1H), 5.67 (d, J = 8.2 Hz, 1H), 5.02 - 4.95 (m, 1H), 4.40 - 4.34 (m, 1H), 4.33 - 4.26 (m, 1H), 4.24 - 4.17 (m, 1H), 4.12 - 4.08 (m, 1H), 4.03 - 3.97 (m, 1H), 3.57 (d, J = 5.9 Hz, 1H), 2.55 - 2.50 (m, 2H), 2.01 - 1.96 (m, 1H), 1.90 - 1.83 (m, 1H), 1.28 (s, 3H), 1.22 (d, J = 6.2 Hz, 6H).

[0374] 13 C NMR (101 MHz, MeOD) δ 172.37 (d, J = 3.4 Hz), 164.24, 150.55, 141.75 (d, J = 5.7 Hz), 129.42, 124.80, 119.89, 101.33, 95.47 (d, J = 187.5 Hz), 85.95 (d, J = 18.3 Hz), 82.60 (d, J = 9.7 Hz), 82.01 (d, J = 7.5 Hz), 75.51 (d, J = 30.6 Hz), 73.93 (d, J = 29.5 Hz), 68.96, 53.39, 29.53, 29.36, 20.60, 20.56, 13.71.

[0375] 19 F NMR (376 MHz, MeOD) δ -159.21.

[0376] 31 P NMR (162 MHz, MeOD) δ 3.64.

[0377] Using the synthetic method of Compound I-12, “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-D-methioninate” replaces “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate” therein, Compound I-13 can be prepared.

[0378]

[0379] 1 H NMR (400 MHz, MeOD) δ 7.60 (dd, J = 8.2, 2.8 Hz, 1H), 7.39 - 7.34 (m, 2H), 7.27 - 7.17 (m, 3H), 6.34 (d, J = 17.0 Hz, 1H), 5.63 (d, J = 8.2 Hz, 1H), 5.01 - 4.95 (m, 1H), 4.38 - 4.28 (m, 2H), 4.24 (d, J = 13.3 Hz, 1H), 4.13 - 4.09 (m, 1H), 4.04 - 3.95 (m, 1H), 3.56 (d, J = 5.9 Hz, 1H), 2.56 - 2.48 (m, 2H), 2.02 (s, 3H), 1.91 - 1.83 (m, 1H), 1.24 - 1.21 (m, 6H).

[0380] 13C NMR (101 MHz, MeOD) δ 172.29 (d, J = 4.4 Hz), 164.25, 150.80 (d, J = 7.4 Hz), 141.83 (d, J = 6.4 Hz), 129.46, 124.82, 119.97 (d, J = 4.4 Hz), 101.29, 95.45 (d, J = 187.5 Hz), 85.91 (d, J = 18.4 Hz), 82.56 (d, J = 9.7 Hz), 82.30 (d, J = 8.0 Hz), 75.62 (d, J = 31.6 Hz), 73.85 (d, J = 29.5 Hz), 68.94, 66.74, 65.21 (d, J = 4.8 Hz), 53.54, 32.85 (d, J = 6.6 Hz), 29.52, 20.61, 20.55, 13.72.

[0381] 19 F NMR (376 MHz, MeOD) δ -159.68.

[0382] Using the synthetic method of compound I-12, “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-tryptophan ester” replaces “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucine ester” therein, to prepare:

[0383]

[0384] 1 H NMR (400 MHz, MeOD) δ 7.50 (d, J = 2.1 Hz, 1H), 7.32 (d, J = 8.1 Hz, 1H), 7.28 – 7.23 (m, 2H), 7.15 – 6.99 (m, 7H), 6.29 (d, J = 16.4 Hz, 1H), 5.53 (d, J = 8.2 Hz, 1H), 4.18 – 4.12 (m, 1H), 4.07 (dd, J = 17.4, 3.8 Hz, 1H), 4.01 – 3.94 (m, 3H), 3.55 (d, J = 5.9 Hz, 1H), 3.25 – 3.18 (m, 1H), 3.09 – 3.03 (m, 1H), 1.14 (d, J = 6.2 Hz, 3H), 1.04 (d, J = 6.3 Hz, 3H).

[0385] 13C NMR (101 MHz, MeOD) δ 172.71 (d, J = 3.4 Hz), 164.23, 150.55, 141.64 (d, J = 5.7 Hz), 136.63, 129.28, 127.40, 124.68, 123.50, 121.09, 119.90 (d, J = 4.4 Hz), 118.49, 117.87, 111.02, 109.33, 101.25, 95.35 (d, J = 187.6 Hz), 85.91 (d, J = 18.4 Hz), 82.53 (d, J = 8.9 Hz), 82.01 (d, J = 8.0 Hz), 75.43 (d, J = 30.7 Hz), 68.75, 66.74, 64.69, 55.81, 29.92 - 29.78 (m), 20.60, 20.38.

[0386] 19 F NMR (376 MHz, MeOD) δ -159.58.

[0387] 31 P NMR (162 MHz, MeOD) δ 3.56.

[0388] Using the synthetic method of Compound I-12, “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-D-tryptophan ester” instead of “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucine ester” therein, Compound I-13 can be prepared.

[0389]

[0390] 1 H NMR (400 MHz, MeOD) δ 7.51 (d, J = 7.6 Hz, 1H), 7.49 - 7.46 (m, 1H), 7.33 - 7.27 (m, 3H), 7.17 - 7.13 (m, 1H), 7.10 - 7.06 (m, 4H), 7.02 - 6.97 (m, 1H), 6.28 (d, J = 16.8 Hz, 1H), 5.51 (d, J = 8.2 Hz, 1H), 4.16 - 4.14 (m, 1H), 4.13 - 4.08 (m, 1H), 4.08 - 3.96 (m, 3H), 3.54 (d, J = 5.9 Hz, 1H), 3.24 - 3.18 (m, 1H), 3.09 - 3.03 (m, 1H), 1.15 (d, J = 6.3 Hz, 3H), 1.04 (d, J = 6.3 Hz, 3H).

[0391] 13C NMR (101 MHz, MeOD) δ 172.67, 164.22, 150.66 (d, J = 7.5 Hz), 141.69 (d, J = 6.5 Hz), 136.64, 129.33, 127.33, 124.70, 123.42, 121.08, 119.93 (d, J = 4.4 Hz), 118.45, 117.85, 110.97, 109.31, 101.19, 95.37 (d, J = 187.4 Hz), 85.85 (d, J = 17.6 Hz), 82.50 (d, J = 9.6 Hz), 82.16 (d, J = 8.3 Hz), 75.57 (d, J = 30.7 Hz), 73.87 (d, J = 29.5 Hz), 68.73, 66.73, 64.86, 55.82, 29.82 (d, J = 7.5 Hz), 20.59, 20.34.

[0392] 19 F NMR (376 MHz, MeOD) δ -159.66.

[0393] 31 P NMR (162 MHz, MeOD) δ 3.76.

[0394] Using the synthetic method of compound I-12, “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-phenylalaninate” replaces “isopropyl ((R)-(perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate” therein, to prepare:

[0395]

[0396] 1 H NMR (400 MHz, MeOD) δ 7.55 (dd, J = 8.2, 2.8 Hz, 1H), 7.32 - 7.25 (m, 5H), 7.24 - 7.21 (m, 3H), 7.12 - 7.09 (m, 2H), 6.32 (d, J = 16.8 Hz, 1H), 5.62 (d, J = 8.2 Hz, 1H), 4.96 - 4.88 (m, 2H), 4.10 - 4.08 (m, 1H), 4.07 - 4.02 (m, 1H), 4.01 - 3.99 (m, 2H), 3.57 (d, J = 5.9 Hz, 1H), 3.35 (s, 1H), 1.20 - 1.18 (m, 3H), 1.13 - 1.11 (m, 3H).

[0397] 13C NMR (101 MHz, MeOD) δ 172.06 (d, J = 4.2 Hz), 164.20, 150.55, 141.71, 129.40, 129.23, 128.14, 126.56, 124.76, 120.00, 101.26, 95.42 (d, J = 187.4 Hz), 85.84 (d, J = 17.7 Hz), 82.56 (d, J = 9.8 Hz), 82.26 (d, J = 7.9 Hz), 75.59 (d, J = 30.9 Hz), 68.83, 66.74, 56.46, 39.68 (d, J = 6.7 Hz), 29.36, 20.61, 20.44.

[0398] NMR (376 MHz, MeOD) δ -159.58.

[0399] 31 P NMR (162 MHz, MeOD) δ 4.68.

[0400] Using the synthetic method of compound I-12, "isopropyl ((R)- (perfluorophenoxy)(phenoxy)phosphoryl)-D-phenylalaninate" instead of "isopropyl ((R)- (perfluorophenoxy)(phenoxy)phosphoryl)-L-leucinate" therein, the following compound can be prepared:

[0401]

[0402] 1 H NMR (400 MHz, MeOD) δ 7.55 - 7.53 (m, 1 H), 7.33 - 7.31 (m, 2H), 7.28 - 7.25 (m, 3H), 7.24 - 7.22 (m, 3H), 7.20 - 7.17 (m, 2H), 6.35 (d, J = 4.3 Hz, 1 H), 5.59 (d, 1 H), 4.94 - 4.89 (m, 2H), 4.18 - 4.13 (m, 1 H), 4.07 - 4.06 (m, 1 H), 3.66 (s, 2H), 3.56 (d, J = 5.9 Hz, 1 H), 3.37 (s, 1 H), 1.20 - 1.19 (m, 3H), 1.12 - 1.10 (m, 3H).

[0403] 13C NMR (101 MHz, MeOD) δ 172.06 (d, J = 4.2 Hz), 164.20, 150.55, 141.74 (d, J = 6.4 Hz), 136.77 (d, J = 6.1 Hz), 129.40, 129.23, 128.14, 126.56, 124.76, 120.00, 101.26, 95.42 (d, J = 187.4 Hz), 85.84 (d, J = 17.7 Hz), 82.56 (d, J = 9.8 Hz), 82.26 (d, J = 7.9 Hz), 75.59 (d, J = 31.0 Hz), 68.83, 56.46, 39.68 (d, J = 6.7 Hz), 29.36, 20.61, 20.44.

[0404] 19 F NMR (376 MHz, MeOD) δ -159.74.

[0405] 31 P NMR (162 MHz, MeOD) δ 3.83.

[0406] Example 18: Preparation of 4-amino-l-((2R,3S,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-5-(((tert-butyldimethylsilyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)pyrimidin-2(lH)-one (compound shown in Formula 15a)

[0407]

[0408] Compound N-(l-((2R,3S,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-5-(((tert- butyldimethylsilyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)-2-oxo-l,2- dihydropyrimidin-4-yl)benzamide (1.10 g, 1.83 mmol) was dissolved with ammonia in methanol (7.0 M, 15 mL) and stirred at 40 °C in an oil bath. TLC was used to monitor the reaction for 3 h until it was complete. The solvent was removed by concentration under reduced pressure. The resulting crude product was purified by silica gel column chromatography (dichloromethane / methanol = 15 / 1) to obtain the product 4-amino-l-((2R,3S,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-5-(((tert- butyldimethylsilyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)pyrimidin-2(lH)-one (0.82 g, 90.14%) as a white solid.

[0409] 1H NMR (400 MHz, CDC13) δ 7.50 (dd, J = 7.6, 2.2 Hz, 1H), 6.50 (d, J = 14.0 Hz, 1H), 5.80 (d, J = 7.6 Hz, 1H), 4.33 (dd, J = 17.5, 4.7 Hz, 1H), 3.90 - 3.84 (m, 1H), 3.84 - 3.73 (m, 2H), 2.86 (d, J = 5.8 Hz, 1H), 0.89 (d, J = 3.3 Hz, 18H), 0.18 - 0.02 (m, 12H).

[0410] 13 C NMR (101 MHz, CDC13) δ 165.96, 155.77, 141.57 (d, J = 4.6 Hz), 95.44 (d, J = 189.3 Hz), 95.24, 86.51 (d, J = 18.8 Hz), 83.48 (d, J = 3.1 Hz), 81.43 (d, J = 9.7 Hz), 76.36 (d, J = 30.5 Hz), 75.75 (d, J = 30.4 Hz), 61.28, 25.90, 25.69, 18.38, 17.99, -4.39, -4.88, -5.41.

[0411] 19 F NMR (376 MHz, CDC13) δ -158.38 (s).

[0412] Example 19: Preparation of tert-butyl (l-((2R,3S,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-5-(((tert-butyldimethylsilyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)-2-oxo-l,2-dihydropyrimidin-4-yl)carbamate (compound shown in Formula 16a)

[0413]

[0414] Compound 4-amino-l-((2R,3S,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-5-(((tert- butyldimethylsilyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)pyrimidin- 2(lH)-one (660.00 mg, 1.33 mmol) was dissolved in acetonitrile (1.5 mL), and 1,8- diazabicycloundec-7-ene (302.79 mg, 1.99 mmol) and N-BOC-imidazole (334.53 mg, 1.99 mmol) were added sequentially at room temperature. The reaction was stirred in an oil bath at 50°C, and thin layer chromatography was used to monitor the reaction for 48 h until completion. A small amount of saturated sodium bicarbonate solution was added to quench the reaction. The reaction was diluted with ethyl acetate and washed sequentially with water 3 times, citric acid solution 3 times, saturated sodium bicarbonate solution 3 times, and saturated brine 1 time, and dried over anhydrous sodium sulfate. The solvent was removed by concentration under reduced pressure, and the resulting crude product was purified by silica gel column chromatography (dichloromethane / methanol = 80 / 1) to obtain a white solid-like product (l-((2R,3S,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-5-(((tert- butyldimethylsilyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)-2-oxo-l,2- dihydropyrimidin-4-yl)carbamic acid tert-butyl ester (566.12 mg, 71.41%).

[0415] 1 H NMR (400 MHz, CDC13) δ 7.90 (d, J = 6.9 Hz, 1H), 7.19 (d, J = 7.5 Hz, 1H), 6.57 (d, J = 12.5 Hz, 1H), 4.40 (dd, J = 18.1, 5.1 Hz, 1H), 3.97 - 3.92 (m, 1H), 3.92 - 3.77 (m, 2H), 2.91 (d, J = 5.8 Hz, 1H), 1.51 (s, 9H), 0.94 (s, 9H), 0.17 - 0.10 (m, 12H).

[0416] 13C NMR (101 MHz, CDC13) δ 162.67, 154.82, 151.11, 145.01 (d), 124.77, 124.36, 123.47, 119.03, 118.84, 114.08, 95.24 (d, J = 190.6 Hz), 94.67, 86.91 (d, J = 19.1 Hz), 83.77 (d, J = 3.5 Hz), 82.85, 81.73 (d, J = 9.7 Hz), 76.15 (d, J = 30.5 Hz), 75.37 (d, J = 30.3 Hz), 60.99, 28.03, 25.88, 25.67, 18.38, 18.00, -4.38, -4.93, -5.42.

[0417] 19 F NMR (376 MHz, CDC13) δ -157.37 (s).

[0418] Example 20: Preparation of tert-butyl (l-((2R,3S,4R,5R)-3-ethynyl-3-fluoro-4- hydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)-2-oxo-l,2-dihydropyrimidin-4- yl)carbamate (compound shown in Formula 17a)

[0419] The compound tert-butyl (l-((2R,3S,4R,5R)-4-((tert-butyldimethylsilyl)oxy)-5-(((tert- butyldimethylsilyl)oxy)methyl)-3-ethynyl-3-fluorotetrahydrofuran-2-yl)-2-oxo-l,2- dihydropyrimidin-4-yl)carbamate (500.00 mg, 836.29 pmol) was dissolved in tetrahydrofuran (1.2 mL), and a solution of tetrabutylammonium fluoride in tetrahydrofuran (1 M, 1.67 mL) was added dropwise under ice bath condition. After the addition was completed, the reaction was stirred at room temperature, and thin layer chromatography was used to monitor the reaction for 2.5 h until it was completed. The reaction system was diluted with ethyl acetate, washed with water three times, and saturated brine once, and dried over anhydrous sodium sulfate. The solvent was removed by concentration under reduced pressure, and the obtained crude product was purified by silica gel column chromatography (dichloromethane / methanol = 10 / 1) to obtain the product (tert-butyl (l-((2R,3S,4R,5R)-3-ethynyl-3-fluoro-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-2-yl)-2-oxo-l,2-dihydropyrimidin-4-yl)carbamate) as a white solid (262.76 mg, 84.17%).

[0420] Example 21: Preparation of ((2R, 3R, 4S, 5R)-3-acetyloxy-5-(4-((tert- butoxycarbonyl)amino)-2-oxopyrimidin-1(2H)-yl)-4-ethynyl-4-fluorotetrahydrofuran- 2-yl)acetic acid methyl ester (compound shown in Formula 20a-1)

[0421]

[0422] Compound (1-((2R, 3S, 4R, 5R)-3-ethynyl-3-fluoro-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-2-yl)-2-oxo-1, 2-dihydropyrimidin-4-yl)carbamic acid tert-butyl ester (55.00 mg, 148.91 μmol) was dissolved in super dry tetrahydrofuran (0.5 mL), and triethylamine (45.54 μL, 327.60 μmol), acetic anhydride (30.68 μL, 327.60 μmol) and 4-dimethylaminopyridine (0.91 mg, 7.45 μmol) were added successively under ice bath condition. The reaction was stirred at room temperature and monitored by thin layer chromatography for 1.2 h until completion. The reaction was diluted with ethyl acetate and washed with water for 3 times, citric acid solution for 3 times, saturated sodium bicarbonate solution for 3 times and saturated brine for 1 time. The organic phase was dried over anhydrous sodium sulfate. The solvent was removed under reduced pressure to give a crude product which was purified by silica gel column chromatography (dichloromethane / methanol = 50 / 1) to give the product ((2R, 3R, 4S, 5R)-3-acetyloxy-5-(4-((tert- butoxycarbonyl)amino)-2-oxopyrimidin-1(2H)-yl)-4-ethynyl-4-fluorotetrahydrofuran- 2-yl)acetic acid methyl ester (51.37 mg, 76.08%) as a white solid.

[0423] 1 H NMR (400 MHz, CDC13) δ 7.77 (dd, J = 7.5, 2.5 Hz, 1H), 7.27 (d, J = 7.7 Hz, 1H), 6.66 (d, J = 18.5 Hz, 1H), 5.36 - 5.31 (m, 1H), 4.47 - 4.36 (m, 2H), 4.31 - 4.25 (m, 1H), 2.94 (d, J = 5.9 Hz, 1H), 2.19 (s, 3H), 2.12 (s, 3H), 1.52 (s, 9H).

[0424] 13C NMR (101 MHz, CDC13) δ 170.48, 168.96, 163.00, 154.76, 150.99, 145.23 (d, J = 6.1 Hz), 95.29, 92.90 (d, J = 188.0 Hz), 86.62 (d, J = 17.8 Hz), 83.04, 82.48 (d, J = 9.6 Hz), 80.34, 76.14 (d, J = 35.7 Hz), 72.46 (d, J = 28.6 Hz), 62.45, 27.99, 20.71 (d, J = 7.5 Hz).

[0425] 19 F NMR (376 MHz, CDC13) δ -161.62 (s).

[0426] Example 22: Preparation of ((2R, 3R, 4S, 5R)-3-acetyloxy-5-(4-amino-2-oxo- pyrimidin-l(2H)-yl)-4-ethynyl-4-fluorotetrahydrofuran-2-yl) acetic acid methyl ester (the compound shown in Formula I-24)

[0427]

[0428] The compound ((2R, 3R, 4S, 5R)-3-acetyloxy-5-(4-((tert-butoxycarbonyl)amino)- 2-oxopyrimidin-l(2H)-yl)-4-ethynyl-4-fluorotetrahydrofuran-2-yl) acetic acid methyl ester (45.00 mg, 99.24 μmol) was dissolved in dichloromethane (0.4 mL) and trifluoroacetic acid (152.00 μL, 1.98 mmol) was added dropwise slowly under ice bath condition. The reaction was stirred at room temperature after the addition was completed and monitored by thin layer chromatography for 2.5 h until the reaction was completed. The excess trifluoroacetic acid was removed by rotary evaporation under reduced pressure and the concentrate was diluted with ethyl acetate, then washed with saturated sodium bicarbonate solution once, saturated brine once, and the organic phase was collected and dried over anhydrous sodium sulfate. The solvent was removed by concentration under reduced pressure and the crude product was purified by silica gel column chromatography (dichloromethane / methanol = 50 / 1) to give the product ((2R, 3R, 4S, 5R)-3-acetyloxy-5-(4-amino-2-oxopyrimidin-l(2H)-yl)-4-ethynyl-4- fluorotetrahydrofuran-2-yl) acetic acid methyl ester (26.72 mg, 74.15%) as a white solid.

[0429] 1H NMR (400 MHz, MeOD) δ 7.81 (dd, J = 7.9, 3.0 Hz, 1H), 6.47 (d, J = 17.7 Hz, 1H), 6.13 (d, J = 7.9 Hz, 1H), 5.37 (dd, J = 16.8, 3.3 Hz, 1H), 4.51 - 4.39 (m, 2H), 4.39 - 4.36 (m, 1H), 3.69 (d, J = 6.0 Hz, 1H), 2.19 (s, 3H), 2.09 (s, 3H).

[0430] 13 C NMR (101 MHz, EtOD) δ 168.71, 166.94, 160.31, 149.17, 141.60 (d, J = 6.3 Hz), 92.61, 91.23 (d, J = 187.5 Hz), 84.35 (d, J = 18.2 Hz), 81.24 (d, J = 9.1 Hz), 77.94, 73.83 (d, J = 35.2 Hz), 70.22 (d, J = 29.1 Hz), 60.01, 17.07 (d, J = 4.4 Hz).

[0431] 19 F NMR (376 MHz, EtOD) δ -163.07 (s).

[0432] Using the synthetic method of compound I-24, using "isobutyric anhydride" instead of "acetic anhydride" therein, compound I-25 was prepared:

[0433]

[0434] 1 H NMR (400 MHz, MeOD) δ 7.79 (dd, J = 7.9, 3.0 Hz, 1H), 6.47 (d, J = 17.7 Hz, 1H), 6.11 (d, J = 7.9 Hz, 1H), 5.37 (dd, J = 17.1, 3.4 Hz, 1H), 4.54 - 4.37 (m, 2H), 4.35 (dd, J = 7.3, 2.8 Hz, 1H), 3.73 - 3.68 (m, 1H), 2.76 - 2.66 (m, 1H), 2.66 - 2.56 (m, 1H), 1.24 (d, J = 7.0 Hz, 6H), 1.20 - 1.16 (m, 6H).

[0435] 13C NMR (101 MHz, MeOD) δ 176.74, 174.98, 162.74, 151.71, 143.60 (d, J = 6.2 Hz), 94.78, 93.50 (d, J = 187.6 Hz), 86.58 (d, J = 18.2 Hz), 83.59 (d, J = 9.2 Hz), 80.15, 75.56 (d, J = 35.2 Hz), 72.51 (d, J = 28.8 Hz), 62.07, 33.61 (d, J = 19.5 Hz), 17.96, 17.90, 17.84, 17.59.

[0436] 19 F NMR (376 MHz, MeOD) δ -160.13 (s).

[0437] Using the synthetic method of compound 1-24, using "pivalic anhydride" instead of "acetic anhydride" therein, the following compound was prepared:

[0438]

[0439] 1 H NMR (400 MHz, MeOD) δ 7.63 (dd, J = 7.7, 3.0 Hz, 1H), 6.50 (d, J = 18.2 Hz, 1H), 5.95 (d, J = 7.7 Hz, 1H), 5.33 (dd, J = 17.3, 3.6 Hz, 1H), 4.50 - 4.32 (m, 2H), 4.32 - 4.26 (m, 1H), 3.67 (d, J = 5.9 Hz, 1H), 1.27 (s, 9H), 1.22 (s, 9H).

[0440] 13 C NMR (101 MHz, MeOD) δ 178.07, 176.39, 165.54, 155.65, 142.21 (d, J = 6.5 Hz), 94.90, 93.56 (d, J = 187.4 Hz), 86.58 (d, J = 18.2 Hz), 83.26 (d, J = 9.4 Hz), 79.75, 75.63 (d, J = 35.7 Hz), 72.84 (d, J = 28.9 Hz), 62.20, 38.52, 38.22, 26.06 (d, J = 8.3 Hz).

[0441] 19 F NMR (376 MHz, MeOD) δ -160.14 (s).

[0442] Using the synthetic method of compound 1-24, using "propionic anhydride" instead of "acetic anhydride" therein, the following compound was prepared:

[0443]

[0444] 1 H NMR (400 MHz, MeOD) δ 7.80 (dd, J = 7.9, 3.0 Hz, 1H), 6.46 (d, J = 17.7 Hz, 1H), 6.12 (d, J = 7.9 Hz, 1H), 5.38 (dd, J = 16.9, 3.4 Hz, 1H), 4.53 - 4.39 (m, 2H), 4.38 - 4.35 (m, 1H), 3.69 (d, J = 5.9 Hz, 1H), 2.49 (q, J = 7.5, 1.6 Hz, 2H), 2.40 (q, J = 7.5 Hz, 2H), 1.18 (t, J = 7.5 Hz, 3H), 1.13 (t, J = 7.6 Hz, 3H).

[0445] 13 C NMR (101 MHz, MeOD) δ 174.22, 172.53, 162.57, 151.49, 143.74 (d, J = 6.1 Hz), 94.77, 93.48 (d, J = 187.6 Hz), 86.56 (d, J = 18.2 Hz), 83.44 (d, J = 9.2 Hz), 80.18, 75.81 (d, J = 35.1 Hz), 72.47 (d, J = 29.2 Hz), 72.32, 62.08, 26.77, 26.71, 7.93, 7.81.

[0446] 19 F NMR (376 MHz, MeOD) δ -160.62 (s).

[0447] Using the synthetic method of compound I-24, using "valeric anhydride" instead of "acetic anhydride" therein, the following compound was prepared:

[0448]

[0449] 1 H NMR (400 MHz, MeOD) δ 7.83 (dd, J = 7.9, 3.0 Hz, 1H), 6.45 (d, J = 17.5 Hz, 1H), 6.13 (d, J = 7.9 Hz, 1H), 5.38 (dd, J = 16.9, 3.4 Hz, 1H), 4.53 - 4.38 (m, 2H), 4.38 - 4.35 (m, 1H), 3.71 (d, J = 6.0 Hz, 1H), 2.48 (t, J = 7.4 Hz, 2H), 2.38 (t, J = 7.4 Hz, 2H), 1.69 - 1.58 (m, 4H), 1.43 - 1.33 (m, 4H), 0.97 - 0.90 (m, 6H).

[0450] 13 C NMR (101 MHz, MeOD) δ 173.50, 171.76, 161.80, 150.11, 144.11 (d, J = 6.2 Hz), 94.55, 93.45 (d, J = 187.7 Hz), 86.58 (d, J = 18.1 Hz), 83.59 (d, J = 9.4 Hz), 80.27, 75.78 (d, J = 35.2 Hz), 72.41 (d, J = 28.8 Hz), 61.99, 33.13, 33.06, 26.62, 26.45, 21.83, 21.79, 12.67, 12.64.

[0451] 19 F NMR (376 MHz, MeOD) δ -160.41 (s).

[0452] Using the synthetic method of compound I-24, using "cyclohexanecarbonyl chloride" instead of "acetic anhydride" therein, compound I-25 was prepared:

[0453]

[0454] 1 H NMR (400 MHz, MeOD) δ 7.70 (dd, J = 7.7, 3.0 Hz, 1H), 6.48 (d, J = 17.9 Hz, 1H), 6.03 (t, J = 8.2 Hz, 1H), 5.34 (dd, J = 17.0, 3.5 Hz, 1H), 4.51 - 4.33 (m, 2H), 4.33 - 4.28 (m, 1H), 3.68 (d, J = 5.9 Hz, 1H), 2.51 - 2.33 (m, 2H), 2.01 - 1.88 (m, 4H), 1.80 - 1.63 (m, 6H), 1.52 - 1.27 (m, 10H).

[0455] 13 C NMR (101 MHz, MeOD) δ 175.57, 173.84, 164.38, 154.07, 142.84 (d, J = 6.0 Hz), 94.95 (d, J = 16.5 Hz), 93.52 (d, J = 187.6 Hz), 86.61 (d, J = 18.2 Hz), 83.39 (d, J = 9.6 Hz), 79.92, 75.56 (d, J = 35.4 Hz), 72.73 (d, J = 29.1 Hz), 61.98, 42.81, 42.50, 28.82, 28.73, 28.66, 28.45, 25.47, 25.42, 25.02, 24.89.

[0456] 19 F NMR (376 MHz, MeOD) δ -160.24 (d, J = 28.1 Hz).

[0457] Using the synthetic method of compound I-24, using "tetrahydropyran-4- formic acid chloride" to replace "acetic anhydride" therein, compound I-25 was prepared:

[0458]

[0459] 1 H NMR (400 MHz, MeOD) δ 7.69 (dd, J = 7.7, 3.0 Hz, 1H), 6.49 (d, J = 18.1 Hz, 1H), 6.02 (d, J = 7.7 Hz, 1H), 5.38 (dd, J = 16.9, 3.5 Hz, 1H), 4.55 - 4.39 (m, 2H), 4.39 - 4.33 (m, 1H), 3.99 - 3.86 (m, 4H), 3.70 (d, J = 5.9 Hz, 1H), 3.53 - 3.42 (m, 4H), 2.80 - 2.63 (m, 2H), 1.98 - 1.71 (m, 8H).

[0460] 13 C NMR (101 MHz, MeOD) δ 174.18, 172.58, 164.64, 154.51, 142.68 (d, J = 6.4 Hz), 95.02, 93.48 (d, J = 187.5 Hz), 86.56 (d, J = 18.0 Hz), 83.52 (d, J = 9.4 Hz), 79.79, 75.72 (d, J = 35.4 Hz), 72.72 (d, J = 29.1 Hz), 66.57, 66.55, 66.55, 66.44, 62.24, 39.63, 39.41, 28.52, 28.43, 28.35, 28.10.

[0461] 19 F NMR (376 MHz, MeOD) δ -160.51.

[0462] Using the synthetic method of compound I-24, using "benzoyl chloride" to replace "acetic anhydride" therein, compound I-26 was prepared:

[0463]

[0464] 1H NMR (400 MHz, MeOD) δ 8.13 - 8.03 (m, 4H), 7.68 - 7.58 (m, 3H), 7.53 - 7.44 (m, 4H), 6.67 (d, J = 18.2 Hz, 1H), 5.87 (d, J = 7.6 Hz, 1H), 5.73 (dd, J = 17.3, 3.7 Hz, 1H), 4.76 (d, J = 4.6 Hz, 2H), 4.66 - 4.57 (m, 1H), 3.60 (d, J = 5.9 Hz, 1H).

[0465] 13 C NMR (101 MHz, MeOD) δ 166.15, 166.02, 164.77, 156.18, 142.02 (d, J = 6.4 Hz), 133.72, 133.20, 129.63, 129.43, 129.31, 128.69, 128.43, 128.31, 94.95, 93.75 (d, J = 187.6 Hz), 86.75 (d, J = 18.3 Hz), 83.30 (d, J = 9.2 Hz), 79.74, 77.05 (d, J = 35.9 Hz), 72.96 (d, J = 29.3 Hz), 62.88.

[0466] 19 F NMR (376 MHz, MeOD) δ -160.37 (s).

[0467] Using the synthetic method of compound I-24, using "4-trifluoromethylbenzoyl chloride" to replace "acetic anhydride" therein, the following compound was prepared:

[0468]

[0469] 1 H NMR (400 MHz, MeOD) δ 8.25 (dd, J = 23.2, 8.1 Hz, 4H), 7.86 - 7.76 (m, 5H), 6.68 (d, J = 17.7 Hz, 1H), 6.07 (d, J = 7.8 Hz, 1H), 5.80 (dd, J = 17.2, 3.7 Hz, 1H), 4.87 - 4.79 (m, 2H), 4.78 - 4.72 (m, 1H), 3.71 (d, J = 5.9 Hz, 1H).

[0470] 13C NMR (101 MHz, MeOD) δ 164.88, 163.58, 163.12, 152.26, 143.36 (d, J = 6.2 Hz), 143.36 (d, J = 6.2 Hz), 134.96, 134.57 (d, J = 13.1 Hz), 134.18, 132.95, 132.15, 130.31, 129.99, 125.88 - 125.11 (m), 125.02 (d, J = 5.7 Hz), 122.32 (d, J = 6.1 Hz), 94.96, 93.65 (d, J = 187.8 Hz), 86.74 (d, J = 18.1 Hz), 83.95 (d, J = 9.4 Hz), 79.76, 77.35 (d, J = 36.0 Hz), 72.52 (d, J = 29.3 Hz), 63.36.

[0471] 19 F NMR (376 MHz, MeOD) δ -64.61 (s), -64.69 (s), -160.19 (s).

[0472] Using the synthetic method of compound I-24, using "4-methoxybenzoyl chloride" to replace "acetic anhydride" therein, the following compound was prepared:

[0473]

[0474] 1 H NMR (400 MHz, MeOD) δ 8.08 - 7.97 (m, 4H), 7.62 (dd, J = 7.6, 3.1 Hz, 1H), 7.03 - 6.95 (m, 4H), 6.65 (d, J = 18.2 Hz, 1H), 5.86 (d, J = 7.6 Hz, 1H), 5.72 - 5.62 (m, 1H), 4.74 - 4.65 (m, 2H), 4.58 - 4.52 (m, 1H), 3.87 (s, 3H), 3.85 (s, 3H), 3.57 (d, J = 5.9 Hz, 1H).

[0475] 13C NMR (101 MHz, MeOD) δ 166.10, 165.96, 164.50, 164.43, 164.02, 156.26, 142.01 (d, J = 6.5 Hz), 131.83, 131.44, 121.54, 120.75, 113.66, 113.52, 94.88, 93.80 (d, J = 187.5 Hz), 86.76 (d, J = 18.2 Hz), 83.13 (d, J = 9.4 Hz), 79.84, 76.85 (d, J = 35.6 Hz), 73.04 (d, J = 29.4 Hz), 62.57, 54.73, 54.65.

[0476] 19 F NMR (376 MHz, MeOD) δ -160.23 (s).

[0477] Using the synthetic method of compound I-24, using "furoyl chloride" instead of "acetic anhydride" therein, the following compound was prepared:

[0478]

[0479] 1 H NMR (400 MHz, MeOD) δ 7.89 (dd, J = 7.9, 2.9 Hz, 1H), 7.83 (d, J = 0.8 Hz, 1H), 7.78 (d, J = 0.8 Hz, 1H), 7.42 (d, J = 3.1 Hz, 1H), 7.30 (d, J = 3.1 Hz, 1H), 6.68 - 6.62 (m, 2H), 6.59 (d, J = 17.3 Hz, 1H), 6.11 (d, J = 7.9 Hz, 1H), 5.68 (dd, J = 16.9, 3.7 Hz, 1H), 4.80 - 4.65 (m, 2H), 4.65 - 4.60 (m, 1H), 3.67 (d, J = 5.9 Hz, 1H).

[0480] 13C NMR (101 MHz, MeOD) δ 162.12, 158.14, 156.41, 150.73, 148.11, 147.40, 143.91 (d, J = 6.2 Hz), 144.22 - 143.70 (m), 143.16, 119.81, 118.71, 111.96 (d, J = 18.4 Hz), 94.72, 93.48 (d, J = 188.6 Hz), 86.77 (d, J = 18.4 Hz), 86.77 (d, J = 18.4 Hz), 83.85 (d, J = 9.3 Hz), 83.85 (d, J = 9.3 Hz), 79.97, 76.37 (d, J = 36.0 Hz), 72.34 (d, J = 29.2 Hz), 62.40.

[0481] 19 F NMR (376 MHz, MeOD) δ -159.88 (s).

[0482] Using the synthetic method of compound I-24, using "2,4-dichlorobenzoyl chloride" to replace "acetic anhydride" therein, the following compound was prepared:

[0483]

[0484] 1 H NMR (400 MHz, MeOD) δ 7.89 (d, J = 8.5 Hz, 1H), 7.79 (d, J = 8.5 Hz, 1H), 7.67 (dd, J = 7.7, 2.8 Hz, 1H), 7.45 (dd, J = 16.5, 1.5 Hz, 2H), 7.36 - 7.25 (m, 2H), 6.50 (d, J = 17.8 Hz, 1H), 5.93 (d, J = 7.8 Hz, 1H), 5.62 (dd, J = 16.5, 3.4 Hz, 1H), 4.73 - 4.59 (m, 2H), 4.59 - 4.52 (m, 1H), 3.61 (d, J = 5.9 Hz, 1H).

[0485] 13C NMR (101 MHz, MeOD) δ 164.06, 163.67, 162.38, 153.22, 143.10 (d, J = 6.1 Hz), 139.24, 138.56, 135.26, 134.63, 133.07, 132.72, 130.88, 130.64, 127.58, 127.25, 127.13, 126.42, 95.12, 93.44 (d, J = 188.3 Hz), 86.70 (d, J = 18.0 Hz), 84.08 (d, J = 9.3 Hz), 79.54, 77.26 (d, J = 35.8 Hz), 72.62 (d, J = 29.2 Hz), 63.31.

[0486] 19 F NMR (376 MHz, MeOD) δ -160.47 (s).

[0487] Using the synthetic method of compound I-24, using "propyl chloroformate" instead of "acetic anhydride" therein, the following compound was prepared:

[0488]

[0489] 1 H NMR (400 MHz, MeOD) δ 7.66 - 7.57 (m, 1H), 6.50 (d, J = 18.1 Hz, 1H), 5.91 (d, J = 7.6 Hz, 1H), 5.22 (dd, J = 16.6, 3.8 Hz, 1H), 4.54 - 4.43 (m, 2H), 4.40 - 4.34 (m, 1H), 4.25 - 4.14 (m, 2H), 4.12 (t, J = 6.6 Hz, 2H), 3.64 (d, J = 5.9 Hz, 1H), 1.77 - 1.64 (m, 4H), 1.02 - 0.92 (m, 6H).

[0490] 13 C NMR (101 MHz, MeOD) δ 166.13, 156.21, 155.16, 153.70, 142.06 (d, J = 6.5 Hz), 94.86, 93.24 (d, J = 188.0 Hz), 86.57 (d, J = 18.3 Hz), 83.29 (d, J = 9.5 Hz), 79.08, 78.91 (d, J = 33.8 Hz), 72.48 (d, J = 29.2 Hz), 70.40, 69.69, 65.32, 21.63 (d, J = 9.4 Hz), 9.06.

[0491] 19F NMR (376 MHz, MeOD) δ -160.79 (s).

[0492] Using the synthetic method of compound I-24, using "isopropyl chloroformate" to replace "acetic anhydride" therein, compound I-25 was prepared:

[0493]

[0494] 1 H NMR (400 MHz, MeOD) δ 7.56 - 7.48 (m, 1H), 6.39 (d, J = 18.1 Hz, 1H), 5.80 (d, J = 7.6 Hz, 1H), 5.12 (dd, J = 16.6, 3.8 Hz, 1H), 4.86 - 4.82 (m, 1H), 4.78 - 4.72 (m, 1H), 4.44 - 4.30 (m, 2H), 4.29 - 4.22 (m, 1H), 3.55 (d, J = 5.9 Hz, 1H), 1.25 - 1.20 (m, 12H).

[0495] 13 C NMR (101 MHz, MeOD) δ 166.17, 156.26, 154.56, 153.07, 142.06 (d, J = 6.6 Hz), 94.81, 93.26 (d, J = 188.1 Hz), 86.55 (d, J = 18.3 Hz), 83.28 (d, J = 9.2 Hz), 79.06, 78.85 (d, J = 36.2 Hz), 73.37, 72.72, 72.37 (d, J = 11.9 Hz), 65.06, 20.56, 20.54, 20.46.

[0496] 19 F NMR (376 MHz, MeOD) δ -160.90 (s).

[0497] Using the synthetic method of compound I-24, using "allyl chloroformate" to replace "acetic anhydride" therein, compound I-26 was prepared:

[0498]

[0499] 1H NMR (400 MHz, MeOD) δ 7.60 (dd, J = 7.6, 3.1 Hz, 1H), 6.51 (d, J = 18.1 Hz, 1H), 6.04 - 5.91 (m, 2H), 5.90 (d, J = 7.6 Hz, 1H), 5.43 - 5.20 (m, 5H), 4.76 - 4.67 (m, 2H), 4.65 (d, J = 5.6 Hz, 2H), 4.53 - 4.47 (m, 2H), 4.39 (dd, J = 8.7, 4.4 Hz, 1H), 3.64 (d, J = 5.9 Hz, 1H).

[0500] 13 C NMR (101 MHz, MeOD) δ 166.18, 156.26, 154.86, 153.45, 142.04 (d, J = 6.5 Hz), 131.69, 131.26, 118.12, 117.66, 94.87, 93.20 (d, J = 187.9 Hz), 86.56 (d, J = 18.2 Hz), 83.37 (d, J = 9.2 Hz), 79.08 (d, J = 36.2 Hz), 79.01, 72.43 (d, J = 29.3 Hz), 68.76 (d, J = 67.3 Hz), 65.48.

[0501] 19 F NMR (376 MHz, MeOD) δ -160.84 (s).

[0502] Using the synthetic method of compound I-24, using "phenyl chloroformate" to replace "acetic anhydride" therein, the following compound was prepared:

[0503]

[0504] 1 H NMR (400 MHz, MeOD) δ 7.51 (dd, J = 7.6, 3.1 Hz, 1H), 7.35 - 7.27 (m, 4H), 7.23 - 7.12 (m, 4H), 7.12 - 7.04 (m, 2H), 6.50 (d, J = 18.1 Hz, 1H), 5.79 (d, J = 7.6 Hz, 1H), 5.29 (dd, J = 16.4, 3.8 Hz, 1H), 4.60 - 4.51 (m, 2H), 4.50 - 4.45 (m, 1H), 3.71 (d, J = 5.9 Hz, 1H).

[0505] 13C NMR (101 MHz, MeOD) δ 166.16, 156.24, 153.64, 152.35, 151.16 (d, J = 12.7 Hz), 142.03, 141.97, 129.34, 129.25, 126.21, 125.96, 120.78, 120.67, 94.97, 93.22 (d, J = 188.3 Hz), 86.61 (d, J = 18.2 Hz), 83.76 (d, J = 9.3 Hz), 79.65 (d, J = 36.4 Hz), 78.70, 72.49 (d, J = 29.1 Hz), 66.09.

[0506] 19 F NMR (376 MHz, MeOD) δ -160.90 (s).

[0507] Using the synthetic method of compound I-24, using "benzyl chloroformate" to replace "acetic anhydride" therein, the following compound was prepared:

[0508]

[0509] 1 H NMR (400 MHz, MeOD) δ 7.53 (dd, J = 7.6, 3.1 Hz, 1H), 7.44 - 7.29 (m, 10H), 6.48 (d, J = 18.3 Hz, 1H), 5.81 (d, J = 7.6 Hz, 1H), 5.29 - 5.16 (m, 5H), 4.56 - 4.44 (m, 2H), 4.41 - 4.33 (m, 1H), 3.44 (d, J = 5.9 Hz, 1H).

[0510] 13 C NMR (101 MHz, MeOD) δ 166.11, 156.21, 155.02, 153.57, 142.01 (d, J = 6.6 Hz), 135.49, 135.01, 128.26 (dd, J = 10.3, 8.1 Hz), 127.86, 94.89, 93.18 (d, J = 188.0 Hz), 86.49 (d, J = 18.2 Hz), 83.24 (d, J = 9.1 Hz), 79.12 (d, J = 36.3 Hz), 78.99, 72.35 (d, J = 28.8 Hz), 70.28, 69.56, 65.53.

[0511] 19 F NMR (376 MHz, MeOD) δ -161.07 (s).

[0512] Example 23: Preparation of ((2R, 3R, 4S, 5R)-3-acetyloxy-5-(2,4-dioxo-3,4- dihydropyrimidin-1 (2H)-yl)-4-ethynyl-4-fluorotetrahydrofuran-2-yl) methyl acetate (the compound shown in Formula I-41)

[0513]

[0514] Compound 1-((2R, 3S, 4R, 5R)-3-ethynyl-3-fluoro-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-2-yl)pyrimidine-2,4(1H, 3H)-dione (35.00 mg, 129.53 μmol) was dissolved in super dry dichloromethane (0.50 mL), and triethylamine (39.61 μL, 284.96 μmol), acetic anhydride (26.76 μL, 284.96 μmol) and 4-dimethylaminopyridine (0.78 mg, 7.45 μmol) were added successively under ice bath condition. It was stirred at room temperature, and thin layer chromatography was used to monitor the reaction for 1.5 h until it was completed. The reaction system was diluted with ethyl acetate, and washed with water for 3 times, citric acid solution for 3 times, saturated sodium bicarbonate solution for 3 times, and saturated brine for 1 time, and dried over anhydrous sodium sulfate. The solvent was removed by concentration under reduced pressure, and the obtained crude product was purified by silica gel column chromatography (dichloromethane / methanol = 45 / 1) to obtain the product ((2R, 3R, 4S, 5R)-3-acetyloxy-5-(2,4-dioxo-3,4-dihydropyrimidin-1 (2H)-yl)-4-ethynyl-4-fluorotetrahydrofuran-2-yl) methyl acetate (35.25 mg, 76.81%) as a white solid.

[0515] 1 H NMR (400 MHz, MeOD) δ 7.68 (m, 1H), 6.42 (d, J = 18.1 Hz, 1H), 5.78 (d, J = 8.0 Hz, 1H), 5.39 (dd, J = 13.5 Hz, 1H), 4.50 - 4.43 (m, 2H), 4.40 - 4.37 (m, 1H), 3.71 (d, J = 5.9 Hz, 1H), 2.22 (s, 3H), 2.13 (s, 3H).

[0516] 13 C NMR (101 MHz, MeOD) δ 170.87, 169.17, 164.08, 150.53, 141.26 (d, J = 7.0 Hz), 101.58, 93.61 (d, J = 187.5 Hz), 86.00 (d, J = 17.6 Hz), 83.24 (d, J = 8.8 Hz), 79.80, 76.04 (d, J = 35.9 Hz), 72.54 (d, J = 29.4 Hz), 62.23, 19.26.

[0517] 19 F NMR (376 MHz, MeOD) δ -161.00.

[0518] Using the synthetic method of compound I-41, by replacing "acetic anhydride" therein with "propionic anhydride", the following compounds can be prepared, respectively:

[0519]

[0520] 1 H NMR (400 MHz, MeOD) δ 7.66 (dd, J = 8.2, 3.1 Hz, 1H), 6.42 (d, J = 18.1 Hz, 1H), 5.79 (d, J = 8.3 Hz, 1H), 5.41 (dd, J = 17.1, 3.7 Hz, 1H), 4.54 - 4.45 (m, 2H), 4.40 - 4.37 (m, 1H), 3.71 (d, J = 5.9 Hz, 1H), 2.56 - 2.51 (m, 2H), 2.47 - 2.42 (m, 2H), 1.24 - 1.16 (m, 6H).

[0521] 13 C NMR (101 MHz, MeOD) δ 174.19, 172.56, 164.06, 150.52, 141.28 (d, J = 6.6 Hz), 101.58, 93.66 (d, J = 187.5 Hz), 86.02 (d, J = 18.3 Hz), 83.28 (d, J = 9.4 Hz), 79.86, 75.82 (d, J = 35.1 Hz), 72.60 (d, J = 29.4 Hz), 62.11, 26.76 (d, J = 7.4 Hz), 7.89 (d, J = 11.0 Hz).

[0522] 19 F NMR (376 MHz, MeOD) δ -160.71.

[0523] Using the synthetic method of compound I-41, by replacing "acetic anhydride" therein with "butyric anhydride", the following compound can be prepared:

[0524]

[0525] 1H NMR (400 MHz, MeOD) δ 7.65 (dd, J = 8.2, 3.1 Hz, 1H), 6.40 (d, J = 18.1 Hz, 1H), 5.77 (d, J = 8.2 Hz, 1H), 5.40 (dd, J = 17.1, 3.6 Hz, 1H), 4.52 - 4.48 (m, 1H), 4.43 - 4.35 (m, 2H), 3.70 (d, J = 5.9 Hz, 1H), 2.50 - 2.46 (m, 2H), 2.41 - 2.37 (m, 2H), 1.74 - 1.67 (m, 4H), 1.03 - 0.98 (m, 6H).

[0526] 13 C NMR (101 MHz, MeOD) δ 173.32, 171.64, 164.06, 150.51, 141.28 (d, J = 7.2 Hz), 101.54, 93.65 (d, J = 187.5 Hz), 86.03 (d, J = 18.2 Hz), 83.34 (d, J = 8.9 Hz), 79.87, 75.81 (d, J = 35.2 Hz), 72.62 (d, J = 29.5 Hz), 62.00, 35.26 (d, J = 5.3 Hz), 17.81, 12.53.

[0527] 19 F NMR (376 MHz, MeOD) δ -160.63.

[0528] Using the synthetic method of compound I-41, using "isobutyric anhydride" instead of "acetic anhydride" therein, the following compound was prepared:

[0529]

[0530] 1 H NMR (400 MHz, MeOD) δ 7.67 - 7.64 (m, 1H), 6.42 (d, J = 18.1 Hz, 1H), 5.78 (d, J = 8.2 Hz, 1H), 5.42 - 5.37 (m, 1H), 4.52 - 4.48 (m, 1H), 4.43 - 4.35 (m, 2H), 3.73 (d, J = 5.9 Hz, 1H), 2.75 - 2.64 (m, 2H), 1.30 - 1.21 (m, 12H).

[0531] 13C NMR (101 MHz, MeOD) δ 176.70, 174.99, 164.04, 150.51, 141.23 (d, J = 6.6 Hz), 101.55, 93.68 (d, J = 188.3 Hz), 86.04 (d, J = 17.7 Hz), 83.43 (d, J = 8.9 Hz), 79.85, 75.56 (d, J = 35.8 Hz), 72.62 (d, J = 29.4 Hz), 62.08, 34.17 - 33.20 (m), 17.88 - 17.76 (m).

[0532] 19 F NMR (376 MHz, MeOD) δ -160.26.

[0533] Using the synthetic method of compound I-41, using "valeric anhydride" instead of "acetic anhydride" therein, the following compound was prepared:

[0534]

[0535] 1 H NMR (400 MHz, MeOD) δ 7.67 (dd, 1 H), 6.42 (d, J = 18.1 Hz, 1 H), 5.79 (d, J = 8.2 Hz, 1 H), 5.44 - 5.39 (m, 1 H), 4.53 - 4.49 (m, 1 H), 4.44 - 4.36 (m, 2H), 3.72 (d, J = 5.9 Hz, 1 H), 2.54 - 2.50 (m, 2H), 2.44 - 2.41 (m, 2H), 1.71 - 1.63 (m, 4H), 1.46 - 1.40 (m, 4H), 1.00 - 0.96 (m, 6H).

[0536] 13 C NMR (101 MHz, MeOD) δ 173.47, 171.79, 164.03, 150.52, 141.27 (d, J = 6.6 Hz), 101.57, 93.65 (d, J = 187.5 Hz), 86.03 (d, J = 18.5 Hz), 83.35 (d, J = 8.9 Hz), 79.87, 75.82 (d, J = 34.9 Hz), 72.62 (d, J = 29.4 Hz), 62.03, 33.12 (d, J = 6.5 Hz), 26.55 (d, J = 18.2 Hz), 21.82 (d, J = 3.4 Hz), 12.66 (d, J = 3.2 Hz).

[0537] 19 F NMR (376 MHz, MeOD) δ -160.56.

[0538] Using the synthetic method of compound I-41, by replacing "acetic anhydride" in it with "cyclohexanecarbonyl anhydride", compound I-42 was prepared:

[0539]

[0540] 1 H NMR (400 MHz, MeOD) δ 7.65 (dd, J = 8.2, 3.1 Hz, 1H), 6.43 (d, J = 18.1 Hz, 1H), 5.78 (d, J = 8.2 Hz, 1H), 5.41 - 5.36 (m, 1H), 4.53 - 4.49 (m, 1H), 4.41 - 4.34 (m, 2H), 3.75 (d, J = 5.9 Hz, 1H), 1.32 - 1.26 (m, 19H).

[0541] 13 C NMR (101 MHz, MeOD) δ 178.04, 176.34, 164.01, 150.50, 141.15 (d, J = 6.6 Hz), 101.56, 93.70 (d, J = 187.5 Hz), 86.02 (d, J = 18.4 Hz), 83.49 (d, J = 9.2 Hz), 79.90, 75.50 (d, J = 35.8 Hz), 72.65 (d, J = 29.4 Hz), 62.19, 38.38 (d, J = 29.7 Hz), 26.20 - 26.04 (m).

[0542] 19 F NMR (376 MHz, MeOD) δ -160.00.

[0543] Using the synthetic method of compound I-41, by replacing "acetic anhydride" in it with "cyclohexanecarbonyl anhydride", compound I-42 was prepared:

[0544]

[0545] 1 H NMR (400 MHz, MeOD) δ 7.65 (dd, J = 8.2, 3.1 Hz, 1H), 6.41 (d, J = 18.0 Hz, 1H), 5.77 (d, J = 8.2 Hz, 1H), 5.38 (dd, J = 17.2, 3.6 Hz, 1H), 4.52 - 4.47 (m, 1H), 4.40 - 4.33 (m, 2H), 3.72 (d, J = 5.9 Hz, 1H), 2.49 - 2.41 (m, 1H), 2.35 - 2.26 (m, 1H), 1.92 - 1.70 (m, 10H), 1.47 - 1.33 (m, 10H).

[0546] 13C NMR (101 MHz, MeOD) δ 178.55, 175.54, 173.83, 164.03, 150.51, 141.25 (d, J = 6.6 Hz), 101.55, 93.67 (d, J = 187.5 Hz), 86.06 (d, J = 17.7 Hz), 83.46 (d, J = 9.6 Hz), 79.87, 75.50 (d, J = 35.0 Hz), 72.65 (d, J = 29.4 Hz), 61.98, 42.93 - 42.68 (m), 28.90 - 28.76 (m), 25.59 - 25.36 (m).

[0547] 19 F NMR (376 MHz, MeOD) δ -160.19.

[0548] Using the synthetic method of compound I-41, using "octanoyl chloride" instead of "acetic anhydride" therein, the following compound was prepared:

[0549]

[0550] 1 H NMR (400 MHz, MeOD) δ 7.67 - 7.62 (m, 1H), 6.39 (d, J = 18.0 Hz, 1H), 5.75 (d, J = 8.2 Hz, 1H), 5.38 (dd, J = 17.2, 3.4 Hz, 1H), 4.53 - 4.47 (m, 1H), 4.40 - 4.33 (m, 2H), 3.69 (d, J = 6.0 Hz, 1H), 2.51 - 2.27 (m, 6H), 1.72 - 1.60 (m, 6H), 1.33 (s, 20H), 0.92 (d, J = 5.5 Hz, 8H).

[0551] 13 C NMR (101 MHz, MeOD) δ 173.48, 171.78, 164.05, 150.51, 141.31 (d, J = 6.8 Hz), 101.55, 93.64 (d, J = 187.5 Hz), 86.12, 83.31 (d, J = 9.6 Hz), 79.90, 75.80 (d, J = 35.0 Hz), 72.61 (d, J = 28.9 Hz), 62.00, 33.79 - 33.19 (m), 32.43, 31.46, 28.70, 24.90 - 24.36 (m), 22.26, 13.01.

[0552] 19 F NMR (376 MHz, MeOD) δ -160.57.

[0553] Using the synthetic method of compound 1-41, using "benzoyl chloride" to replace "acetic anhydride" therein, compound 1-42 was prepared:

[0554]

[0555] 1 H NMR (400 MHz, MeOD) δ 8.11 - 8.02 (m, 4H), 7.66 (d, J = 7.8 Hz, 1H), 7.63 - 7.58 (m, 2H), 7.51 - 7.45 (m, 4H), 6.54 (d, J = 18.0 Hz, 1H), 5.73 (dd, J = 17.6, 3.9 Hz, 1H), 5.66 (d, J = 8.1 Hz, 1H), 4.75 (d, J = 4.6 Hz, 2H), 4.63 (q, 1H), 3.65 (d, J = 5.9 Hz, 1H).

[0556] 13 C NMR (101 MHz, MeOD) δ 166.13, 164.73, 164.05, 150.54, 141.23 (d, J = 6.5 Hz), 134.23 - 132.36 (m), 129.91 - 127.62 (m), 101.55, 93.89 (d, J = 187.5 Hz), 86.19 (d, J = 17.7 Hz), 83.57 (d, J = 9.7 Hz), 79.93, 76.88 (d, J = 35.9 Hz), 72.70 (d, J = 29.3 Hz), 62.81.

[0557] 19 F NMR (376 MHz, MeOD) δ -160.01.

[0558] Using the synthetic method of compound 1-41, using "p-methoxybenzoyl chloride" to replace "acetic anhydride" therein, compound 1-42 was prepared:

[0559]

[0560] 1 H NMR (400 MHz, MeOD) δ 8.05 - 7.98 (m, 4H), 7.63 (dd, J = 8.2, 3.2 Hz, 1H), 7.01 - 6.95 (m, 4H), 6.52 (d, J = 17.9 Hz, 1H), 5.70 - 5.67 (m, 1H), 5.65 (d, J = 3.8 Hz, 1H), 4.70 (d, J = 4.7 Hz, 2H), 4.59 - 4.56 (m, 1H), 3.85 (d, J = 7.8 Hz, 6H), 3.63 (d, J = 5.9 Hz, 1H).

[0561] 13 C NMR (101 MHz, MeOD) δ 165.94, 164.25 (d, J = 39.1 Hz), 150.53, 141.25 (d, J = 6.6 Hz), 132.51 - 130.99 (m), 121.09 (d, J = 81.7 Hz), 113.61 (d, J = 13.4 Hz), 101.54, 93.93 (d, J = 188.5 Hz), 86.19 (d, J = 17.7 Hz), 83.45 (d, J = 8.9 Hz), 80.07, 76.67 (d, J = 35.9 Hz), 72.78 (d, J = 29.4 Hz), 62.52, 54.69 (d, J = 7.6 Hz).

[0562] 19 F NMR (376 MHz, MeOD) δ -160.01.

[0563] Example 24: In vitro enzymatic characterization of NUSC001-TP molecular intervention of RNA synthesis in CCHFV RdRP system

[0564] Nucleoside drugs are usually developed in the form of prodrugs such as nucleoside derivatives or nucleoside monophosphate derivatives, which are converted into NTP effect molecules in cells after oral or injection, and directly intervene in the process of viral RdRP synthesizing RNA by simulating the natural substrate NTP of polymerase (K.A. Johnson, T. Dangerfield, Mechanisms of inhibition of viral RNA replication by nucleotide analogs. Enzymes, 49:39-62. doi:10.1016 / bs.enz.2021.07.001. (2021)). The NUSC001-TP molecule is an NTP form of the effect molecule of compound 15a (structure as shown below), in order to accurately detect whether the NUSC001-TP molecule can simulate the incorporation of CTP into the product chain and inhibit the subsequent synthesis in the CCHFV RdRP system, the present application also uses isotope-labeled [a- 32 P]ATP to characterize the process of NUSC001-TP intervention of RdRP.

[0565]

[0566] As Figure 1The sequence of template RNA T38 is 5'-GGGAGAUGAAAAUCUCCAACUUUUGAUUAUAUCCUUAA-3', which was prepared and purified by "T7 RNA polymerase-glmS ribozyme" method (Kieft and Batey. A general method for rapid and nondenaturing purification of RNAs. RNA, 10(6):988-95. doi: 10.1261 / rna.7040604. (2004); Batey and Kieft. Improved native affinity purification of RNA. RNA, 13(8): 1384-9. doi: 10.1261 / rna.528007. (2007)). The template RNA T38 was mixed with trinucleotide primer pGGA (P3, sequence is 5'-GGA-3', "p" means 5'-end is phosphate group) to get "T38 / P3" with final concentration of 1:20 molar concentration. In 10 μL system, 0.5 μM hook RNA (5'-UCUCAAAGAUAUCAAUCC-3', playing the role of promoter), 0.5 μM T38 / P3 (P3 concentration is 10 μM), 0.2 μM CCHFV L protein, 40 mM NaCl, 30 mM Tris (pH 7.5), 2 mM MnCl2, 5 mM TCEP, 40 μM ATP (A) containing [α-32P]ATP, 100 μM UTP (U) and / or 100 μM CTP (C) or NUSC001-TP were added, and incubated at 25°C for 1 h and 3 h respectively, and then terminated by adding Stop Solution (95% [v / v] formamide, 20 mM EDTA [pH 8.0], 0.02% [w / v] bromophenol blue, 0.02% [w / v] xylene cyanol). 32 P]ATP, 100 μM UTP (U) and / or 100 μM CTP (C) or NUSC001-TP were added, and incubated at 25°C for 1 h and 3 h respectively, and then terminated by adding Stop Solution (95% [v / v] formamide, 20 mM EDTA [pH 8.0], 0.02% [w / v] bromophenol blue, 0.02% [w / v] xylene cyanol).

[0567] The electrophoretogram of the experiment of NUSC001-TP molecule simulating CTP incorporation into product chain in CCHFV RdRP system is shown in Figure 1 Figure B: when only ATP and UTP were added in the reaction system, due to the existence of G:U mismatch, the main product length was 10 nt (B, lanes 2-3), and further extension of the 10 nt product could produce a small amount of 11-14 nt products; when ATP, UTP and CTP were added at the same time, the main product length of the reaction was 14 nt (B, lanes 4-5). Figure 1 B, lanes 2-3), and further extension of the 10 nt product could produce a small amount of 11-14 nt products; when ATP, UTP and CTP were added at the same time, the main product length of the reaction was 14 nt (B, lanes 4-5). Figure 1B, lanes 4-5); when ATP, UTP and NUSC001-TP were added simultaneously, the major product was 10 nt in length Figure 1 B, lanes 8-9), and this 10 nt product migrated slightly faster (positioned slightly lower in the gel) than the 10 nt major product in lanes 2-3, thus the 10 nt product in lanes 8-9 was judged to be the product after NUSC001-TP incorporation. Only a small amount of 11-14 nt products were observed in lanes 8-9, thus the NUSC001-TP incorporated product strand could greatly inhibit the subsequent synthesis, with strong strand termination properties. The 9 nt and 14 nt bands in lane 1 were RNA migration markers.

[0568] The above results show that the NUSC001-TP molecule exhibits good incorporation activity in the CCHF VRdRP system, and can greatly inhibit the RNA synthesis after its incorporation.

[0569] Example 25: In vitro enzymatic characterization of NUSC001-TP molecule intervention in RNA synthesis in SARS-CoV-2 RdRP system

[0570] (I) In vitro enzymatic characterization in SARS-CoV-2 RdRP system allowing only single NUSC001-TP incorporation on template

[0571] As Figure 2The sequence of the template RNA V10-15 is shown in FIG. A: 5'-GGGAGAUGAAAGUCUCCACCUCGUCUCUCGUCGAACAUCGUCGAACAUCGUCGAAA-3', which was prepared and purified by the "T7 RNA polymerase-glmS ribozyme" method. The template RNA V10-15 was mixed with a 10-nt primer (P10, sequence: 5'-UGUUCGACGAUGUUCGACGAUGUUCGACGA) at a final molar ratio of 1:3.1, incubated at 45 °C for 3 min, and then slowly cooled to room temperature (resulting in V10-15 / P10). In a 200-μL system, V10-15 / P10 (P10 concentration: 12.4 μM) was added at a final concentration of 4 μM, 6 μM SARS-CoV-2 nsp12-nsp8-nsp7 (nsp8 concentration: 12 μM, nsp7 concentration: 6 μM), 50 μM GTP, 100 μM ATP, 20 mM NaCl, 50 mM HEPES (pH 7.0), 5 mM MgCl2, 4 mM DTT, and the reaction was performed at 25 °C for 40 min. Then, 5 M NaCl was added to the above-mentioned 200-μL reaction system to a final concentration of 200 mM. After 19 μL of the above-mentioned reaction solution was added with 1 μL of CTP or 3'-dCTP or NUSC001-TP at an initial concentration of 6 mM, the reaction was performed at 25 °C for different time periods, and then terminated by adding 20 μL of Stop Solution (95% [v / v] formamide, 20 mM EDTA [pH 8.0], 0.02% [w / v] bromophenol blue). DNA complementary to the sequence of V10-15 was added to the sample at a molar ratio of 1:3, and incubated at 100 °C for 45 s, followed by slow cooling to room temperature. After polyacrylamide gel electrophoresis, imaging was performed after Stains-All (Sigma-Aldrich) staining (Liu, Q., Wu, J., Gong, P. Assessment of nucleotide / nucleoside analog intervention in primer-dependent viral RNA-dependent RNA polymerases. STAR Protoc 3, 101468. doi:10.1016 / j.xpro.2022.101468. eCollection (2022.)).

[0572] The gel electrophoresis image is shown in FIG. B: when the extension complex with a product length of 14 nt was obtained, CTP was continuously added, and a product with a length of 19 nt was synthesized due to the presence of GTP and ATP substrates Figure 2 FIG. B: when the extension complex with a product length of 14 nt was obtained, CTP was continuously added, and a product with a length of 19 nt was synthesized due to the presence of GTP and ATP substratesFigure 2 B, lanes 2-3); with the addition of 3′-deoxy-CTP (3′-dCTP), due to its forced chain termination effect, products with a maximum length of 15 nt can be synthesized. Figure 2 B, Lane 4): After adding NUSC001-TP and reacting for 10 minutes, the major product was 15 nt in length, and the minor product was a 19 nt product obtained by further synthesis after incorporating NUSC001-TP. Figure 2 B, lane 5). As reaction time increases, the 19nt product gradually increases, and the 15nt product gradually decreases, but at least half of the product is still 15nt at 120 minutes. Figure 2 B, lanes 5-9). This indicates that incorporating a single NUSC001-TP molecule into the SARS-CoV-2RdRP system can significantly inhibit subsequent synthesis, demonstrating chain termination properties.

[0573] (ii) In vitro enzymatic characterization in a SARS-CoV-2 RdRP system in which the template allows for continuous incorporation of NUSC001-TP.

[0574] like Figure 3 As shown in Figure A, the sequence of template RNA V10-15-1 is: 5′-GGGAGAUGAAAGUCUCCACGGGGUCUCUCGUCGAACAUCGUCGAACAUCGUCGAAA -3′. This template was prepared and purified using the "T7 RNA polymerase-glmS ribozyme" method. Template RNA V10-15-1 was mixed with 10 nt primer (P10) at a final molar ratio of 1:3.1, incubated at 45°C for 3 min, and then slowly cooled to room temperature. The experimental procedure is as follows. Figure 3 For step B, the method is the same as step 24 (one) of embodiment 2.

[0575] Electrophoresis images of in vitro enzymatic experiments in the SARS-CoV-2RdRP system are shown below. Figure 3 As shown in B: After obtaining an extended complex with a product length of 14 nt, further addition of CTP, due to the simultaneous presence of the GTP substrate, yielded a complex with a length of 19 nt. Figure 3 B, lane 2); with the addition of 3′-dCTP, due to its forced chain termination effect, products with a maximum length of 15 nt can be synthesized. Figure 3 B, lane 3), when NUSC001-TP is added, the product can be synthesized quickly up to 15 nt, and there is a significant immediate chain termination effect at 15 nt ( Figure 3 B, lanes 4-8). This indicates that the incorporation of NUSC001-TP molecules into this SARS-CoV-2RdRP system exhibits an immediate chain termination effect, preventing the synthesis from proceeding.

[0576] (iii) In vitro enzymatic characterization performed in SARS-CoV-2 RdRP system with template allowing single incorporation of nucleoside analog

[0577] The nucleoside molecule Sofosbuvir is a specific drug for hepatitis C virus. To compare with NUSC001-TP, we constructed an in vitro enzymatic characterization system of Sofosbuvir nucleoside interfering SARS-CoV-2 RdRP as a reference. Sofosbuvir nucleoside has the typical characteristics of immediate chain termination intervention (Fung, A., Jin, Z., Dyatkina, N., et al., Efficiency of incorporation and chain termination determines the inhibition potency of 2’-modified nucleotide analogs against hepatitis C virus polymerase. Antimicrobial Agents and Chemotherapy 58(7): 3636-3645. (2014)). As shown in Figure 6, the incorporation of Sofosbuvir nucleoside into the nascent RNA chain is very efficient, and the chain termination is also very efficient. The IC50 of Sofosbuvir nucleoside is 0.1 mM, which is much lower than that of NUSC001-TP. This is because the Sofosbuvir nucleoside has a more efficient chain termination intervention than NUSC001-TP. Figure 4The sequence of template RNA V10-1 is shown in FIG. A: 5'-GGGAGAUGAAAGUCUCCACCUCCUGUGUCGUCGAACAUCGUCGAACAUCGUCGAAA-3', which was prepared and purified by "T7 RNA polymerase-glmS ribozyme" method. After mixing template RNA V10-1 with 10 nt primer (P10) at a molar ratio of 1:3.1 final concentration, incubation at 45 °C for 3 min, and then slowly cooling at room temperature. In a 1.5 mL system, add V10-15 / P10 (P10 concentration is 31 mM) at a final concentration of 10 mM, 12 mM SARS-CoV-2 nsp12-nsp8-nsp7 (nsp8 concentration is 24 mM, nsp7 concentration is 12 mM), 300 mM CTP, 300 mM ATP, 50 mM NaCl, 50 mM HEPES (pH 7.0), 5 mM MgCl2, 4 mM DTT, and react at 25 °C for 120 min. After high-resolution ion exchange chromatography, remove NTP and free protein and RNA, and finally obtain a 14 nt extension complex sample at a concentration of 4 mM (buffer: 50 mM HEPES (pH 7.0), 100 mM NaCl, 4 mM MgCl2, 4 mM DTT). Take 19 mL of the above extension complex sample, add 1 mL of GTP or GTP, ATP or GTP, ATP, Sofosbuvir-TP at a final concentration of 100 mM, respectively, and react at 25 °C for different times. Then add 20 mL of termination reaction solution to terminate the reaction. Add V10-1 complementary DNA to the sample at a molar ratio of 1:3, incubate at 100 °C for 45 s, and then slowly cool to room temperature. After polyacrylamide gel electrophoresis, image after Stains-All staining.

[0578] The electropherogram of in vitro biochemical enzymology experiment of incorporation of Sofosbuvir molecules in the SARS-CoV-2 RdRP system is shown in FIG. B. Figure 4 As shown in FIG. B, when the 14 nt long extension complex product is obtained, the addition of GTP can obtain a 16 nt long product (FIG. B, lane 2), the addition of GTP and ATP can obtain a 19 nt long product (FIG. B, lanes 3-4), and the simultaneous addition of GTP, ATP and NTP form of Sofosbuvir (Sofosbuvir-TP) can at most obtain a 20 nt long product, indicating that the Sofosbuvir nucleoside has an immediate chain termination effect, which can block the subsequent synthesis after its incorporation (FIG. B, lanes 5-15). Figure 4 Figure 4 Figure 4

[0579] ​​​Based on the three sets of data in this embodiment, it can be seen that the NUSC001-TP molecule exhibits good incorporation activity and strong post-incorporation inhibitory effect in the SARS-CoV-2RdRP system, with effects comparable to those of NTP form of sofosbuvir.

[0580] Example 26: In vitro enzymatic characterization of NUSC001-TP molecule-mediated RNA synthesis in the EV71 RdRP system

[0581] To accurately detect whether the NUSC001-TP molecule can mimic CTP incorporation into the product chain and inhibit subsequent synthesis in the EV71 RdRP system, this invention also performed in vitro enzymatic characterization of the NUSC001-TP molecule's intervention in EV71 RdRP.

[0582] (i) In vitro enzymatic characterization performed in an EV71 RdRP system where the template only allows for single-time NUSC001-TP incorporation.

[0583] like Figure 5 As shown in Figure A, the sequence of template RNA V5-1-F is: 5′-GGGAGAUGAAAGUCUCCUAGUCUCUCGUCGAAA-3′. This template was prepared and purified using the "T7 RNA polymerase-glmS" ribozyme method. Template RNA V5-1-F was mixed with 10 nt of primer (P10) at a final molar ratio of 1:1.1, incubated at 45°C for 3 min, and then slowly cooled to room temperature.

[0584] The reaction system was as follows: 50 mM HEPES (pH 7.0), 30 mM NaCl, 50 mM KCl, 5 mM MgCl2, 5 mM MTCEP, 300 μM ATP, 300 μM GTP, 6 μM EV71 RdRP, and 4 μM double-stranded RNA V5-1-F / P10. After reacting at 22.5 °C for 2 h, the product chain had extended to 14 nt. GTP and ATP were then removed from the reaction system. 19 μL of the above reaction solution was taken, and 1 μL of NUSC001-TP or NUSC001-TP, UTP with an initial concentration of 6 mM was added respectively. After reacting at 22.5 °C for different times, 20 μL of stop solution (95% [v / v] formamide, 20 mM EDTA [pH 8.0], 0.02% [w / v] bromophenol blue) was added to terminate the reaction. Complementary DNA from V5-1-F was added to the sample at a molar ratio of 1:2 and incubated at 100°C for 60 seconds, followed by slow cooling to room temperature. After centrifugation, the sample was separated by electrophoresis on a 5 mL urea (7M)-20% polyacrylamide gel at a constant voltage of 200V for approximately 1.5 hours, and stained with Stains-All.

[0585] The results of in vitro enzymatic experiments in EV71 RdRP system are shown in Fig. Figure 5 B: when the extension complex with product length of 14 nt was obtained, further addition of NUSC001-TP could only obtain product with length of 15 nt (corresponding to the product with only one NUSC001-TP incorporated) Figure 5 B, lanes 3-6); when NUSC001-TP and UTP were added, the 15 nt product failed to be further extended Figure 5 B, lanes 8-11). This indicates that in EV71 RdRP system, the incorporation of a single NUSC001-TP molecule exhibits an immediate chain termination effect, which can block the subsequent synthesis after its incorporation.

[0586] (ii) In vitro enzymatic characterization in EV71 RdRP system with template allowing continuous incorporation of NUSC001-TP

[0587] As shown in Fig. Figure 6 A, the sequence of template RNA V5-5 is: 5'-GGGAGAUGAAAGUCUCCAGGUCUCUCUCGUCGAAA-3', which was prepared and purified by "T7 RNA polymerase-glmS" ribozyme method. The template RNA V5-5 was mixed with 10 nt primer (P10) at a molar ratio of 1:1.1 final concentration, incubated at 45°C for 3 min, and then slowly cooled at room temperature. The method was operated as in step (i) of Example 25.

[0588] The results of in vitro enzymatic experiments in EV71 RdRP system are shown in Fig. Figure 6 B: when the extension complex with product length of 16 nt was obtained, further addition of CTP or NUSC001-TP, with or without UTP, could at most obtain product with length of 17 nt (corresponding to the product with only one NUSC001-TP incorporated) Figure 6 B, lanes 3-5 and lanes 6-8). This indicates that in EV71 RdRP system, the continuous incorporation of multiple NUSC001-TP molecules exhibits an immediate chain termination effect.

[0589] In summary of the above examples, it is shown that NUSC001-TP molecule exhibits an immediate chain termination intervention effect in EV71 RdRP system.

[0590] Example 27: Evaluation of the inhibitory effect of 2'-a-ethynyl-ß-fluoro nucleoside compounds on CCHFV at cell level

[0591] The cells were seeded into 96-well plates at 1 x 10 4cells, and the experiment was performed the next day. First, 100 μL of medium containing the corresponding concentration (20 μM, 10 μM, 5 μM, 2.5 μM, 1.25 μM, 0.625 μM, 0.3125 μM) of the test compound was added to the cell plate, and the cells were pretreated for 1 hour, then 20 μL of diluted virus (containing a virus amount of 1000 TCID 50 , i.e. MOI = 0.1) was added, and the plate was incubated in an incubator for 1 hour. Then the virus culture solution was discarded, the residual uninfected virus was washed away with PBS, 180 μL of cell culture solution containing the corresponding concentration of compound was added, and the plate was then placed in a 37°C, 5% CO2incubator for continued culture for 72 hours.

[0592] The cell culture medium in the 96-well plate was discarded, the cell plate was soaked in 4% paraformaldehyde for 2 hours for fixation, washed once with PBS, and then 15 minutes of incubation at room temperature with the cell nucleus staining solution Hoechst 33258 (Beyotime) was performed, followed by washing once with PBS. The number of cells (indicated by the cell nucleus) and the number of virus-positive cells (indicated by EGFP) in each well were scanned using high content, and the virus infection positive rate was calculated.

[0593]

[0594]

[0595] The results of the cell level inhibition experiment showed that the 2'-a-ethynyl-β-fluoro nucleoside compounds had obvious inhibitory effects on CCHFV on HUVEC cells.

Claims

1. A compound comprising a 2'-a-ethynyl-β-fluoro nucleoside, having the structure of Formula I, or an enantiomer, diastereomer, racemate, pharmaceutically acceptable salt, pharmaceutically acceptable ester, crystalline hydrate or solvate thereof: ###0001### Formula I wherein: AA represents an amino acid segment; B is selected from the group consisting of: 5-9 membered heteroaryl, which heteroaryl can be further substituted with any one or both of: amino, oxo. Formula I is either Formula II-1 or Formula II-2: ###0002### Formula II-1 Formula II-2 AA is an amino acid segment from glycine, L-leucine, D-leucine, L-valine, D-valine, L-alanine, D-alanine, L-phenylalanine, D-phenylalanine, L-tryptophan, D-tryptophan, L-isoleucine, D-isoleucine, L-proline, D-proline, L-serine, D-serine, L-methionine, D-methionine, L-cysteine, D-cysteine, L-tyrosine, D-tyrosine, L-threonine, or D-threonine, or any combination of one or more of the foregoing amino acid segments. R 1 is selected from the group consisting of hydrogen, halogen-substituted benzyl, benzyl, -C(=O)R 11 , -C(=O)OR 12 , R 13 , R 14 , and R 15 substituted silyl, R 11 is selected from the group consisting of C1-C12 alkyl, 3-7 membered cycloalkyl, 3-7 membered heterocycloalkyl, 5-7 membered aromatic ring, 5-7 membered heteroaromatic ring; R 12 is selected from the group consisting of C2-C5 alkyl, C2-C5 unsaturated alkyl, 5-7 membered aromatic ring, 5-7 membered aromatic ring substituted methylene; R 13 , R 14 , and R 15 are each independently selected from the group consisting of C1-C5 alkyl; said aromatic ring can be further substituted with one or more substituents selected from the group consisting of halogen, halogen-substituted C1-C3 alkyl, C1-C3 alkoxy; R 2 selected from the group consisting of hydrogen, halogen-substituted benzyl, benzyl, -C(=O)R 21 , -C(=O)OR 22 , R 23 , R 24 , and R 25 substituted silyl, trimetaphosphoric acyl; R 21 is selected from the group consisting of C1-C12 alkyl, 3-7 membered cycloalkyl, 3-7 membered heterocycloalkyl, 5-7 membered aromatic ring, 5-7 membered heteroaromatic ring; R 22 is selected from the group consisting of C2-C5 alkyl, C2-C5 unsaturated alkyl, 5-7 membered aromatic ring, 5-7 membered aromatic ring substituted methylene; R 23 , R 24 , and R 25 are each independently selected from the group consisting of C1-C5 alkyl; said aromatic ring can be further substituted with one or more substituents selected from the group consisting of halogen, halogen-substituted C1-C3 alkyl, C1-C3 alkoxy; or R 2 selected from the group consisting of: B is selected from the group consisting of: ###0003### wherein P is R, S or racemic. is one of the following compounds: ###0004### ###0005### ###0006### 2. The compound of claim 1, wherein A pharmaceutical composition comprising a compound of any one of claims 1-6, and a pharmaceutically acceptable carrier. R 1 selected from hydrogen, 2,4-dichlorobenzyl, benzyl, acetyl, propionyl, 2-methylpropionyl, valeryl, pivaloyl, octanoyl, cyclohexylcarbonyl, 4-oxanylcyclohexylcarbonyl, benzoyl, furan-1- formyl, p-trifluoromethylbenzoyl, p-methoxybenzoyl, 2,4-dichlorobenzoyl, trimethylsilyl, t-butyldimethylsilyl, propyloxycarbonyl, isopropyloxycarbonyl, allyloxycarbonyl, phenyloxycarbonyl, benzyloxycarbonyl; R 2 selected from the group consisting of hydrogen, 2,4-dichlorobenzyl, benzyl, acetyl, propionyl, 2-methylpropionyl, valeryl, pivaloyl, octanoyl, cyclohexylcarbonyl, 4-oxanylcyclohexylcarbonyl, benzoyl, furan-1- formyl, p-trifluoromethylbenzoyl, p-methoxybenzoyl, 2,4-dichlorobenzoyl, trimethylsilyl, t-butyldimethylsilyl, propyloxycarbonyl, isopropyloxycarbonyl, allyloxycarbonyl, phenyloxycarbonyl, benzyloxycarbonyl, trimethylphosphono.

3. The compound of claim 1 or 2, wherein 8. Use of a compound of any one of claims 1-6 or a composition of claim 7 for the manufacture of a medicament for the treatment or prevention of a viral infection, alone or in combination with a second therapeutic agent selected from one or more of an antiviral agent.

4. The compound of claim 1 or 2, wherein The viral infection is caused by one or more of a bunyavirus, a flavivirus, a coronavirus; and the antiviral agent is one or more of ribavirin, α-interferon, sofosbuvir, favipiravir, acyclovir, deoxyactinomycin, paromomycin, poly I:C, amantadine, acyclovir, idoxuridine, iododeoxyuridine, zidovudine, remdesivir, dideoxythymidine, baloxavir, ganciclovir, vidarabine, or telbivudine.

5. The compound of claim 1, wherein The process comprises:

6. The compound of claim 1, wherein reacting a compound of Formula la with bis(2-methoxyethyl)aminosulfur trifluoride in the presence of pyridine to obtain a compound of Formula 2a; 7. A pharmaceutical composition, characterized by, reacting a compound of Formula 2a with acetic anhydride under catalysis of sulfuric acid to obtain a compound of Formula 3a; glycosylating a compound of Formula 3a with silylated benzoylcytidine under catalysis of tin tetrachloride to obtain a mixture of isomers of Formula 4a; 9. Use according to claim 8, characterized in that, reacting a compound of Formula 4a with boron trichloride at -75°C to -85°C, and isolating and purifying to obtain a compound of Formula 6a; 10. A process for the preparation of a compound according to any one of claims 1 to 6, characterized in that, reacting a compound of Formula 6a with boron tribromide at room temperature to obtain a compound of Formula 9a; reacting a compound of Formula 9a with tert-butyldimethylsilyl chloride to obtain a compound of Formula 12a; selectively removing the tert-butyldimethylsilyl protecting group from the 5'-hydroxyl group of a compound of Formula 12a under catalysis of trichloroacetic acid to obtain a compound of Formula 13a; ​ ​ ​ ​ ​ heating the compound of formula 13a in ammonia in methanol to obtain the compound of formula 14a; reacting the compound of formula 14a with compound of formula 18a under t- butyl magnesium chloride condition to obtain the compound of formula 19a; removing the t-butyldimethylsilyl protecting group at 3'-position hydroxyl group of compound of formula 19a under 6M hydrochloric acid condition to obtain the compound of formula I-A; or, glycosidation of compound of formula 3a with uracil under trimethylsilyl triflate condition to obtain the compound of formula 5a; reacting the compound of formula 5a with p-methoxybenzyl chloride to introduce PMB group, separation of isomers to obtain the compound of formula 7a; removing the PMB group of compound of formula 7a under cerium ammonium nitrate condition to obtain the compound of formula 8a; reacting the compound of formula 8a with boron trichloride at room temperature to obtain the compound of formula 10a; reacting the compound of formula 10a with compound of formula 18a under t- butyl magnesium chloride condition to obtain the compound of formula I-B. heating the compound of formula 9a in ammonia in methanol to obtain the compound of formula 11a; or, heating the compound of formula 12a in ammonia in methanol to obtain the compound of formula 15a; reacting the compound of formula 15a with N-t-butoxycarbonylimidazole under 1,8-diazabicyclo[5.4.0]undec-7-ene condition to obtain the compound of formula 16a; removing the two t-butyldimethylsilyl protecting group from hydroxyl group of compound of formula 16a under tetrabutylammonium fluoride condition to obtain the compound of formula 17a; reacting the compound of formula 17a with corresponding acid chloride, anhydride or chloroformate under basic condition to obtain the compound of formula 20a; removing the t-butoxycarbonyl protecting group from base of compound of formula 20a under trifluoroacetic acid condition to obtain the compound of formula I-C; or, reacting the compound of formula 10a with corresponding acid chloride, anhydride or chloroformate under basic condition to obtain the compound of formula I-D;