Dehydration response element binding protein FtDREB02 as well as coding gene and application thereof

Abstract

The invention discloses a dehydration response element binding protein FtDREB02 as well as a coding gene and application thereof. The dehydration response element binding protein FtDREB02 and the coding gene thereof are separated from tartary buckwheat through molecular cloning, the amino acid sequence of the dehydration response element binding protein FtDREB02 is shown as SEQ ID No.2, and the nucleotide sequence of the coding gene of the dehydration response element binding protein FtDREB02 is shown as SEQ ID No.1. Genetic transformation experiments prove that the encoding gene of the dehydration response element binding protein FtDREB02 can remarkably improve the plant drought tolerance, has the dual functions of enhancing the promoter activity of the anthocyanin synthase gene, and has application prospects in the aspects of improving the plant drought stress resistance or regulating the plant anthocyanin biosynthesis and the like.

Description

TECHNICAL FIELD

[0001] The present application relates to a dehydration responsive element binding protein and its encoding gene and application, and particularly relates to a dehydration responsive element binding protein FtDREB02 isolated from Fagopyrum tataricum (L.) Gaertn and its encoding gene and application in regulating plant drought stress resistance and anthocyanin biosynthesis, and belongs to the field of dehydration responsive element binding protein and its application. BACKGROUND

[0002] Fagopyrum tataricum (L.) Gaertn as an important economic crop of Polygonaceae is a kind of nutrition-rich pseudo-cereal. Its kernels do not contain gluten protein, and contain complete high-quality protein and essential amino acids for human body, and are rich in various plant secondary metabolites with health-care functions. Especially noteworthy is that a large amount of flavonoids (such as rutin) and phenolic compounds accumulated in Fagopyrum tataricum not only endow it with special nutritional value, but also play an important antioxidant protective role in the process of plant resisting drought stress. This unique physiological characteristic makes Fagopyrum tataricum have high nutritional quality and outstanding abiotic stress resistance.

[0003] From the perspective of cultivation characteristics, Fagopyrum tataricum has the characteristics of short growth period, tolerance to poor soil, and high light energy utilization rate, and is particularly suitable for planting in arid and semiarid areas, which can significantly reduce the dependence of agricultural production on water resources. According to statistics, about 60% of the global Fagopyrum tataricum planting area is distributed in high-altitude areas with cold climate and scarce rainfall, and continuous drought and seasonal water shortage have become the key limiting factors restricting the yield improvement of Fagopyrum tataricum in these areas. Therefore, carrying out Fagopyrum tataricum drought-resistant germplasm resource screening and mining key drought-resistant genes has important application value for improving the stress resistance of Fagopyrum tataricum varieties. SUMMARY

[0004] One of the purposes of the present application is to provide a dehydration responsive element binding protein FtDREB02 isolated from Fagopyrum tataricum (L.) Gaertn and its encoding gene.

[0005] The second purpose of the present application is to provide a recombinant expression vector containing the above-mentioned encoding gene and a host cell containing the recombinant expression vector.

[0006] The third purpose of the present application is to apply the transcription factor and its encoding gene to regulating plant drought stress resistance or anthocyanin biosynthesis and the like.

[0007] The above-mentioned purposes of the present application are realized by the following technical solutions:

[0008] The application provides a dehydration responsive element binding protein FtDREB02 isolated from tartary buckwheat, wherein the amino acid is shown in (a) or (b):

[0009] (a), the amino acid shown in SEQ ID No. 2; or (b), a protein variant derived from the amino acid shown in SEQ ID No. 2 by substitution, deletion or / and insertion of one or more amino acid residues, and the protein variant still has the function or activity of regulating plant drought stress resistance or anthocyanin biosynthesis.

[0010] The protein variant of the application can be generated by genetic polymorphism or artificial operation, and the operation methods are generally known in the art. For example, the amino acid sequence variant or fragment of the dehydration responsive element binding protein FtDREB02 can be prepared by mutation of DNA, wherein the methods for mutagenesis or changing polynucleotides are known in the art. Among them, the conservative substitution is to replace one amino acid residue with another amino acid with similar properties.

[0011] The application provides a coding gene of the dehydration responsive element binding protein FtDREB02 isolated from tartary buckwheat, wherein the polynucleotide sequence of the CDS of the coding gene is shown in (a), (b), (c), (d) or (e):

[0012] (a), the polynucleotide sequence shown in SEQ ID No. 1; or (b), the polynucleotide sequence encoding the amino acid sequence shown in SEQ ID No. 2; or (c), a polynucleotide sequence capable of hybridizing to the complement of the polynucleotide sequence of SEQ ID No. 1 under stringent hybridization conditions, and the protein encoded by the polynucleotide sequence still has the function of regulating plant drought stress resistance or anthocyanin biosynthesis; or (d), a polynucleotide sequence having at least 90% or more homology with the polynucleotide sequence shown in SEQ ID No. 1; or (e), a polynucleotide variant obtained by deletion, substitution or insertion of one or more bases based on the polynucleotide sequence shown in SEQ ID No. 1, and the protein encoded by the polynucleotide variant still has the function or activity of regulating plant drought stress resistance or anthocyanin biosynthesis.

[0013] The chimeric gene or expression cassette obtained by chimerizing or connecting the coding gene shown in SEQ ID No. 1 of the application with other genes all belong to the protection scope of the application; the recombinant expression vector containing the chimeric gene or expression cassette also belongs to the protection scope of the application.

[0014] In addition, the polynucleotide shown in SEQ ID No. 1 can be optimized by the person skilled in the art to enhance the expression efficiency in plants. For example, the polynucleotide can be synthesized by using the preferred codon of the target plant to enhance the expression efficiency in the target plant.

[0015] The present application also provides a recombinant plant expression vector containing the coding gene of the dehydration responsive element binding protein FtDREB02 and a host cell containing the recombinant plant expression vector.

[0016] The coding gene of the dehydration responsive element binding protein FtDREB02 is operably linked to an expression regulatory element to obtain a recombinant plant expression vector that can express the coding gene in a plant; the recombinant plant expression vector can be composed of a 5' non-coding region, a polynucleotide sequence shown in SEQ ID No. 1 and a 3' non-coding region, wherein the 5' non-coding region can include a promoter sequence, an enhancer sequence or / and a translation enhancer sequence; the promoter can be a constitutive promoter, an inducible promoter, a tissue or organ specific promoter; the 3' non-coding region can contain a terminator sequence, an mRNA cleavage sequence and the like. A suitable terminator sequence can be taken from a Ti-plasmid of Agrobacterium tumefaciens, for example, an octopine synthase and nopaline synthase terminator region.

[0017] The recombinant plant expression vector can also contain a selectable marker gene for selecting transformed cells. The selectable marker gene is used for selecting transformed cells or tissues. The marker gene includes genes encoding antibiotic resistance and genes conferring resistance to herbicidal compounds and the like. In addition, the marker gene also includes phenotypic markers, for example, β-galactosidase and fluorescent proteins and the like.

[0018] The present application also relates to the use of the coding gene of the dehydration responsive element binding protein FtDREB02 in plants to regulate plant drought stress resistance or anthocyanin biosynthesis, for reference, the use includes: (1) constructing a recombinant plant expression vector containing the coding gene of the dehydration responsive element binding protein FtDREB02; (2) transforming the constructed recombinant plant expression vector into plant tissues or plant cells; (3) overexpressing the coding gene of the dehydration responsive element binding protein FtDREB02 in plant tissues or cells.

[0019] The transformation protocol and the protocol for introducing the polynucleotide or polypeptide into a plant can vary depending on the type of plant (monocotyledonous or dicotyledonous) or plant cell used for transformation. Suitable methods for introducing the polynucleotide or polypeptide into a plant cell include microinjection, electroporation, Agrobacterium-mediated transformation, direct gene transfer, and high-velocity ballistic bombardment, etc. In particular embodiments, the gene encoding the dehydration responsive element binding protein FtDREB02 of the present application can be provided to a plant using a variety of transient transformation methods. In other embodiments, the gene encoding the dehydration responsive element binding protein FtDREB02 of the present application can be introduced into a plant by contacting the plant with a virus or viral nucleic acid, typically, such methods involve introducing the gene encoding the dehydration responsive element binding protein FtDREB02 of the present application into a viral DNA or RNA molecule. The transformed cells can be regenerated into stably transformed plants using conventional methods (McCormick et al. Plant Cell Reports. 1986. 5: 81-84).

[0020] As a reference embodiment, the present application further provides a method for improving the drought stress tolerance of a plant, the method comprising: (1) constructing a recombinant plant expression vector containing the gene encoding the dehydration responsive element binding protein FtDREB02; (2) transforming the constructed recombinant plant expression vector into plant tissue or plant cells; and (3) overexpressing the gene encoding the dehydration responsive element binding protein FtDREB02 in the plant tissue or cells.

[0021] The present application demonstrates that the gene encoding the dehydration responsive element binding protein FtDREB02 can enhance the activity of the promoter of the anthocyanin synthesis key enzyme gene FtANS by LUC experiment, indicating that the FtDREB02 gene interferes with the biosynthesis of anthocyanin by regulating the expression of the anthocyanin key synthesis enzyme gene.

[0022] Therefore, the present application provides the use of the gene encoding the dehydration responsive element binding protein FtDREB02 in enhancing the activity of the promoter of the anthocyanin synthesis key enzyme gene FtANS or improving the anthocyanin content in a plant, comprising: (1) constructing a recombinant plant expression vector containing the gene encoding the dehydration responsive element binding protein FtDREB02; (2) transforming the constructed recombinant plant expression vector into plant tissue or plant cells; and (3) overexpressing the gene encoding the dehydration responsive element binding protein FtDREB02 in the plant tissue or cells.

[0023] The plant in the present application includes monocotyledonous or dicotyledonous plants, preferably buckwheat, soybean, white clover, alfalfa, or Arabidopsis thaliana, and most preferably buckwheat or Arabidopsis thaliana.

[0024] The application obtains a dehydration response element binding protein FtDREB02 and its coding gene from tartary buckwheat by molecular cloning, and proves that the FtDREB02 can significantly improve the drought tolerance of plants, and enhance the promoter activity of anthocyanin synthetase gene.

[0025] The application mainly has the following beneficial effects:

[0026] (1) Gene resource innovation: the coding gene FtDREB02 of the dehydration response element binding protein of tartary buckwheat is successfully cloned, and the blank of the gene function research is filled.

[0027] (2) Stress resistance improvement: the Arabidopsis thaliana strain overexpressing FtDREB02 is obtained through Agrobacterium-mediated genetic transformation, and the natural drought stress experiment proves that the transgenic strain has stronger water deficiency tolerance and survival rate than the wild type.

[0028] (3) Gene regulation innovation: it is found that the FtDREB02 gene can enhance the promoter activity of anthocyanin synthetase gene FtANS, and the synergistic regulation mechanism of flavonoid compound biosynthesis and drought stress response in tartary buckwheat is revealed, which provides molecular evidence for analyzing the internal correlation between plant secondary metabolism and stress resistance.

[0029] Definitions of terms involved in the present invention

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods, devices and materials similar or equivalent to those described herein can be used in the practice or testing of the application, the preferred methods, devices and materials are now described.

[0031] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides in either single- or double-stranded form, and polymers thereof. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless specifically indicated otherwise, the term also means oligonucleotide analogs, including PNAs (peptide nucleic acids), DNA analogs used in antisense technology (phosphorothioates, phosphoramidates, etc.). Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including, but not limited to, simplifying degenerate codon substitutions) and

[0032] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to mean a polymer of amino acid residues. That is, a description of a polypeptide applies equally to a description of a peptide and to a description of a protein, and vice versa. The terms apply to naturally-occurring amino acid polymers as well as to amino acid polymers in which one or more of the amino acid residues are non-naturally encoded amino acids. As used herein, the terms encompass amino acid chains of any length including full-length proteins (i.e., antigens) in which the amino acid residues are connected by covalent peptide bonds.

[0033] The term "stringent hybridization conditions" means conditions that are known in the art to be low in ionic strength and high in temperature. Typically, under stringent conditions, a detectable degree of hybridization of a probe to its target sequence is higher than a detectable degree of hybridization to other sequences (e.g., at least 2-fold over background). Stringent hybridization conditions are sequence dependent, and will be different in varying environmental conditions, with longer sequences being specifically hybridized at higher temperatures. By controlling the stringency or washing conditions of the hybridization, one can identify target sequences that are 100% complementary to the probe. For an extensive guide to nucleic acid hybridization, see the relevant literature (Tijssen, Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Probes," Overview of principles of hybridization and the strategy of nucleic acid assays. 1993). More specifically, the stringent conditions are typically chosen to be around 5-10°C lower than the thermal melting point (T m ) for the specific sequence at the specified ionic strength pH. T mThe temperature at which 50% of the probes complementary to a target hybridize to the target sequence in equilibrium under physiological conditions (in a particular ionic strength, pH, and nucleic acid concentration) as the target sequences are present in excess (since the target sequences are usually present in much excess for hybridization) (Tm). The term "stringent conditions" refers to conditions under which 50% of the probes are occupied in equilibrium under physiological conditions (in a particular ionic strength, pH, and nucleic acid concentration) as the target sequences are present in excess (since the target sequences are usually present in much excess for hybridization) (Tm). Stringent conditions can be those in which the concentration of salt and the temperature are such that more than about 50% of the probes do not, under equilibrium conditions, form hybrids with the target sequence to which the probes are complementary, and yet less than about 50% of the probes do form hybrids. Stringent conditions can be, for example, a salt concentration of about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (including, but not limited to, 10 to 50 nucleotides) and at least about 60°C for long probes (including, but not limited to, greater than 50 nucleotides). Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal can be at least twice background hybridization, and more preferably 10 times background hybridization. Exemplary stringent hybridization conditions can be as follows: 50% formamide, 5 x SSC and 1% SDS, at 42°C, or 5 x SSC, 1% SDS at 65°C, with wash in 0.2 x SSC and 0.1% SDS at 65°C. The washes can be for 5, 15, 30, 60, 120 minutes or more. m The term "stringent conditions" refers to conditions under which 50% of the probes are occupied in equilibrium under physiological conditions (in a particular ionic strength, pH, and nucleic acid concentration) as the target sequences are present in excess (since the target sequences are usually present in much excess for hybridization) (Tm). Stringent conditions can be those in which the concentration of salt and the temperature are such that more than about 50% of the probes do not, under equilibrium conditions, form hybrids with the target sequence to which the probes are complementary, and yet less than about 50% of the probes do form hybrids. Stringent conditions can be, for example, a salt concentration of about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (including, but not limited to, 10 to 50 nucleotides) and at least about 60°C for long probes (including, but not limited to, greater than 50 nucleotides). Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal can be at least twice background hybridization, and more preferably 10 times background hybridization. Exemplary stringent hybridization conditions can be as follows: 50% formamide, 5 x SSC and 1% SDS, at 42°C, or 5 x SSC, 1% SDS at 65°C, with wash in 0.2 x SSC and 0.1% SDS at 65°C. The washes can be for 5, 15, 30, 60, 120 minutes or more.

[0034] "Multiple" as used herein generally means 2-8, preferably 2-4, depending on the location of the amino acid residues in the three-dimensional structure of the transcription factor or the kind of the amino acid; "substitution" means replacing one or more amino acid residues with different amino acid residues, respectively; "deletion" means reducing the number of amino acid residues, i.e. lacking one or more amino acid residues, respectively; and "insertion" means changing the sequence of the amino acid residues, i.e. adding one or more amino acid residues, compared to the natural molecule.

[0035] The term "recombinant host cell strain" or "host cell" means a cell which contains a polynucleotide of the present application, whether or not the polynucleotide is integrated into the host cell's genome, or exists as an extrachromosomal element, such as a plasmid. The host cell can be a prokaryotic or eukaryotic cell, and the host cell can be a monocotyledonous or dicotyledonous plant cell.

[0036] The term "operably linked" means functional linkage, and the operably linked elements can be contiguous or non-contiguous.

[0037] The term "transformed" refers to the introduction of a heterologous DNA sequence into a host cell or organism.

[0038] The term "introducing" means genetically transforming a plant with a polynucleotide or polypeptide in such a way that the polynucleotide or polypeptide is inside the plant cell. Methods of introducing a polynucleotide or polypeptide into a plant are known in the art and include, but are not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods. "Stable transformation" means that the introduced polynucleotide construct is integrated into the genome of the plant cell and can be inherited by the progeny thereof; "transient transformation" means that the polynucleotide is introduced into the plant but can only be expressed or present in the plant temporarily.

[0039] The term "expression": transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0040] The term "coding sequence": a nucleic acid sequence that is transcribed into RNA.

[0041] The term "recombinant plant expression vector": one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art. Binary vectors, along with vectors with helper plasmids, are most commonly used for Agrobacterium-mediated transformation. Binary vectors usually include: cis-acting sequences required for T-DNA transfer, a selectable marker engineered to be able to express in plant cells, a heterologous DNA sequence to be transcribed, etc. BRIEF DESCRIPTION OF DRAWINGS

[0042] Figure 1 A phylogenetic tree of FtDREB02 protein and homologous proteins in other plants.

[0043] Figure 2 Identification of FtDREB02 overexpression Arabidopsis positive plants.

[0044] Figure 3 FtDREB02 overexpression Arabidopsis plants drought resistance phenotype detection results.

[0045] Figure 4 A map of pGreenII 62sk vector.

[0046] Figure 5 A map of pGreenII 0800-LUC vector.

[0047] Figure 6 LUC analysis of FtDREB02 gene regulation on FtANS promoter. DETAILED DESCRIPTION

[0048] The application will be further described in connection with the specific embodiments. The advantages and features of the application will become more apparent with the description. However, these embodiments are only exemplary and do not constitute any limitation to the scope of the application. Those skilled in the art should understand that the details and forms of the technical solutions of the application can be modified or replaced without departing from the spirit and scope of the application, and such modifications and replacements fall within the protection scope of the application.

[0049] Cloning of CDS sequence of FtDREB02

[0050] The complete coding region sequence (CDS) of FtDREB02 gene was obtained by using specific primers (the primers are FtDREB02-F / R) to amplify the cDNA of tartary buckwheat cultivar 'Pinku No. 1' as a template. The specific method comprises the following steps:

[0051] 1. RNA extraction and reverse transcription steps:

[0052] (1) Material preparation: select 2-6 week old tartary buckwheat cultivar 'Pinku No. 1' seedlings, take 50-100 mg of sample;

[0053] (2) RNA extraction: grind the sample in step (1) using liquid nitrogen, and then extract total RNA using Trizol method;

[0054] (3) cDNA synthesis: using the total RNA obtained in step (2) as a template, using III 1st Strand cDNA Synthesis Kit (+gDNA wiper) kit (Nanjing Novogene Bioinformatics Technology Co., Ltd.) for reverse transcription.

[0055] 2. Cloning FtDREB02 gene from tartary buckwheat seedling cDNA, the specific method comprises the following steps:

[0056] (1) Design specific primers:

[0057] Forward primer FtDREB02-F: 5'-ATGGAAAACTACAGAATATCTCCAG-3' Reverse primer FtDREB02-R: 5'-CTACCCTCTGAAGCTCCAAATTT-3';

[0058] (2) PCR amplification using Pinku No. 1 cDNA as a template, the amplification program is as follows:

[0059] 95℃ 3min pre-denaturation; 95℃ 30s, 55℃ 60s, 72℃ 90s, a total of 31 cycles;

[0060] (3) Purify the PCR product and connect to pTOPO-Blunt Simple blunt-end cloning vector to construct FtDREB02-T vector plasmid;

[0061] (4) Obtain the full-length sequence of FtDREB02 by sequencing, analysis and splicing, and the CDS sequence is shown as SEQ ID No. 1:

[0062] ATGGAAAACTACAGAATATCTCCAGTGAGGCCATGGAAGAAAGGCC

[0063] CTGCAAGAGGAAAAGGTGGGCCCCAGAACGCCTCTTGCTCCTACCG

[0064] GGGAGTAAGGCAGAGAACATGGGGGAAGTGGGTGGCTGAGATTAG

[0065] AGAGCCTAAGAAGAGGTCAAGGCTCTGGCTCGGATCATATTCCACC

[0066] GCTGAGGAAGCTGCCATGGCCTATGATGAGGCTGCAAGGAGACTAT

[0067] ATGGACCCGAGGCTTATTTAAACCTACCCCACCTTAGATCGAACTTC

[0068] AACCCGCTAGACAAATCCCAAAAATACAAGTGGTTACCTACTAGGA

[0069] ACTTGTTTTCAACGTTTCCTTCTCCCCGGCTGCTTAATTTGAGCGCGC

[0070] AGCCTAGTGTTCATGTCATTCATCAAAGGCTGCAAGAGCTCAACAAT

[0071] AATAGGTTTCTAAACCAATTCCAATCCACTGCCTCGTCATCTTCACA

[0072] ACCACTTATAGGTGATCAGCGTACCTGTGAAACATCAGCTGCCAGG

[0073] GATGACCTTGTTGAGCTACCAACCATGAACGAGAAACCTCAGATTG

[0074] ACCTGCACGAGTTTCTCCAACAATTGGGAGTCCTGAAAGGCCAAGA

[0075] AAAATCAAATAACAGCCATGCTATAGAAGATACACTCCGCTGTGAT

[0076] TCTACACTGGAAAGTGGTCAAGGCATTGATGCACTGAATCAGGCAA

[0077] CTGTTGGTGAGGACCTTCAACAAGCAGAAATGAGCAATCTTCAAAT

[0078] CTGCAACAGTCATGATGATGAGCTTGACTTTGCCCATCAAATTTGGAGCTTCAGAGGGTAG (SEQ ID No. 1).

[0079] Bioinformatics analysis of FtDREB02 gene sequence

[0080] The CDS sequence of FtDREB02 gene obtained by cloning and sequencing in Example 1 was translated to obtain the encoded protein (FtDREB02 protein), and the amino acid sequence thereof is shown in SEQ ID No. 2: MENYRISPVRPWKKGPARGKGGPQNASCSYRGVRQRTWGKWVAEIREPKKRSRLWLGSYSTAEEAAMAYDEAARRLYGPEAYLNLPHLRSNFNPLDKSQKYKWLPTRNLFSTFPSPRLLNLSAQPSVHVIHQRLQELNNNRFLNQFQSTASSSSQPLIGDQRTCETSAARDDLVELPTMNEKPQIDLHEFLQQLGVLKGQEKSNNSHAIEDTLRCDSTLESGQGIDALNQATVGEDLQQAEMSNLQICNSHDDELDFAHQIWSFRG* (SEQ ID No. 2).

[0081] The amino acid sequence of FtDREB02 protein was input into NCBI to obtain homologous proteins of the gene in other species, and a phylogenetic tree was further constructed by using MEGA7.0 software, and it was found that the FtDREB02 protein in F. tataricum had high amino acid sequence similarity with the dehydration response element binding proteins of other species. Figure 1

[0082] ​Functional verification experiment of FtDREB02 gene genetic transformation of Arabidopsis thaliana

[0083] 1. Construction of recombinant expression vector pCAMBIA1307-FtDREB02

[0084] The purified CDS fragment of FtDREB02 gene was constructed into pCAMBIA1307 plant expression vector by enzyme digestion and ligation to obtain the recombinant expression vector pCAMBIA1307-FtDREB02, and the specific construction steps are as follows:

[0085] (1) Design homologous recombination primers:

[0086] Upstream primer 1307-FtDREB02-BamHIF:

[0087] 5'-TATCTAGAACTAGTGGATCCATGGAAAACTACAGAATATCTCCAG-3'

[0088] Downstream primer 1307-FtDREB02-HindIIIR:

[0089] 5'-TCGACGGTATCGATAAGCTTCTACCCTCTGAAGCTCCAAATT-3'

[0090] (2) PCR amplification was performed with FtDREB02-T vector as the template to obtain the full-length sequence of FtDREB02;

[0091] (3) After enzyme digestion, recovery and ligation transformation, the FtDREB02 sequence was inserted into the pCAMBIA 1307 vector downstream of the CaMV35S promoter in the forward direction;

[0092] (4) After sequencing verification, the overexpression vector pCAMBIA 1307-FtDREB02 was obtained.

[0093] 2. Agrobacterium infection of Arabidopsis thaliana and identification of transgenic positive lines

[0094] The overexpression vector pCAMBIA 1307-FtDREB02 was introduced into GV3101 Agrobacterium competent cells by heat shock method. The obtained Agrobacterium was used to infect Arabidopsis thaliana inflorescences by dipping method.

[0095] The correct pCAMBIA 1307-FtDREB02 recombinant plasmid and pCAMBIA 1307 empty vector plasmid verified by sequencing were transformed into Agrobacterium GV3101 competent cells by heat shock method respectively; the transformants were identified by colony PCR; the positive Agrobacterium strain containing the pCAMBIA 1307-FtDREB02 recombinant plasmid and the control strain containing the pCAMBIA 1307 empty vector were obtained. The obtained Agrobacterium bacterial liquid was used to infect Arabidopsis thaliana by the dipping method; the harvested seeds were disinfected with 10% sodium hypochlorite for 8 minutes, and then washed with sterile water for 5-6 times; the sterilized seeds were sown on the MS solid medium containing hygromycin (Hyg) resistance, and after 1-2 weeks of culture, the plants that could grow true leaves were selected as candidate positive strains; PCR detection was performed using FtDREB02-F / R primers to obtain transgenic positive plants (FtDREB02 overexpressing Arabidopsis thaliana plants) and empty vector control plants, and the transgenic positive strain detection results are shown in Figure 2 .

[0096] 3. Phenotype comparison analysis of transgenic positive strains under natural drought

[0097] (1) The FtDREB02 overexpressing Arabidopsis thaliana plants (OE#1, OE#2 and OE#3) and wild type Arabidopsis thaliana seeds were disinfected and sown on MS solid medium;

[0098] (2) After 1-2 weeks of culture, the seedlings with consistent growth were transplanted to soil;

[0099] (3) Continue to culture for about 2 weeks, stop watering after sufficient watering, and make the soil naturally dry;

[0100] (4) Observe the changes in plant phenotype for 1-2 weeks until Arabidopsis thaliana begins to show drought stress phenotype (e.g. whole plant wilting, leaf yellowing, stem bending and wilting).

[0101] According to Figure 3 It can be seen that compared with wild type Arabidopsis thaliana WT, the transgenic positive strains OE#1-3 of Arabidopsis thaliana plants are greener and more robust, with less wilting and weaker stress phenotype; the FtDREB02 overexpressing strains show stronger drought resistance than the wild type, with plants being hard and straight, leaves being green and stems growing normally, indicating that FtDREB02 gene overexpression enhances the drought tolerance of plants.

[0102] Example 3: FtDREB02 regulation mechanism experiment on anthocyanin synthase gene FtANS promoter

[0103] It is known that flavonoids in plants will accumulate under drought conditions, and anthocyanins are known as flavonoids with antioxidant capacity and enhanced drought tolerance of plants. Therefore, the promoter of the key enzyme gene FtANS for anthocyanin synthesis (SEQ ID No. 3) was cloned, and FtDREB02 overexpression vector and FtANS promoter-fluorescent protein fusion vector were constructed, and Agrobacterium was transformed; (8) The engineered bacteria prepared in step (7) were used to transiently transform tobacco leaves to verify the regulation function. FtDREB02 overexpression vector and FtANS promoter-fluorescent protein fusion vector were constructed and transformed into Agrobacterium, and the regulation function of FtDREB02 gene was verified by transiently transforming tobacco leaves; wherein the construction method of FtDREB02 overexpression vector and FtANS promoter-fluorescent protein fusion vector comprises:

[0104] FtDREB02 was constructed into pGreen II 62sk vector Figure 4 ), and the promoter of FtANS gene was constructed into pGreenII 0800-LUC vector Figure 5 ), and the primers were as follows:

[0105] 62sk-FtDREB02-F: 5'-CGCGGTGGCGGCCGCTCTAGAATGGAAAACTACAGAATATCTCCAG-3';

[0106] 62sk-FtDREB02-R: 5'-TTCCTGCAGCCCGGGGGATCCCTACCCTCTGAAGCTCCAAATTT-3';

[0107] 0800-FtANSpro-F: 5'-TTCCTGCAGCCCGGGGGATCCCTACCCTCTGAAGCTCCAAATTT-3';

[0108] 0800-FtANSpro-R: 5'-TTCCTGCAGCCCGGGGGATCCCTACCCTCTGAAGCTCCAAATTT-3'.

[0109] According to the detection results of dual luciferase reporter gene Figure 6)It can be seen that the luciferase signal is enhanced after the addition of FtDREB02 protein, i.e. the FtANS promoter activity is increased, indicating that the FtDREB02 gene can promote the expression of the FtANS promoter; the LUC experiment results show that the FtDREB02 gene can enhance the activity of the FtANS promoter of the key enzyme gene of anthocyanin synthesis, and the experimental results show that the FtDREB02 gene can interfere with the biosynthesis of anthocyanin by regulating the expression of the key synthesis enzyme gene of anthocyanin.

Claims

1. The dehydration response element binding protein FtDREB02 isolated from tartary buckwheat, characterized in that, Its amino acid sequence is shown in (a) or (b): (a) The amino acid shown in SEQ ID No. 2; or (b) Protein variants derived from the amino acid shown in SEQ ID No. 2 by substitution, deletion and / or insertion of one or more amino acid residues, which still have the function or activity of regulating plant resistance to drought stress or anthocyanin biosynthesis.

2. The gene encoding the dehydration response element binding protein FtDREB02 as described in claim 1.

3. The encoding gene according to claim 2, characterized in that, The polynucleotide sequence of the CDS encoding the gene is shown in (a), (b), (c), (d), or (e): (a) The polynucleotide sequence shown in SEQ ID No. 1; or (b) A polynucleotide sequence encoding the amino acid sequence shown in SEQ ID No. 2; or (c) A polynucleotide sequence whose complementary sequence to the polynucleotide sequence of SEQ ID NO.1 can hybridize under stringent hybridization conditions, and whose encoded protein still has the function of regulating plant resistance to drought stress or anthocyanin biosynthesis; or (d) A polynucleotide sequence that has at least 90% or more homology with the polynucleotide sequence shown in SEQ ID No. 1; or (e) A polynucleotide variant based on the polynucleotide sequence shown in SEQ ID NO.1 with one or more base deletions, substitutions or insertions, wherein the protein encoded by the polynucleotide variant still has the biological function or activity of regulating plant resistance to drought stress or anthocyanins.

4. A recombinant plant expression vector containing the encoding gene as described in claim 2 or 3.

5. A host cell containing the recombinant plant expression vector of claim 4.

6. The application of the encoding gene as described in claim 2 or 3 and the recombinant plant expression vector as described in claim 4 in improving plant resistance to drought stress.

7. The application of the encoding gene as described in claim 2 or 3, or the recombinant plant expression vector as described in claim 4, in enhancing the promoter activity of the key anthocyanin synthesis enzyme gene FtANS.

8. The application according to claim 6 or 7, characterized in that, The plants mentioned include monocotyledonous or dicotyledonous plants, preferably buckwheat, soybean, white clover, alfalfa, or Arabidopsis thaliana.

9. A method for improving plant resilience to drought stress, the method comprising: (1) Construct a recombinant plant expression vector containing the coding gene as described in claim 2 or 3; (2) Transform the constructed recombinant plant expression vector into plant tissues or plant cells; (3) Overexpress the coding gene of the dehydration response element binding protein FtDREB02 in plant tissues or cells; wherein the plant includes monocotyledonous plants or dicotyledonous plants, preferably buckwheat, soybean, white clover, alfalfa or Arabidopsis thaliana.

10. A method for increasing the anthocyanin content of plants, the method comprising: (1) Construct a recombinant plant expression vector containing the coding gene as described in claim 2 or 3; (2) Transform the constructed recombinant plant expression vector into plant tissues or plant cells; (3) Overexpress the coding gene in plant tissues or cells; the plant includes monocotyledonous plants or dicotyledonous plants, preferably buckwheat, soybean, white clover, alfalfa or Arabidopsis thaliana.

Images