Imistoc talaromyces as well as microbial inoculum, separation and screening method and application of Imistoc talaromyces

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to talaromyces amestokiae as well as a separation and screening method and application of the talaromyces amestokiae. In order to simultaneously regulate and control the contents of ethyl lactate, acetic acid and isoheteroacid in the Luzhou-flavor liquor, the invention provides the Imistoc talaromyces capable of reducing acid and increasing milk in the Luzhou-flavor liquor, and the preservation number is CGMCC No. 42174. The strain is subjected to single-bacterium enhanced fermentation in Luzhou-flavor liquor, and in the presence of Daqu, the fermentation efficiency of the Luzhou-flavor liquor can be remarkably improved, alcoholic fermentation is promoted, and the ethanol content is increased. The content of esters in the Luzhou-flavor liquor can be regulated and controlled, the taste and quality of the Luzhou-flavor liquor are improved by increasing the content of ethyl lactate and reducing the content of isoheteroacid and acetic acid, the liquor flavor is more coordinated, the Luzhou-flavor is more prominent, and the blending difficulty is reduced.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of microorganisms, and particularly relates to a Talaromyces emersonii, Talaromyces amestolkiae and a microbial agent thereof, a separation and screening method and application. BACKGROUND

[0002] Ester compounds are the main components of liquor aroma, and the content ratio of ethyl lactate and ethyl hexanoate in Luzhou-flavor liquor is an important index for controlling liquor quality. Among them, ethyl lactate is mainly used to adjust apple flavor, pineapple flavor, caramel flavor and musk flavor, etc., and is the key ester to give the liquor body a sense of mellow and sweet aroma. However, excessive short-chain fatty acids such as butyric acid, propionic acid and valeric acid in the brewing process of liquor are easy to cause the liquor body to have "abnormal flavor" (such as sweat acid taste, rancid taste), affecting the coordination of flavor. Some Luzhou-flavor liquor in the production process has the phenomenon that the content of abnormal acid is obviously high, thereby causing the problem of uncoordinated flavor, non-outstanding strong aroma, and difficult to adjust, etc. At present, the production of Luzhou-flavor liquor generally relies on natural fermentation microbial system, but the microbial flora structure in traditional pit mud and fermented grains is complex, and the proportion of functional strains is unstable, which is easy to cause imbalance of acid and ester metabolism, resulting in fluctuation of liquor quality. Therefore, how to reduce the content of abnormal acid and increase the content of ethyl lactate in Luzhou-flavor liquor is of great significance to the control of liquor quality.

[0003] In the prior art, in order to balance the acid and ester metabolism in the natural fermentation system, the method of directly adding ethyl lactate or acid inhibitors is used, but it will violate the specification of traditional brewing process, and is easy to introduce chemical residue risk. Although the esterifying yeast (such as Pichia) or lactic acid bacteria (such as Lactobacillus plantarum) reported in the existing research can produce ester or acid, the ability of synergistic regulation of complex acid and ester system is insufficient; and it is difficult to efficiently obtain mold resources with dual functions of "reducing abnormal acid" and "increasing ethyl lactate" by traditional separation method.

[0004] To overcome the above-mentioned shortcomings, Xu Chunyan et al. published a paper titled "Targeted Regulation and Application Research Based on Functional Core Microbial Communities of Cellar Mud Microbiome" (2021, 47(15): 1-7) in *Food and Fermentation Industries*, pointing out that targeted cultivation of the microecology of cellar mud can be achieved by analyzing the structure of the cellar mud microbiome and identifying its functional core microbial communities. By mixing *Ruminococcus rumeniformis* bacteria CPB6, *Clostridium butyricum*, *Lactobacillus* GJG1, *Lactobacillus*, *Oleaceae* bacteria BTY6, and *Clostridium beyerii* GJG2 in a certain proportion of colonies to obtain a mixed bacterial suspension, the addition of this suspension can increase the activity of hexanoic acid bacteria, increase the ethyl hexanoate content in the solid-state fermentation process of strong-aroma baijiu, and simultaneously reduce the ethyl lactate content. Patent CN115838619A also discloses a method for regulating the total acid and ethyl lactate content in Maotai-flavor liquor. This method mainly involves the concentrated distillation of the tails of the third, fourth, fifth, and sixth distillations in stages to effectively control the content of total acid, ethyl lactate, and other substances in bulk liquor.

[0005] However, the microbial agents in the above-mentioned schemes can only regulate the ethyl lactate content or control the total acid and ethyl lactate content of the bulk liquor through concentrated distillation of the tail liquor after fermentation. The regulation of the relationship between ethyl lactate and various heteroacids in strong-aroma baijiu is not addressed. Since the contents of ethyl lactate and heteroacids have a significant impact on the flavor of strong-aroma baijiu, there is an urgent need to obtain methods or functional microorganisms capable of simultaneously regulating the contents of ethyl lactate and heteroacids in strong-aroma baijiu. Summary of the Invention

[0006] To simultaneously regulate the content of ethyl lactate, acetic acid, and isomalic acid in strong-aroma baijiu, this invention provides a strain of *Amystoc commune* capable of "reducing acidity and increasing lactation" in strong-aroma baijiu. Talaromyces amestolkiae This invention relates to *Amystoc commune*, a functional bacterium capable of regulating the content of ethyl lactate, ethanol, heterologous acids, and acetic acid in wine. It addresses problems such as unbalanced flavor profiles, lack of prominent aroma, and difficulty in blending caused by excessive heterologous acid and acetic acid content.

[0007] To achieve the above-mentioned objectives, the technical solution adopted in this application is as follows: In a first aspect, the present invention provides a strain of *Amystoc commune* (…). Talaromyces amestolkiae MBT-TA499, with accession number CGMCC No. 42174, was deposited on August 22, 2025. The depositary institution is the China General Microbiological Culture Collection Center (CGMCC), located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, 100101, China. The classification name is: Talaromyces amestolkiae .

[0008] The ITS nucleotide sequence of the Talaromyces emersonii MBT-TA499 is shown as SEQ ID NO: 1. TCCGAGGTCACCGTGGTAAAATTTTGGTGGTGACCAACCCCCGCCAGTCCTTCCCGAGCGAGTGACAAAGCCCCATACGCTCGAGGACCAGACGGACGTCGCCGCTGCCTTTCGGGCAGGTCCCCGGGGGGACCGCACCCAACACACAAGCCGTGCTTGAGGGCAGAAATGACGCTCGGACAGGCATGCCCCCCGGAATGCCAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTGACAATTTTCATAGTACTCAGACAGCCCATCTTCATCAGGGTTCACAGAGCGCTTCGGCGGGCGCGGGCCCGGGGACAGATGTCCCCCGGCGACCAGGTGGCCCCGGTGGGCCCGCCAAAGCAACAGGTGTATAGAGACAAGGGTGGGAGGTTGGGCCACGAGGGCCCGCACTCGGTAATGATCCTTCCGCAGG The morphological characteristics of the Talaromyces emersonii MBT-TA499 are as follows: after being cultured on PDA medium at 25℃ for 7 days, the colony is velutinous, with a diameter of 30-40 mm, and the spore-producing area in the center of the surface is gray-green, and the aerial mycelium is white to light yellow; the reverse of the colony is bright orange-yellow to reddish-brown, and yellow soluble pigment is secreted into the medium; the microscopic structure produces biverticillate fructifications, and the conidia are spherical or subspherical, with a diameter of 2.0-3.5 μm and smooth surface.

[0009] In a second aspect, the present application provides a microbial inoculant containing the Talaromyces emersonii.

[0010] In a third aspect, the present application provides a method for isolating, screening and identifying the Talaromyces emersonii, comprising the following steps: The strong-flavor Daqu is made into a sample bacterial suspension, and after gradient dilution, it is isolated and purified on PDA medium, and the Talaromyces emersonii is isolated and identified according to morphological, physiological and biochemical characteristics and / or molecular biology.

[0011] In a fourth aspect, the present application provides application of the above-mentioned T. emersonii or microbial inoculant in the production of ethyl lactate.

[0012] In a fifth aspect, the present application provides application of the above-mentioned T. emersonii or microbial inoculant in the preparation of liquor, bran koji, Daqu and fermented grains.

[0013] In a sixth aspect, the present application provides application of the above-mentioned T. emersonii or microbial inoculant in balancing the content of ethyl lactate, acetic acid and iso-acids in liquor.

[0014] The iso-acids include at least one of propionic acid, butyric acid, valeric acid, caproic acid, capric acid, caprylic acid, acetic acid, lactic acid, isobutyric acid and isovaleric acid.

[0015] The liquor is a distilled liquor selected from at least one of a Luzhou-flavor type, a Jiang-flavor type or a Qing-flavor type.

[0016] Beneficial effects: The present application isolates, screens and identifies a functional mold T. emersonii MBT-TA499 from Luzhou-flavor Daqu, which can produce ethyl lactate at a high yield and reduce the content of various iso-acids and acetic acid. The preservation number of the strain is CGMCC No. 42174. Experimental results prove that the strain can significantly improve the fermentation efficiency of Luzhou-flavor liquor, promote alcohol fermentation and increase the content of ethanol in the condition of single-bacterial intensified fermentation in Luzhou-flavor liquor and the presence of Daqu. Moreover, the strain can regulate the content of ester substances in Luzhou-flavor liquor, increase the content of ethyl lactate, reduce the content of iso-acids and acetic acid, improve the taste and quality of Luzhou-flavor liquor, and make the flavor of liquor body more coordinated, the aroma of Luzhou-flavor more prominent and the difficulty of blending reduced. BRIEF DESCRIPTION OF DRAWINGS

[0017] Talaromyces amestolkiae Figure 2 is a clustering analysis heat map of aroma substances in Example 2 in which TA: T. emersonii MBT-TA499, CK: control group, LC, TS, TP-2, TV, TP-1, MF, PV-1, PV-2 and AN are commercially available T. emersonii LC, T. stoloniferum TS, T. emersonii TP-2, commercially available T. verrucosum TV, T. emersonii TP-1, R. stoloniferum MF, P. waughii PV-1, P. waughii PV-2 and A. niger, respectively.

[0018] Strain preservation of the present application: T. emersonii (MBT-TA499) Figure 1) MBT-TA499, the preservation number of which is CGMCC No. 42174. The preservation time is August 22, 2025, and the preservation unit is China General Microbiological Culture Collection Center (CGMCC), located at No. 1, Yihuangyuan 3rd, Beichenxi Road, Chaoyang District, Beijing, China, with a postal code of 100101. The classification name is: Talaromyces amestolkiae . DETAILED DESCRIPTION

[0019] In order to make the technical problems, technical solutions and beneficial effects to be solved in the present application clearer, the present application will be further described in detail below in combination with embodiments. Unless otherwise defined, all technical terms used herein have the same meanings as understood by those of ordinary skill in the art.

[0020] In an embodiment of the present application, a functional Talaromyces emersonii strain MBT-TA499 is isolated, screened and identified from a Luzhou-flavor Daqu, and the preservation number of the strain is CGMCC No. 42174.

[0021] In another embodiment of the present application, the obtained Talaromyces emersonii strain MBT-TA499 is used for liquor fermentation, especially for Luzhou-flavor liquor fermentation. Compared with fermentation with other strains, the content of ethyl lactate can be increased, the body of the liquor can be thickened, and the sweet aroma can be given. By rapidly consuming precursor substances (such as pyruvic acid), the synthesis pathways of butyric acid and propionic acid are blocked; the dominant bacterial flora is formed in the pit mud, and the reproduction of acid-producing miscellaneous bacteria is inhibited, so that the content of miscellaneous acids is significantly reduced. At the same time, the content of acetic acid can also be appropriately reduced, the irritating sour taste can be reduced, the aroma coordination can be improved, the content of ethanol can be increased, the liquor yield can be improved, and the fermentation process of Luzhou-flavor liquor can be optimized. In addition, the addition of Talaromyces emersonii strain MBT-TA499 can also reduce the content of acetaldehyde and some higher alcohols, reduce the risk of dizziness after drinking, and improve the sensory quality of Luzhou-flavor liquor. The goals of "reducing acid and increasing lactate" and health and flavor are achieved.

[0022] The following specific examples will be listed to explain the scheme of the present application. Those skilled in the art will understand that the following examples are only used to illustrate the present application, and should not be regarded as limiting the scope of the present application. If the specific technology or condition is not specified in the examples, the technology or condition described in the literature in the art or according to the product manual is used. If the reagent or instrument is not specified by the manufacturer, it is a conventional product that can be obtained by purchase.

[0023] The PDA culture medium contains potato infusion powder 12.0 g / L, glucose 20.0 g / L, and agar 23.0 g / L, with a pH value of 5.6±0.2 at 25℃.

[0024] Example 1: Isolation, screening and identification of Amylostereum MBT-TA499 (1) Strain screening Sample source: The strain MBT-TA499 of the present application was isolated from Luzhou Daqu.

[0025] Pre-treatment and enrichment: 1 g of Luzhou Daqu sample was suspended in 9 mL of sterile physiological saline, mixed thoroughly by shaking, and prepared into a 10 -1 mL bacterial suspension. Then gradient dilution method was used to dilute it to 10 -3 to 10 -5 concentrations.

[0026] Isolation and purification: 100 μL of each gradient dilution was taken and spread on PDA (potato dextrose agar) medium. The plates were incubated at 25-28°C for 3-7 days.

[0027] Single colony acquisition: The plates were observed regularly, and single and independent suspected Amylostereum colonies were picked according to the differences in colony morphology, color and sporulation structure. Plate streaking method was used to purify them on fresh PDA plates for several times until they were confirmed as pure cultures under a microscope. The obtained pure strains were stored at 4°C for short-term preservation and prepared into glycerol tubes for long-term preservation at -80°C. One of the strains, numbered as MBT-TA499, was selected as the object of further study due to its unique color-producing characteristics.

[0028] (2) Morphological identification Cultivation conditions: The purified strain MBT-TA499 was inoculated in the center of PDA (potato dextrose agar) medium.

[0029] Observation and recording: After 7 days of incubation at 25°C, the following characteristics were systematically observed and recorded: Colony growth rate: The diameter of the colony was measured.

[0030] Colony morphology: including texture (fluffy, floccose), surface relief, and abundance of aerial hyphae.

[0031] Color: color of the front spores (gray-green, yellow-green), color of the hyphae, color of the reverse colony and whether it produces soluble pigments.

[0032] Microscopic morphology: using lactic acid phenol cotton blue staining to prepare slides, and observing under an optical microscope. The emphasis was placed on observing the asexual reproduction structure: structure of conidial anamorph, number of turns of the broom (double turns), morphology of the phialide (ampoule shape), and shape (spherical / nearly spherical), size, and surface ornamentation (smooth) of the conidia.

[0033] Sexual form: whether to produce closed asci and other sexual structures was observed.

[0034] From the above observations, the morphological characteristics of MBT-TA499 are as follows: after being cultured on PDA medium at 25°C for 7 days, the colony is velutinous, 30-40 mm in diameter, with a gray-green spore-producing area in the center and white to light yellow aerial mycelium; the colony reverse is bright orange to reddish-brown, and yellow soluble pigment is secreted into the medium; the microscopic structure produces biverticillate brush-like branches, and the conidia are spherical or subspherical, 2.0-3.5 μm in diameter, with smooth surface.

[0035] Preliminary conclusion: the macroscopic and microscopic morphological characteristics of the strain MBT-TA499 are consistent with those of Talaromyces, and the bright yellow soluble pigment produced by the strain and the orange to reddish-brown colony reverse are highly consistent with the characteristics of Talaromyces emersonii described in the authoritative classification work Aspergillus and Penicillium. Talaromyces amestolkiae

[0036] (3) Molecular biological identification Genomic DNA extraction: The strain MBT-TA499 is activated and inoculated into PDA medium, and cultured at a certain temperature (e.g., 28-30°C) for a certain period of time (e.g., 4-7 days) to form a single colony in the central area. The mycelium is collected, and the total genomic DNA of the strain is extracted using a conventional fungal genomic DNA extraction kit (e.g., OMEGA Fungal DNA Kit) according to the instructions. The quality and concentration of the extracted DNA are detected by agarose gel electrophoresis and a nucleic acid quantifier, and the DNA is diluted to an appropriate concentration (e.g., 50 ng / μL) for standby use.

[0037] PCR amplification of ITS gene fragment: The ITS region is amplified by PCR using fungal universal primers.

[0038] The primers used are primer ITS1 (SEQ ID NO: 2) and primer ITS4 (SEQ ID NO: 3).

[0039] The PCR reaction system (50 μL) includes 10×PCR Buffer, dNTPs, upstream and downstream primers, DNA template, and Taq DNA polymerase.

[0040] The PCR amplification program is as follows: pre-denaturation at 94°C for 5 minutes; followed by 35 cycles of amplification (denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 1 minute); and finally, terminal extension at 72°C for 10 minutes.

[0041] The primers used are ITS1 / ITS4 for the ITS region.

[0042] ​SEQ ID NO: 2, ITS1: 5‘-TCCGTAGGTGAACCTGCGG-3’ SEQ ID NO: 3, ITS4: 5‘-TCCTCCGCTTATTGATATGC-3’ PCR product purification and sequencing: The PCR amplification product was detected by agarose gel electrophoresis, and the target band with a size of about 560 bp was recovered and purified by gel cutting. The purified product was directly sent to a professional biotechnology company for bidirectional sequencing.

[0043] Sequence analysis and strain identification: The forward and reverse sequencing results obtained were spliced to obtain the complete ITS gene sequence of strain MBT-TA499, and the nucleotide sequence is shown as SEQ ID NO: 1.

[0044] The obtained sequence was subjected to BLAST homology comparison in the GenBank database of the National Center for Biotechnology Information (NCBI). The results showed that the ITS sequence (SEQ ID NO: 1) of strain MBT-TA499 had a homology of more than 99% with the ITS sequence of the known Talaromyces amestolkiae Talaromyces Talaromyces emersonii (Talaromyces emersonii) model strain (such as CBS 135.63).

[0045] Based on the results of molecular phylogenetic analysis of ITS gene sequences, the strain MBT-TA499 was identified as Talaromyces emersonii (Talaromyces emersonii) amestolkiae ).

[0046] In summary, by combining its morphological characteristics and the results of molecular phylogenetic analysis, strain MBT-TA499 was identified as Talaromyces emersonii (Talaromyces emersonii) Talaromyces amestolkiae ). It was preserved in the China General Microbiological Culture Collection Center (CGMCC) on August 22, 2025, address: No. 1, Beichen West Road, Yard 3, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China, Postcode: 100101. The preservation number is: CGMCC No. 42174, and the classification name is: Talaromyces amestolkiae .

[0047] Example 2: Application of Talaromyces emersonii MBT-TA499 in Luzhou-flavor liquor fermentation The isolated Talaromyces emersonii MBT-TA499 was inoculated in PDA medium and cultured in a mold incubator at 30°C for 5-7 days to obtain mature mold. After the culture ended, the mold was subjected to spore washing liquid experiment operation. The OD420 values of different dilutions of the spore liquid were determined, and the corresponding growth standard curve (x = strain concentration and y = OD420 value) was used to determine the spore concentration of the spore liquid at 10 7 The inoculation amount of CFU / g was used for the primary and secondary expansion culture of the mold.

[0048] The sterilized primary 65% bran test tube was inoculated with spores and cultured at 30°C for 48 h. After the culture ended, the mycelium covered the bran, which was dried in a 37°C incubator and shaken to disperse to obtain the primary seed. The prepared primary seed was cooled and inoculated into a 85% bran medium in a flask, mixed thoroughly and cultured at 30°C for 40 h. When the mycelium covered the bran and formed a cake, the flask was removed and the bran was separated from the bottom of the culture container. The culture was continued for 24 h, and then the product was transferred to a cowhide bag and rapidly dried at 37-40°C to a water content of less than 12%. The product was thoroughly dispersed and stored to obtain the pure Talaromyces emersonii MBT-TA499 bran koji.

[0049] The prepared Talaromyces emersonii MBT-TA499 bran koji was inoculated into the fermented grains of Luzhou-flavor liquor, and the fermented grains were composed of 65% sorghum, 10% wheat, 10% waxy rice, 10% corn, and 5% rice, with 25% rice husk added to the raw materials. The fermentation experiment was carried out in a 500 mL flask, and the fermentation time was 30 days. After the fermentation ended, the ethanol content, acidity, reducing sugar content, moisture content, starch content, weight loss, acetic acid, various non-main body acids, aroma compounds, and higher alcohol content were determined, and the results are shown in Table 1 and Talaromyces amestolkiae As shown in Table 1 and

[0050] Table 1 Determination results of ethanol content, acidity, reducing sugar content, moisture content, starch content, ethyl lactate, acetic acid, various non-main body acid content, and total weight loss after Talaromyces emersonii MBT-TA499 enhanced fermentation

[0051] As can be seen from Table 1, compared with the control group, after adding Talaromyces emersonii MBT-TA499 for reinforced fermentation, the total weight loss and ethanol content were increased, indicating that the addition of functional mold MBT-TA499 was helpful for alcohol fermentation. At the same time, the total acid was increased, and the reducing sugar had no obvious change. Too high or too low reducing sugar content would lead to abnormal fermentation, flavor imbalance and storage risk. In moderate amount, it could support fermentation power and improve the sweet and smooth feeling of the wine body. The results showed that the addition of functional mold MBT-TA499 could keep the acidity and reducing sugar content within the appropriate range, and would not have adverse effects on the wine quality. The moisture content had no obvious change, and was maintained between 55%-60%, and the starch content also had no obvious change, which mutually corroborated the change of reducing sugar content.

[0052] Notably, compared with the control group, after adding Talaromyces emersonii MBT-TA499 for reinforced fermentation, the ethyl lactate yield reached 41.11 mg / L, indicating that the addition of Talaromyces emersonii MBT-TA499 could secrete ester synthetase (such as lipase, esterase), increase the content of ethyl lactate, and give the wine body a fullness and sweet aroma.

[0053] Acetic acid is an important volatile acid component. Excessive acetic acid would lead to flavor imbalance, produce sharp vinegar taste, mask the main aroma of cellar aroma and grain aroma, destroy the balance of acid and ester, and affect the fruit aroma presentation. Properly reducing the acetic acid content can reduce the irritating sour taste, improve the aroma coordination, enhance the sweet and smooth feeling, inhibit the pollution of miscellaneous bacteria and improve the liquor yield. As can be seen from Table 1, after adding Talaromyces emersonii MBT-TA499 for reinforced fermentation, the main acid-acetic acid content was reduced, which mutually corroborated the increase of ethanol content. It was indicated that the addition of Talaromyces emersonii MBT-TA499 could properly reduce the acetic acid content, improve the liquor yield and optimize the fermentation process of Luzhou-flavor liquor.

[0054] At the same time, after adding Talaromyces emersonii MBT-TA499, compared with the control group CK, the contents of isomerized acid: propionic acid, butyric acid and pentanoic acid (all 0 detected by liquid phase instrument) were much lower than those of the control group. It was indicated that the addition of functional mold MBT-TA499 could significantly reduce the content of isomerized acid by rapidly consuming precursor substances (such as pyruvic acid), blocking the synthesis pathway of butyric acid and propionic acid, forming dominant flora in the distiller's grains and inhibiting the reproduction of acid-producing miscellaneous bacteria. The typical style of "rich cellar aroma, balanced acid and ester, and pure aftertaste" of the wine body was achieved.

[0055] Figure 1 Figure 1The clustering analysis results of all aroma substances detected after adding Talaromyces emersonii MBT-TA499 to reinforce fermentation showed that the total ester content of Talaromyces emersonii MBT-TA499 was significantly improved compared with the control group CK and other existing Talaromyces. Among them, the content of ethyl lactate was most significantly improved. The content of ethyl lactate in the control group CK was 12.11 mg / L, which was significantly improved to 41.11 mg / L after adding Talaromyces emersonii MBT-TA499. The content was improved to 35.97 mg / L after adding Talaromyces verruculosus TV, to 37.57 mg / L after adding Talaromyces TP-1, to 32.71 mg / L after adding Talaromyces TP-2, to 25.85 mg / L after adding Paecilomyces variotii PV-1, to 21.62 mg / L after adding Paecilomyces variotii PV-2, to 27.12 mg / L after adding Aspergillus niger AN, to 40.94 mg / L after adding Stachybotrys chartarum LC, to 28.29 mg / L after adding Talaromyces stolonifer T, and to 18.66 mg / L after adding Monascus fuciformis MF. It can be seen that the other strains also have improved compared with CK, but not as significant as Talaromyces emersonii MBT-TA499.

[0056] And only after the addition of Talaromyces emersonii MBT-TA499, the acetic acid content was appropriately reduced compared with CK, the content of CK group was 17.77 mg / L, the content increased to 19.13 mg / L after the addition of TV bacteria, the content increased to 27.61 mg / L after the addition of TP-1 bacteria, the content increased to 21.61 mg / L after the addition of TP-2 bacteria, the content increased to 23.22 mg / L after the addition of PV-1 bacteria, the content increased to 32.94 mg / L after the addition of PV-2 bacteria, the content increased to 22.61 mg / L after the addition of AN bacteria, the content increased to 27.65 mg / L after the addition of LC bacteria, the content increased to 38.87 mg / L after the addition of TS bacteria, and the content increased to 21.67 mg / L after the addition of MF bacteria. It can be seen that the acetic acid content of the rest of the bacteria increased compared with CK, and the content decreased to 15.67 mg / L after the addition of Talaromyces emersonii MBT-TA499. And the content of non-main acid, that is, heteroacid (propionic acid, butyric acid, pentanoic acid, hexanoic acid, isobutyric acid, isoamyl acid) was significantly reduced compared with CK, among which propionic acid, butyric acid and pentanoic acid were the most significantly reduced. Specifically, the content of propionic acid in CK group was 14.90 mg / L, and the content decreased to 0 mg / L after the addition of Talaromyces emersonii MBT-TA499. The content of the rest of the bacteria such as TV bacteria was 0.74 mg / L, TP-1 bacteria was 0.34 mg / L, TP-2 bacteria was 0.91 mg / L, PV-1 bacteria was 0.43 mg / L, PV-2 bacteria was 1.67 mg / L, AN bacteria was 0.76 mg / L, LC bacteria was 0.96 mg / L, TS bacteria was 1.18 mg / L, and MF bacteria was 3.71 mg / L. The content of butyric acid in CK group was 270.91 mg / L, and the content decreased to 0 mg / L after the addition of Talaromyces emersonii MBT-TA499. The content of the rest of the bacteria such as TV bacteria was 6.82 mg / L, TP-1 bacteria was 6.68 mg / L, TP-2 bacteria was 32.15 mg / L, PV-1 bacteria was 13.38 mg / L, PV-2 bacteria was 5.27 mg / L, AN bacteria was 7.73 mg / L, LC bacteria was 73.05 mg / L, TS bacteria was 3.12 mg / L, and MF bacteria was 55.06 mg / L. It can be seen that the content of propionic acid and butyric acid decreased most significantly after the addition of Talaromyces emersonii MBT-TA499. The content of acetaldehyde of Talaromyces emersonii MBT-TA499 was 8.48 mg / L, and the content of acetaldehyde of the control group CK was 10.97 mg / L. And it also appropriately reduced the content of various higher alcohols (isoamyl alcohol, isobutyl alcohol, phenethyl alcohol), such as the content of phenethyl alcohol in CK group was 7.17 mg / L, and the content of phenethyl alcohol decreased to 6.13 mg / L after the addition of Talaromyces emersonii MBT-TA499.It is illustrated that the addition of Talaromyces emersonii MBT-TA499 can reduce the off-flavor, reduce the risk of dizziness after drinking, and meet the development goals of liquor flavor and health.

[0057] In conclusion, the Talaromyces emersonii MBT-TA499 can increase the content of ethyl lactate by secreting ester synthetase (such as lipase and esterase), endow the liquor body with thickness and sweet aroma. By rapidly consuming precursor substances (such as pyruvic acid), the synthesis pathways of butyric acid and propionic acid are blocked; the dominant bacterial flora is formed in the pit mud, and the reproduction of acid-producing miscellaneous bacteria is inhibited, so as to significantly reduce the content of miscellaneous acid. At the same time, the content of acetic acid can also be appropriately reduced, the irritating sour taste is reduced, the aroma coordination is improved, the ethanol content is increased, the liquor yield is improved, and the fermentation process of Luzhou-flavor liquor is optimized. In addition, the addition of Talaromyces emersonii MBT-TA499 can also reduce the content of acetaldehyde and some higher alcohols, reduce the risk of dizziness after drinking, and improve the sensory quality of Luzhou-flavor liquor. The goals of reducing acid and increasing lactate are achieved, and the goals of liquor flavor and health are achieved.

Claims

1. Emystoker's Basket ( Talaromyces amestolkiae MBT-TA499, characterized in that, The accession number is: CGMCC No. 42174.

2. A microbial inoculant, characterized in that, Contains the *Amystoc basketus* as described in claim 1.

3. The method for isolating, screening, and identifying *Amystoc commune* as described in claim 1, characterized in that, Includes the following steps: A strong-aroma Daqu was prepared into a sample bacterial suspension, which was then serially diluted and purified on PDA medium. The Amystok basket bacteria were isolated and identified based on morphological, physiological and biochemical characteristics and / or molecular biology screening.

4. The application of *Amystoc commune* as described in claim 1 or the microbial agent as described in claim 2 in the production of ethyl lactate.

5. The application of the *Amystoc commune* of claim 1 or the microbial agent of claim 2 in the brewing of baijiu (Chinese liquor), the preparation of bran koji, daqu (large koji), and the preparation of mash.

6. The application of the *Amystoc basketulae* of claim 1 or the microbial agent of claim 2 in balancing the content of ethyl lactate, acetic acid, and heteroacids in wine.

7. The application according to claim 6, characterized in that, The heteroacids include at least one of propionic acid, butyric acid, valeric acid, hexanoic acid, decanoic acid, octanoic acid, acetic acid, lactic acid, isobutyric acid, or isovaleric acid.

8. The application according to claim 5 or 6, characterized in that, The liquor is a distilled spirit, selected from at least one of the following: strong aroma, soy sauce aroma, or light aroma.

Images