Eurotium cristatum for degrading fungaltoxin in Fuzhuan tea and application of eurotium cristatum

Abstract

The invention discloses an eurotium cristatum strain for degrading mycotoxin in Fuzhuan tea and application of the eurotium cristatum strain. The preservation number of the eurotium cristatum OA3 is CGMCC (China General Microbiological Culture Collection Center) No.42157. The eurotium cristatum strain can be used for degrading mycotoxin in Fuzhuan tea. The strain disclosed by the invention can be used for efficiently degrading two mycotoxins, namely aflatoxin B1 and ochratoxin A at the same time, and the action mechanism of the strain comprises but is not limited to enzymatic degradation and biological adsorption. Through verification, the eurotium cristatum OA3 can grow and breed by taking a mixture of aflatoxin B1 and ochratoxin A as a unique carbon source. In a wide temperature range of 25-55 DEG C, the strain shows efficient and stable degradation capability on the two types of mycotoxins. Particularly, when the initial concentration of the aflatoxin B1 and the initial concentration of the ochratoxin A are both 1000 [mu] g / L, the degradation rate of the eurotium cristatum OA3 to the aflatoxin B1 and the ochratoxin A reaches 80% or above after 7 days of culture, and it is fully proved that the eurotium cristatum OA3 has excellent degradation efficiency and wide adaptability.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology and relates to a strain of *Aurorus cristatus* that degrades fungal toxins in Fu brick tea and its application. Specifically, it involves a strain of *Aurorus cristatus* OA3 isolated from Fu brick tea. This strain has a high efficiency in degrading aflatoxin B1 and ochratoxin A and can be applied to the microbial detoxification treatment of Fu brick tea. Background Technology

[0002] Aflatoxin B1 and ochratoxin A, two common mycotoxins found in food and animal feed, pose a serious threat to human and animal health. Once ingested, these toxins can cause acute and chronic harm, including liver damage, intestinal damage, kidney damage, and immune system suppression. Both are classified as potent carcinogens by the International Agency for Research on Cancer (IARC). Once these mycotoxins contaminate the food chain, they not only harm consumer health but also lead to a decline in the quality and safety of agricultural products, resulting in economic losses. This situation can weaken the market competitiveness of products and may also trigger international trade barriers.

[0003] Faced with widespread contamination by aflatoxin B1 and ochratoxin A, traditional mycotoxin control methods (such as physical removal methods like physical adsorption and screening separation, and chemical treatment technologies like chemical detoxification and oxidative degradation) can reduce mycotoxin levels under specific conditions, but their practical application effectiveness and safety remain significantly limited. Physical methods mainly reduce risk by altering the distribution or concentration of toxins, but they often fail to completely remove toxin residues from the food matrix; while chemical treatment methods, although highly efficient in degradation, may alter the nutritional composition of food and even generate secondary pollutants with unknown toxicity, posing new safety hazards. These limitations severely restrict the application of traditional methods in the field of food safety. Microbial and enzymatic degradation, with its high detoxification efficiency, strong specificity, and lack of environmental pollution, has attracted considerable attention from researchers.

[0004] Fu brick tea, a traditional Chinese fermented dark tea, is susceptible to contamination by various microorganisms during the "fermentation" process, leading to the presence of aflatoxin B1 and ochratoxin A. While there have been reports of microbial strains degrading aflatoxin B1 and others degrading ochratoxin A, most of these reports focus on single or mixed strains degrading a single toxin. Research on single strains simultaneously degrading multiple toxins is scarce, and there are currently no reports of *Aurogonium cristatum* strains simultaneously degrading aflatoxin B1 and ochratoxin A in Fu brick tea. This invention discloses a *Aurogonium cristatum* OA3 strain capable of simultaneously degrading aflatoxin B1 and ochratoxin A, which is of great significance for effectively controlling the contamination of tea raw materials and products by fungal toxins and ensuring human food safety. Summary of the Invention

[0005] This invention screens out a strain of *Aspergillus cristatus* that degrades fungal toxins in Fu brick tea and its application. This strain can efficiently degrade both aflatoxin B1 and ochratoxin A simultaneously. Its mechanism of action includes, but is not limited to, enzymatic degradation and biosorption.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: A strain of *Aspergillus cristatus* that degrades mycotoxins in Fu brick tea, wherein *Aspergillus cristatus* (Aspergillus) Aspergillus cristatus The accession number for OA3 is CGMCC No. 42157. *Eurotium cristatum* is deposited at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.

[0007] The application of *Aspergillus cristatus*, which degrades mycotoxins in Fu brick tea, as described in this invention, in the preparation of mycotoxin biodegrading agents.

[0008] Optionally, the mycotoxin biodegrading agent includes whole-cell fermentation broth, cell lysate, and / or metabolic broth.

[0009] Optionally, the method for preparing the whole-cell fermentation broth includes: inoculating the *Aspergillus cristatus* in potato dextrose broth and culturing it at 28°C for 7 days to obtain the whole-cell fermentation broth; the method for preparing the cell disruption broth includes: centrifuging the whole-cell fermentation broth, resuspending the precipitate in sterile water, and then disrupting it to obtain the cell disruption broth; the method for preparing the metabolic broth includes: centrifuging the whole-cell fermentation broth and obtaining the supernatant as the metabolic broth.

[0010] Optionally, in the method for preparing the whole-cell fermentation broth, the inoculum amount of *Aspergillus cristatus* is 1%–9%, ​​and the effective viable count of *Aspergillus cristatus* in the whole-cell fermentation broth is >1×10⁻⁶. 6 CFU / mL.

[0011] Optionally, the degradation temperature of the fungal toxin biodegrading agent is 25–55°C; the degradation time is >7 days; and the degradation pH is 3.0–11.0.

[0012] A fungal toxin biodegrading agent containing *Aspergillus cristatus* as described in this invention.

[0013] The *Aspergillus cristatus* strain described in this invention, which degrades fungal toxins in Fu brick tea, is used in the preparation of products that degrade aflatoxin B1 and / or ochratoxin A.

[0014] Optionally, the degradation temperature of the product is 25–55°C; the degradation time is >7 days; and the degradation pH is 3.0–11.0.

[0015] A method for degrading mycotoxins, said mycotoxins including aflatoxin B1 and / or ochratoxin A, characterized in that it comprises: The *Aspergillus cristatus* or the fungal toxin biodegrading agent of the present invention is used to treat materials containing fungal toxins in vitro: the materials refer to at least one of tea, traditional Chinese medicine, or their processing by-products. The degradation temperature is 25–55℃; the degradation time is >7 days; and the degradation pH is 3.0–11.0.

[0016] The beneficial effects of this invention are: This invention provides a strain of *Aurorus cristatus* OA3, with accession number CGMCC No. 42157. This *Aurorus cristatus* OA3 strain was screened and domesticated from Fu brick tea and can efficiently degrade aflatoxin B1 and ochratoxin A. Verification showed that *Aurorus cristatus* OA3 can utilize a mixture of aflatoxin B1 and ochratoxin A as the sole carbon source for growth, achieving highly efficient degradation of both. When the concentration of aflatoxin B1 and ochratoxin A was 1000 μg / L and the inoculum size of *Aurorus cristatus* OA3 was 7%, the degradation rate of aflatoxin B1 and ochratoxin A exceeded 80% after 7 days of cultivation, demonstrating strong degradation efficiency. Therefore, the *Aurorus cristatus* OA3 strain of this invention can efficiently degrade and metabolize aflatoxin B1 and ochratoxin A, showing promising application prospects in ensuring tea safety. Attached Figure Description

[0017] The accompanying drawings are provided to further illustrate the present disclosure and form part of the specification. They are used together with the following detailed description to explain the present disclosure, but do not constitute a limitation thereof. In the drawings: Figure 1 This refers to the degradation rates of aflatoxin B1 and ochratoxin A in Fu brick tea samples at each fermentation stage in Example 1 of the present invention, where A is the degradation rate of aflatoxin B1 in Fu brick tea samples at each fermentation stage; B is the degradation rate of ochratoxin A in Fu brick tea samples at each fermentation stage; C is the statistical distribution of the degradation rates of aflatoxin B1 and ochratoxin A by 113 microbial strains screened and isolated from Fu brick tea samples after 6 days of fermentation; and D is a comparison of the degradation rates of highly efficient degrading strains with aflatoxin B1 and ochratoxin A degradation rates >50%. Figure 2 This is an electrophoresis image of PCR amplification of the ITS sequences of four high-degradation-rate fungi in Example 1 of this invention; Figure 3 This is a phylogenetic tree of *Aspergillus cristatus* OA3 based on ITS sequences, as presented in this invention. Figure 4The colony morphology (A: front view; B: back view) and cleistothecia morphology (C: 10× objective lens; D: 40× objective lens) of *Aspergillus cristatus* OA3 of the present invention are shown. Figure 5 This is a statistical graph of non-redundant protein database species annotations for Coronavirus OA3 of the present invention; Figure 6 This is the complete genome map of *Aspergillus cristatus* OA3 according to the present invention; Figure 7 To investigate the degradation of aflatoxin B1 and ochratoxin A and OD by *Aurotium cristatum* OA3 under different reaction conditions 600 Effects of inoculum size on the degradation of aflatoxin B1 and OD by *Aspergillus cristatus* OA3; A: Effects of inoculum size on the degradation of aflatoxin B1 and OD by *Aspergillus cristatus* OA3. 600 Effects of inoculum size on the degradation of ochratoxin A and OD by *Aspergillus cristatus* OA3. 600 The effect of pH on the degradation of aflatoxin B1 and OD by *Aurogonium cristatum* OA3. 600 The effect of pH on the degradation of ochratoxin A and OD by *Aurogonium cristatum* OA3. 600 Effects of culture temperature on the degradation of aflatoxin B1 and OD by *Aspergillus cristatus* OA3. 600 Effects of culture temperature on the degradation of ochratoxin A and OD by *Aurogonium cristatum* OA3. F: Effects of culture temperature on the degradation of ochratoxin A and OD by *Aurogonium cristatum* OA3. 600 Effects of initial concentration on the degradation of aflatoxin B1 and OD by *Aurogonium cristatum* OA3. 600 Effects of initial concentration on the degradation of ochratoxin A and OD by *Aurogonium cristatum* OA3. 600 The impact.

[0018] Figure 8 This study compares the degradation rates of aflatoxin B1 and ochratoxin A by different components of *Aspergillus cristatus* OA3. A: Degradation rate of aflatoxin B1 by different components of *Aspergillus cristatus* OA3. B: Degradation rate of ochratoxin A by different components of *Aspergillus cristatus* OA3.

[0019] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments. Detailed Implementation

[0020] To make the technical problems, solutions, and advantages of this invention clearer, a detailed description will be provided below with reference to the accompanying drawings and specific embodiments. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0021] Furthermore, the technical features involved in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other. Unless otherwise specified, the methods and test conditions used in the embodiments of the present invention are all technical. The methods and experimental conditions used in this field, as well as the reagents, equipment, and culture media used, are all conventionally used in this field and can be prepared by existing methods or purchased commercially.

[0022] This invention discloses a strain of *Aspergillus cristatus* screened from Fu brick tea that can simultaneously degrade aflatoxin B1 and ochratoxin A. Aspergillus cristatus This invention relates to the field of microbial technology. *Aurogonium cristatum* OA3 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 42157. The core innovation of this invention lies in the fact that the strain can simultaneously and efficiently degrade both aflatoxin B1 and ochratoxin A, with mechanisms including but not limited to enzymatic degradation and biosorption. Verification has shown that *Aurogonium cristatum* OA3 can grow and reproduce using a mixture of aflatoxin B1 and ochratoxin A as the sole carbon source. Within a wide temperature range of 25–55°C, this strain exhibits highly efficient and stable degradation capabilities for both mycotoxins. Particularly noteworthy is that when the initial concentrations of both aflatoxin B1 and ochratoxin A are 1000 μg / L, after 7 days of cultivation, *Aurogonium cristatum* OA3 achieves a degradation rate of over 80% for both, fully demonstrating its excellent degradation efficiency and broad applicability. This invention provides a novel solution for the biological detoxification of tea and the reduction of post-harvest losses of tea, and also greatly enriches the germplasm resource bank of highly efficient fungal toxin-degrading bacteria.

[0023] The *Aurorus cristatus* OA3 of this invention is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 42157. *Aurorus cristatus* OA3, which simultaneously degrades aflatoxin B1 and ochratoxin A, was isolated and purified from Fu brick tea by the inventors through a complex screening process.

[0024] The present invention also provides the application of the above-mentioned *Aspergillus cristatus* OA3, especially its application in the detoxification of fungal toxins, which can efficiently degrade fungal toxins such as aflatoxin B1 and ochratoxin A.

[0025] This invention provides a fungal toxin biodegrading agent, including the *Aspergillus cristatus* OA3 described above.

[0026] Preferably, the application forms of *Eurotium cristatum* OA3 include culture medium, cell lysate, and metabolic fluid.

[0027] Preferably, the method for preparing the culture medium includes the following steps: inoculating *Aspergillus cristatus* OA3 into potato dextrose broth medium and culturing it to obtain the culture medium.

[0028] The preparation method of cell lysate includes: centrifuging the whole-cell fermentation broth, resuspending the precipitate in sterile water, and then breaking it up using a commercially available cell disruptor. The resulting liquid is the cell lysate.

[0029] The preparation method of the metabolic liquid includes: centrifuging the whole-cell fermentation broth, and the supernatant obtained is the metabolic liquid.

[0030] This invention provides the application of *Aspergillus cristatus* OA3 or the above-mentioned bacterial agent in the preparation of products that degrade aflatoxin B1 and / or ochratoxin A.

[0031] Preferably, when *Aurogonium cristatum* OA3 is used in the form of a culture medium, the inoculum size is 1%–9%, ​​and the effective viable count of *Aurogonium cristatum* OA3 in the culture medium is >1 × 10⁻⁶. 6 CFU / mL; When the application of *Aspergillus cristatus* OA3 is in the form of cell lysate or metabolic broth, the concentration of the cell lysate or metabolic broth is equivalent to that of the whole-cell fermentation broth.

[0032] Preferably, the degradation temperature is 25–55°C; the degradation time is >7 days; and the degradation pH is 3.0–11.0.

[0033] This invention provides a method for degrading aflatoxin B1 and ochratoxin A, comprising the following steps: mixing *Aspergillus cristatus* OA3 or the above-mentioned inoculum agent with materials containing aflatoxin B1 and ochratoxin A for degradation; the materials include, but are not limited to, one or more of tea raw materials and their processing by-products, and traditional Chinese medicines.

[0034] The present invention will be further illustrated below with reference to the embodiments: Example 1: Screening and identification of *Aurogonium cristatum* OA3, which simultaneously degrades aflatoxin B1 and ochratoxin A. The samples used to screen the strains in this embodiment were obtained from: raw black tea leaves after pile fermentation; finished Fu tea samples purchased from commercially available finished Fu tea; and tea samples at different fermentation points were obtained by simulating fermentation in a laboratory environment.

[0035] Main reagents: Aflatoxin B1 standard, purity ≥99.50%; Ochratoxin A standard, purity ≥99.10%, Qingdao Puribang Biotechnology Co., Ltd. Chromatographic grade methanol, formic acid, and acetonitrile were purchased from Sichuan Xilong Scientific Co., Ltd. Anhydrous magnesium sulfate, analytical grade, Shanghai Maclean Biochemical Technology Co., Ltd.; Sodium chloride, analytical grade, Sichuan Xilong Scientific Co., Ltd. The preparation method for the inorganic salt liquid culture medium for screening aflatoxin B1 and ochratoxin A was as follows: Take 0.2 g of MgSO4·7H2O, 0.5 g of (NH4)2SO4, 2.44 g of Na2HPO4, 1.52 g of KH2PO4, and 0.05 g of CaCl2, add distilled water to a final volume of 1 L, and adjust the pH to 7.0. The inorganic salt liquid culture medium was directly sterilized (autoclaved at 121℃ for 20 min), while the solid culture medium required the addition of 2 g of agar powder per 100 mL before aliquoting and sterilization.

[0036] Detection methods for aflatoxin B1 and ochratoxin A Mycotoxin B1 and ochratoxin A were detected using a quadrupole-electrostatic track trap high-resolution liquid chromatography-mass spectrometry (HPLC-MS / MS). Separation was performed using a Thermo Scientific™ Syncronis™ C18 column (2.1 × 150 mm, 2.6 μm). HPLC conditions were as follows: column temperature: 40.0 °C; injection volume: 4 μL; flow rate: 0.2 mL / min; mobile phase A: ultrapure water (containing 0.1% formic acid); mobile phase B: acetonitrile. Gradient elution conditions were as follows: initially (0–2 min), maintaining 90% A / 10% B; then linearly adjusting to 20% A / 80% B over 2–12 min and maintaining this ratio until 15 min; rapidly restoring the initial ratio (90% A / 10% B) at 15.1 min and equilibrating until 19 min.

[0037] Mass spectrometry conditions were as follows: ion source parameters: sheath gas flow rate 35 au, auxiliary gas flow rate 10 au, positive ion ionization mode, spray voltage 3.0 kV, ion transfer tube temperature 350℃, auxiliary gas heating temperature 320℃. The scanning mode was Parallel Reaction Monitoring (PRM), with fragmentation energies (NCE) set to 30, 40, and 50 eV. The mass-to-nucleus ratios (m / z) of the precursor ion, qualitative progeny ion, and quantitative progeny ion of aflatoxin B1 were 313.1, 241.0, and 285.1, respectively; those of ochratoxin A were 404.1, 239.01, and 358.08, respectively. Data processing was performed using Xcalibur software v. 3.0.63. The degradation rate was calculated using the following formula: ; in C 0 represents the initial concentration of aflatoxin B1 / ochratoxin A (treatment time: 0 min). C t The concentration of aflatoxin B1 / ochratoxin A after treatment (treatment time: t min).

[0038] The screening method is as follows: (1) Enrichment Screening: 25 g of black tea and samples of fermented tea (0 days, 6 days, 12 days after fermentation) and finished Fu brick tea were weighed and added to 225 mL of 0.85% sterile physiological saline. After thorough shaking, the samples were placed in a constant temperature shaker at 28 ℃ and 160 r / min for 30 min. Sterile centrifuge tubes were taken in a clean bench and 10 μL of aflatoxin B1 and ochratoxin A standard stock solutions were added (to make the content of aflatoxin B1 and ochratoxin A 1 μg). Then, 880 μL of inorganic salt basal liquid culture medium and 100 μL of sample supernatant were added. The mixture was placed in a shaker at 28 ℃ and cultured at 160 r / min for 7 days. The control group used inorganic salt basal liquid culture medium instead of sample supernatant. After 7 days of cultivation, 100 μL of the mixed solution was taken, 900 μL of acetonitrile was added, and the mixture was centrifuged at 10000 r / min for 10 min. The supernatant was filtered through a 0.22 μm organic nylon filter membrane, and the residual aflatoxin B1 and ochratoxin A content in the sample was detected by high performance liquid chromatography-mass spectrometry. 100 μL of the culture medium was transferred to a new sterile centrifuge tube containing 10 μL of aflatoxin B1 and ochratoxin A standard stock solution, 880 μL of inorganic salt basal medium was added, and the tube was incubated at 28℃ with shaking at 160 r / min for 7 days to verify the degradation rate. The sample with the highest degradation rate of aflatoxin B1 and ochratoxin A in both incubations was selected. The enriched sample was then plated and diluted to screen for single colonies that could remove aflatoxin B1 and ochratoxin A.

[0039] like Figure 1 A and Figure 1 As shown in Figure B, the black tea and tea samples fermented for 0 days exhibited weak degradation abilities for aflatoxin B1 and ochratoxin A. However, the initial and secondary screening results showed that after 6 days and 12 days of fermentation, and after 7 days of cultivation at 28℃, the degradation rates of the finished Fu brick tea samples ranged from 44.17% to 49.65% and 44.91% to 67.36%, respectively. The 6-day fermented sample showed high degradation efficiency for both aflatoxin B1 and ochratoxin A in both the initial and secondary screenings. Since the microbial diversity of Fu brick tea decreased in the later stages of fermentation, the 6-day fermented Fu brick tea was selected as the research subject for further isolation and purification of bacterial strains.

[0040] (2) Separation and purification: Take 100 μL of the enriched sample (sample fermented for 6 days after flowering) with the highest degradation rate of aflatoxin B1 and ochratoxin A, mix it evenly with 900 μL of inorganic salt basic liquid medium, and then dilute it to 10 with inorganic salt basic liquid medium. -3 10 -4 and 10 -5 First, 10 μL of aflatoxin B1 and ochratoxin A standard stock solutions were spread onto an inorganic salt-based plate to ensure that the concentration of aflatoxin B1 and ochratoxin A on the inorganic salt-based solid medium was 1 μg. Then, 10 μL of each stock solution was taken and diluted to a specific concentration. -3 10 -4 and 10 -5 100 μL of each sample dilution was spread onto an inorganic salt-based solid medium containing 1 μg of aflatoxin B1 and ochratoxin A, and incubated upside down at 28°C. Three replicates were set up for each dilution. Colony growth on each medium was observed during the incubation period. After 7 days of incubation, different colonies on the inorganic salt-based plates were picked and repeatedly streaked until uniformly morphological colonies were observed under a microscope. This process was repeated 6 times to obtain the corresponding aflatoxin B1 and ochratoxin A degrading strains.

[0041] After 7 days of incubation, single bacteria were picked from the inorganic salt basal plate and transferred to a centrifuge tube containing 1 μg of aflatoxin B1 and ochratoxin A and 980 μL of inorganic salt basal liquid medium. The mixture was incubated at 28 ℃ with shaking at 160 r / min for 7 days. Samples were then taken to detect the residual amounts of aflatoxin B1 and ochratoxin A in each system, and the removal rate of aflatoxin B1 and ochratoxin A by the strain was calculated. If the removal rate was greater than 40%, 50 μL of sample was transferred from the toxin tube to a new toxin tube, 440 μL of inorganic salt basal medium was added, and the mixture was incubated at 28 ℃ with shaking at 160 r / min for 7 days. The removal rate of aflatoxin B1 and ochratoxin A was then detected. If the removal rate of aflatoxin B1 and ochratoxin A by the strain exceeded 50% in both incubations, the strain was considered to be able to stably and efficiently remove aflatoxin B1 and ochratoxin A. The screened strains were stored in an aqueous glycerol solution with a final concentration of 25% (m / v) and kept at –80°C for later use.

[0042] like Figure 1 As shown in C, using a mixture of aflatoxin B1 and ochratoxin A as the sole carbon source, 113 strains capable of degrading aflatoxin B1 and ochratoxin A were isolated from Fuzhuan tea samples that had been fermenting for 6 days. Among them, four fungi achieved a degradation rate of more than 50% for aflatoxin B1 and ochratoxin A, and were named OA1, OA2, OA3 and OA4, respectively. Figure 1The results showed that the degradation rates of aflatoxin B1 and ochratoxin A by the four strains were 68.05%–78.54% and 65.16%–79.25%, respectively, with strain OA3 exhibiting the highest degradation rate.

[0043] The purified colonies OA3 were further observed and identified, and the results are as follows: 1) The isolated bacteria were inoculated into PDA medium and incubated upside down at 28°C for 5 days. DNA was extracted from the isolated strain according to the fungal DNA extraction kit instructions. Using the extracted DNA as a template, PCR amplification was performed using universal fungal internal transcribed spacer (ITS) primers ITS1 (5ʹ-TCCGTAGGTGAACCTGCGG-3ʹ) and ITS4 (5ʹ-TCCTCCGCTTATTGATATGC-3ʹ). The PCR amplification reaction system consisted of 1.5 μL each of the forward and reverse primers, 1.0 μL of genomic DNA, and 5.0 μL of 10× Buffer (containing 2.5 mM MgSO4). 2+ 1.0 μL Taq polymerase (5 u / μL), 1.0 μL dNTP (10 mM), and ddH2O were added to a final volume of 50.0 μL. The PCR amplification program was set as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, repeated 35 times, followed by a final extension at 72℃ for 7 min, and then stored at 4℃. Electrophoretic analysis of the ITS sequence amplification products of four highly efficient degrading bacteria strains in Fu brick tea is shown below. Figure 2 The four bacterial bands, with molecular weights ranging from approximately 500 bp to 750 bp and all appearing single and bright, indicate high DNA purity and freedom from contamination. Further identification was then performed. Sequencing was commissioned to Shanghai Paisenno Biotechnology Co., Ltd. The ITS sequences of strain OA3 were obtained, as shown below. The sequenced gene sequences were uploaded to the NCBI website for BLAST alignment. Strains with high homology were selected, and a phylogenetic tree was constructed using MEGA11 software. The results are as follows. Figure 3 As shown. Strains OA1, OA2, OA3, and OA4 all belong to the genus *Aspergillus*, with OA1-OA4 forming a unique cluster, exhibiting high genetic sequence similarity and a close phylogenetic relationship. BLAST alignment results show that these four strains (OA1, OA2, OA3, and OA4) are similar to *Aspergillus chevaleri* (…). Aspergillus chevalieri The sequence homology of P47 (MZ573101.1) reached 99.05%, 99.05%, 99.23%, and 99.05%, respectively. Furthermore, OA2 and OA3 showed similarities to *Aspergillus cristatus* (…). AspergilluscristatusPP126609.1 showed higher homology, reaching 99.41% and 99.80%, respectively. Existing literature indicates that *Aspergillus serrata* and *Aspergillus cristatus* are both *Aspergillus* species found in Fu brick tea, exhibiting high similarity that makes them difficult to distinguish using traditional classification methods. Studies have shown that *Aspergillus serrata* and *Aspergillus cristatus* share over 99% genetic similarity. Due to their highly similar ITS sequences, these isolates can only be identified at the genus level (*Aspergillus*). To obtain more accurate taxonomic positioning and functional prediction, the entire genome of strain OA3 was subsequently sequenced.

[0044] Aspergillus sp. (Aspergillus) OA3 (PV616835.1) CCTTTCCGGGTGAGGGGTGCCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCTGGGTCCAACCTCCCATCCGTGTCTATCTGTACCCTGTTGCTTCGGCGTGGCCACGGCCCGCCGGAGACTAACATTTGA ACGCTGTCTGAAGTTTGCAGTCTGAGTTTTTAGTTAAACAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGT GAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTTCCGTCCCTGGCAACGGGGACGGGCCCAAA AGGCAGTGGCGGCACCATGTCTGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCCCGTAGGTCCAGCTGGCAGCTAGCCTCGCAACCAATCTTTTTAACCAGGTGACCTCGGATCAGGTAGGAAGCCCCCT 2) The colony diameter of this strain was 22–25 mm after 5 days of culture on potato dextrose agar medium. Figure 4 When viewed from the front, the entire colony is round, with a dense texture, radial ridges, and distinct color layers resembling concentric circles. The edges are light yellow and radiating outwards, while the central part is darker in color. Scraping a small amount of hyphae and observing it under a microscope reveals numerous nearly spherical yellow cleistothecia.

[0045] Should Aspergillussp. (Aspergillus) OA3 was deposited at the China General Microbiological Culture Collection Center (CGMCC) on August 6, 2025, with accession number CGMCC No. 42157. To accurately identify the species name of strain OA3, its whole genome was subsequently sequenced.

[0046] Whole genome sequencing analysis of strains: *Coronavirus cristatum* Aspergillus cristatus The whole genome sequencing of OA3 was completed by Beijing Novogene Technology Co., Ltd. Glimmer was used to predict gene element CDS, Aragorn to predict tRNA, and Rnammer to predict rRNA. Functional annotation was performed by comparing the predicted gene sequences of the strain with non-redundant protein databases and other databases using BLAST to obtain the corresponding gene function annotation results. The Illumina NovaSeq and PacBio Sequel sequencing data were jointly assembled to obtain the complete genome sequence. After optimization, the genome assembly of *Aspergillus cristatus* strain OA3 yielded 8 contigs, with an N50 length of 3,589,331 bp and a GC content of 49.81%. Detailed information is shown in Table 1. Furthermore, coding genes, repetitive sequences, and non-coding RNAs were predicted using various methods to obtain the composition of the OA3 genome. The total length of the whole genome was 27,907,558 bp. A total of 6,320 genes were annotated, with a total length of 8,565,738 bp and an average length of 1,355 bp.

[0047] Table 1. Coronavirus ( Aspergillus cristatus Final genome assembly results and coding gene prediction results of OA3

[0048] As shown in Tables 2 and 3, among the scattered repetitive sequences, 1268 long terminal repeats were obtained, with a total length of 336619 bp and an average length of 270 bp. Long terminal repeats accounted for 1.21% of the genome. Among the tandem repeat sequences, 2385 tandem repeats were obtained, with repeat unit lengths ranging from 1 to 726 bp and a total length of 113943 bp, accounting for 0.36% of the genome. Among the tandem repeat sequences, 2385 tandem repeats were obtained, with repeat unit lengths ranging from 1 to 726 bp and a total length of 107640 bp, accounting for 0.39% of the genome.

[0049] Table 2. Statistics of sporadic repeat sequences

[0050] Note: Type: Type of sporadic repetitive sequence; Number: Number of repetitive sequences; Total Length (bp): Total length of repetitive sequences; In genome (%): Percentage of repetitive sequences in the genome; Average length (bp): Average length of repetitive sequences; LTR: Long terminal repetitive sequence; DNA: DNA transposon; LINE: Long sporadic repetitive sequence; SINE: Short sporadic repetitive sequence; RC: Rolling circle.

[0051] Table 3 Statistical analysis of tandem repeat sequences

[0052] Note: Type: Type of tandem repeat sequence; Number: Number of repeat sequences; Repeat Size (bp): Length range of repeat sequences; Total Length (bp): Total length of repeat sequences; In genome (%): Percentage of repeat sequences in the genome; TR: Tandem repeat sequence; Minisatellite DNA: Minisatellite DNA; Microsatellite DNA: Microsatellite DNA.

[0053] Based on the aforementioned ITS sequencing results, the species classification of strain OA3 can only be determined to be within the genus *Aspergillus*. Further species classification was determined using a non-redundant protein database. Based on the species information obtained from gene annotation, the number of annotated species and genes was calculated as follows: Figure 5 As shown. The top five bacterial species are mainly annotated as follows: Aspergillus cristatus (5505 genes) Aspergillus chevalieri (319 genes) Aspergillus glaucus (59 genes) Aspergillus ruber (45 genes) Aspergillus fumigatus (18 genes). This confirms the ITS sequencing results, showing that strain OA3 has high species homology and a similar genetic evolutionary process with Aspergillus species. Furthermore, Aspergillus cristatus The number of matching genes is far greater than that of other bacterial species; therefore, further identification of strain OA3 suggests it belongs to *Aspergillus cristatus* (…). Aspergillus cristatus ).

[0054] Based on the assembled genome sequence of the sequencing samples and the predicted results of coding genes, the genome of *Coronavirus cristatum* strain OA3 was visualized using Circos software. The results are as follows: Figure 6As shown. The outermost ring represents the genomic sequence location coordinates. From the outside in, these represent GC content, GC-skew, (gene density of coding genes, rRNA, snRNA, and tRNA), and Gene Duplication. Genomic GC content: GC content is calculated using a window size (chromosome length / 1000) bp and a step size (chromosome length / 1000) bp. The light blue area inwards indicates that the GC content in that region is lower than the average GC content of the entire genome, while the dark purple area outwards indicates the opposite. A higher peak value indicates a larger difference from the average GC content. Genomic GC skew value: Window size (chromosome length / 1000) bp and a step size (chromosome length / 1000) bp, specifically calculated as GC / G+C. The light green area inwards indicates that the G content in that region is lower than the C content, while the pink area outwards indicates the opposite. Gene density: Window size (chromosome length / 1000) bp and a step size (chromosome length / 1000) bp, representing the percentage of genes within each window.

[0055] Example 2: Effects of Environmental Factors on the Degradation of Aflatoxin B1 and Ochratoxin A by *Aspergillus cristatus* OA3 Strains: derived from *Aspergillus cristatus* OA3 isolated in Example 1.

[0056] To investigate the effects of environmental factors on the degradation of aflatoxin B1 and ochratoxin A by *Aspergillus cristatus* OA3, strain OA3 was inoculated onto potato dextrose agar and activated through two consecutive culture cycles (7 days each, 28°C). Spores were then collected after 7 days of culture using sterile water, filtered through sterile glass wool, and centrifuged at 5000 r / min at 4°C for 10 min to remove residual culture medium. The spores were resuspended in sterile water and washed three times, finally adjusted to a concentration of 1×10⁻⁶. 6 CFU / mL concentration. Spore suspensions were inoculated into inorganic salt basal media containing different concentrations of aflatoxin B1 and ochratoxin A to investigate the effects of different culture conditions on the degradation of aflatoxin B1 and ochratoxin A by strain OA3, including initial pH (3.0, 5.0, 7.0, 9.0, 11.0), inoculum size (1%, 3%, 5%, 7%, 9%), initial concentrations of aflatoxin B1 and ochratoxin A (0.5, 1.0, 1.5, 2.0 μg / mL), and culture temperature (25, 35, 45, 55℃). The control group received sterile water instead of spore suspension. Six replicates were set up for all experimental groups, three for residual degradation rate analysis and three for OD of the culture medium. 600Measurements. Except for the temperature change experiment which used different culture temperatures, all other cultures were conducted for 7 days in a shaker at 28°C and 120 rpm / min. After 7 days of culture, 100 μL of the mixture was mixed with 900 μL of acetonitrile to terminate the reaction. The sample was evaporated under nitrogen at 50°C until completely dry, and then reconstituted with 1 mL of acetonitrile. After filtration through a 0.22 μm organic membrane filter, the treated sample was transferred to a liquid chromatography vial, and the concentrations of residual aflatoxin B1 and ochratoxin A were determined using the same detection method as in Example 1.

[0057] like Figure 7 As shown, the inoculum size, initial pH, culture temperature, and initial concentrations of aflatoxin B1 and ochratoxin A significantly (p<0.05) affected the degradation capacity of strain OA3 for aflatoxin B1 and ochratoxin A. The optimal degradation rates for aflatoxin B1 and ochratoxin A were achieved at an inoculum size of 7%, reaching 80.34% and 82.50%, respectively. Subsequently, the effect of pH on biodegradation efficiency was investigated at an inoculum size of 7%, revealing that the degradation rate peaked at pH 7.0. Although the bacterial biomass (OD) remained relatively high under alkaline conditions... 600 The degradation rate was lower than that under neutral conditions, but there was no significant difference compared to pH 7.0. This may be due to the direct destructive effect of ·OH free radicals generated in a strongly alkaline environment on mycotoxins. Furthermore, it was found that strain OA3 showed no significant difference in degradation efficiency for aflatoxin B1 and ochratoxin A after 7 days of cultivation at test temperatures ranging from 25 to 55°C, indicating that *Aspergillus cristatus* OA3 has the potential to stably and effectively degrade mycotoxins during the fermentation process of Fu brick tea. It was observed that the initial toxin concentration significantly affected the degradation rates of aflatoxin B1 and ochratoxin A. The biomass of strain OA3 was not affected at different toxin concentrations, but the degradation rate decreased significantly with increasing initial toxin concentration.

[0058] Within the experimental conditions described above, strain OA3 efficiently degraded aflatoxin B1 and ochratoxin A at temperatures ranging from 25 to 55°C. Strain OA3 exhibited a wide range of culture temperatures and demonstrated varying degrees of degradation ability at pH values ​​from 3.0 to 11.0, with the optimal degradation rate observed at pH 7.0. This indicates that the strain has a broad applicability.

[0059] Example 3: Localization of the active components of *Aspergillus cristatus* OA3 in degrading aflatoxin B1 and ochratoxin A Strains OA3 were cultured in potato dextrose broth at 28°C and 120 rpm for 5 days with shaking. Then, 5 mL of the suspension was transferred to a 500 mL Erlenmeyer flask containing 95 mL of potato dextrose broth, and cultured for another 5 days with shaking to obtain the whole-cell fermentation broth of strain OA3. The sample was centrifuged at 8000 rpm for 10 min at 4°C to separate the cell-free fermentation supernatant and cell pellet. The collected cell pellet was resuspended in sterile PBS buffer and then processed using an ultrasonic disruptor (model JY92-IIN, Ningbo Scientific Biotechnology Co., Ltd.): 100% power, 3-second pulses with 3-second intervals, for a total duration of 30 min. The resulting lysate was the cell lysate. 990 μL of each sample group (containing fermentation broth, cell-free supernatant, cell-free supernatant treated at 121°C for 15 min, cell lysate, cell suspension, and cell suspension treated at 121°C for 15 min) was transferred to individual centrifuge tubes, and 10 μL of 100 μg / mL aflatoxin B1 or ochratoxin A solution was added to each tube. The control group was treated with potato dextrose broth and PBS instead of the bacterial strain components. The reaction mixture was cultured at 28°C and 120 rpm / min for 7 days with shaking, and then collected. After the culture was completed, 1 mL of acetonitrile was added to terminate the reaction. The mixture was then evaporated to complete dryness at 50°C under nitrogen atmosphere and reconstituted with 1 mL of acetonitrile. The residual levels of aflatoxin B1 or ochratoxin A were analyzed using the same detection method as in Example 1.

[0060] like Figure 8 As shown, the degradation activities of fermentation broth, cell-free supernatant, cell lysate, and cell suspension on aflatoxin B1 and ochratoxin A differed significantly. For aflatoxin B1, the degradation rates of each component were as follows: fermentation broth 74.12%, cell-free supernatant 24.99%, cell lysate 95.43%, cell suspension 51.22%, heat-treated cell-free supernatant 33.89%, and heat-treated cell suspension 26.30% (…). Figure 8 A). These results indicate that the active aflatoxin B1 degradation components in the OA3 strain are mainly located intracellularly. Heat treatment of the OA3 cell lysate significantly reduced its aflatoxin B1 degradation capacity, consistent with the characteristics of this thermally unstable and cell-bound component.

[0061] Notably, both the fermentation broth and cell-free supernatant of strain OA3 exhibited highly efficient ochratoxin A degradation capabilities, with removal rates reaching 81.90% and 65.09%, respectively. These values ​​were significantly higher than those of cell lysate (17.40%) and cell suspension (12.05%). Figure 8(B) indicates that the ochratoxin A degradation components of strain OA3 are mainly located in the extracellular components. Experimental data show that, under the same culture time, the removal efficiency of ochratoxin A in the heat-treated cell-free supernatant is significantly improved compared to the untreated sample. This suggests that OTA degradation substances in the cell-free supernatant may exert their effects through adsorption mechanisms or bioactive components such as thermostable enzymes.

[0062] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A strain of *Aspergillus cristatus* that degrades fungal toxins in Fu brick tea, characterized in that, The aforementioned *Eurotium cristatum* ( Aspergillus cristatus The accession number of OA3 is CGMCC No. 42157.

2. The application of the *Aspergillus cristatus* strain described in claim 1, which degrades mycotoxins in Fuzhuan tea, in the preparation of mycotoxin biodegrading agents.

3. The application according to claim 2, characterized in that, The aforementioned mycotoxin biodegrading agents include whole-cell fermentation broth, cell lysate, and / or metabolic broth.

4. The application according to claim 3, characterized in that, The method for preparing the whole-cell fermentation broth includes: inoculating the *Aspergillus cristatus* into potato dextrose broth and culturing it at 28°C for 7 days to obtain the whole-cell fermentation broth; The method for preparing the cell lysate includes: centrifuging the whole-cell fermentation broth, resuspending the precipitate in sterile water, and then breaking it up to obtain the cell lysate. The method for preparing the metabolic liquid includes: centrifuging the whole-cell fermentation broth, and obtaining the supernatant as the metabolic liquid.

5. The application according to claim 4, characterized in that, In the method for preparing the whole-cell fermentation broth, the inoculum amount of *Aspergillus cristatus* is 1%–9%, ​​and the effective viable count of *Aspergillus cristatus* in the whole-cell fermentation broth is >1×10⁻⁶. 6 CFU / mL.

6. The application according to any one of claims 2-4, characterized in that, The degradation temperature of the aforementioned mycotoxin biodegrading agent is 25–55°C; the degradation time is >7 days; and the degradation pH is 3.0–11.

0.

7. A mycotoxin biodegrading agent, characterized in that, Contains *Aspergillus cristatus* as described in claim 1.

8. The application of the *Aspergillus cristatus* strain according to claim 1, which degrades mycotoxins in Fu brick tea, in the preparation of products that degrade aflatoxin B1 and / or ochratoxin A.

9. The application according to claim 8, characterized in that, The degradation temperature of the product is 25–55℃; the degradation time is >7 days; and the degradation pH is 3.0–11.

0.

10. A method for degrading mycotoxins, said mycotoxins comprising aflatoxin B1 and / or ochratoxin A, characterized in that, include: In vitro treatment of materials containing mycotoxins with the *Aspergillus cristatus* of claim 1 or the mycotoxin biodegrading agent of claim 7: the materials refer to at least one of tea, traditional Chinese medicine, or their processing by-products; The degradation temperature is 25–55℃; the degradation time is >7 days; and the degradation pH is 3.0–11.0.

Images