Yarrowia lipolytica genetically engineered bacterium capable of producing decaisopentenol and application of yarrowia lipolytica genetically engineered bacterium

Abstract

The invention discloses yarrowia lipolytica genetically engineered bacteria capable of producing decaisopentenol and application of the yarrowia lipolytica genetically engineered bacteria, and belongs to the technical field of bioengineering. The yarrowia lipolytica genetically engineered bacterium is obtained by cloning a decene diphosphate synthase gene into yarrowia lipolytica, overexpressing related genes of an endogenous acetyl coenzyme A synthetic pathway and a mevalonic acid pathway of the yarrowia lipolytica, weakening a squalene synthetic pathway and knocking out endogenous ylCOQ1 enzyme. Experiments prove that the yarrowia lipolytica genetically engineered bacterium can significantly improve the yield of decyl isopentenol, and the product serves as an important precursor for chemical synthesis of coenzyme Q10, so that the engineered bacterium and the product thereof can be applied to biochemical synthesis of coenzyme Q10. The method is green and efficient, and has important industrial application value.

Description

TECHNICAL FIELD

[0001] The present application relates to a Yarrowia lipolytica genetically engineered bacterium for producing decaprenylphenol and application thereof, and belongs to the technical field of bioengineering. BACKGROUND

[0002] Coenzyme Q10 (CoQ10) is a liposoluble quinone compound, which plays a core role in human respiratory chain electron transfer, ATP synthesis, antioxidant and immune regulation. It is clinically used in cardiovascular diseases, hepatitis, cancer adjuvant therapy and health care product field, and the global demand is growing at an annual rate of 15%-20%, with a significant market gap.

[0003] The current mainstream production methods of CoQ10 include biological extraction method, microbial fermentation method, semi-chemical synthesis method and total chemical synthesis method. Among them, the biological extraction method is extracted from animal heart or plant, with low product purity, high cost (need enrichment and purification), and is difficult to scale due to raw material limitation. The yield of microbial fermentation method is unstable, with poor predictability, relying on experience optimization, and the cost is still high. The semi-chemical synthesis method is to synthesize decaprenylphenol (CoQ10 side chain precursor) from solanesol, and then couple with the mother ring. However, solanesol is expensive, and the raw material utilization rate is low in the process, and the steps are complicated (need bromination, Grignard reaction, etc.), and the total yield is only 50%-75%. The steps of total chemical synthesis method are complex, and it is difficult to control the stereoselectivity.

[0004] Among them, the structural formula of decaprenylphenol is as follows: .

[0005] In the existing semi-chemical synthesis, decaprenylphenol is synthesized from solanesol, which is brominated to form solanesyl bromide, then reacted with ethyl acetoacetate to form solanesyl ketone, and finally reduced to decaprenylphenol. The total yield is only 54%-67%, and toxic reagents (such as phosphorus tribromide) are used, and there are many by-products. Through synthetic biology method, natural microorganisms can generate isopentenyl diphosphate (IPP / DMAPP) through mevalonic acid (MVA) or methyl erythritol phosphate (MEP) pathway, and then extend it through polyisoprene transferase. However, the synthesis efficiency of long-chain (C50) isoprene alcohol is low, and the endogenous pathway regulation of microorganisms is complex. How to modify the natural microorganisms to effectively synthesize decaprenylphenol is a research topic. SUMMARY

[0006] The purpose of the present application is to overcome the shortcomings of the prior art, and to provide a Yarrowia lipolytica genetically engineered bacterium for producing decaprenylphenol. Yarrowia lipolytica ).

[0007] The application provides a Yarrowia lipolytica gene engineering bacterium for producing decaprenylphenol, which is obtained by overexpressing a decaprenyl diphosphate synthase gene in a Yarrowia lipolytica starting bacterium; the decaprenyl diphosphate synthase gene is integrated into the genome of the Yarrowia lipolytica to be overexpressed in the cytoplasm; and the starting bacterium is a leucine and / or uracil auxotrophic Yarrowia lipolytica.

[0008] Preferably, the decaprenyl diphosphate synthase gene is from the decaprenyl diphosphate synthase RsDDSA gene of Rhodobacter sphaeroides, and the expression cassette of the decaprenyl diphosphate synthase gene carried by the linearized plasmid is integrated into the genome of the Yarrowia lipolytica by the non-homologous end joining mechanism of the Yarrowia lipolytica.

[0009] Specifically, the nucleotide sequence of the decaprenyl diphosphate synthase gene is codon-optimized according to the expression preference of the Yarrowia lipolytica. The RsDDSA gene is codon-optimized according to the preference of the Yarrowia lipolytica, and the nucleotide sequence is shown in SEQ ID NO. 1.

[0010] In the specific embodiment, the decaprenyl diphosphate synthase gene is integrated into the genome of the Yarrowia lipolytica in 1, 2, 3, or 4 copies.

[0011] Preferably, the Yarrowia lipolytica is selected from any one of Yarrowia lipolytica E150 (CLIB122), Yarrowia lipolytica E129 (CLIB121), Yarrowia lipolytica po1 series strains (Po1d, Po1e, Po1f, Po1g, and Po1h), and Yarrowia lipolytica w29 (CLIB89, ATCC20460, and CBS7504), and the like, or a derivative strain thereof. Further, one or both of the endogenous acetyl-CoA synthase pathway acetyl-CoA thiolase ERG10 and HMG-CoA synthase ERG13 genes of the Yarrowia lipolytica are overexpressed, or one or more of the endogenous mevalonate pathway hydroxymethylglutaryl-CoA reductase tHMG1, mevalonate kinase ERG12, phosphomevalonate kinase ERG8, mevalonate diphosphate decarboxylase ERG19, IPP isomerase IDI, and geranyl / farnesyl diphosphate synthase ERG20 genes of the Yarrowia lipolytica are overexpressed.

[0012] Specifically, the overexpression of the endogenous genes is achieved by the non-homologous end joining-mediated iterative gene integration technology.

[0013] Further, the hydroxymethylglutaryl-CoA reductase tHMG1 gene is overexpressed. Specifically, two copies of the hydroxymethylglutaryl-CoA reductase tHMG1 gene are overexpressed.

[0014] Further, the overexpression of the hydroxymethylglutaryl coenzyme A reductase tHMG1 gene is a truncated hydroxymethylglutaryl coenzyme A reductase tHMG1 gene.

[0015] Further, the overexpression of the acetyl-CoA thiolase ERG10 and HMG-CoA synthase ERG13 genes is simultaneously performed.

[0016] Further, the overexpression of the mevalonate kinase ERG12, phosphomevalonate kinase ERG8 and mevalonate diphosphate decarboxylase ERG19 genes is simultaneously performed.

[0017] Further, the overexpression of the bifunctional enzyme (geranyl diphosphate synthase and farnesyl diphosphate synthase) ERG20 gene and the IPP isomerase IDI gene is simultaneously performed.

[0018] Further, the expression of the squalene synthase ERG9 gene in the squalene synthesis pathway is weakened. Specifically, the squalene synthase ERG9 gene is weakened or knocked out by a homologous recombination-mediated gene knockout technology or a gene editing method. More specifically, the weakening method is to truncate the promoter of ERG9 to 50 bases, and the nucleotide sequence of the weakened promoter is shown in SEQ ID NO. 3. Wherein the truncated squalene synthase ERG9 promoter expression cassette is provided with an upstream and downstream homologous arm on both sides of the retained 50bp promoter, and the homologous arm is 1000bp-1500bp.

[0019] In another embodiment, the coding gene of the endogenous ylCOQ1 enzyme is replaced by the RsDDSA coding gene by homologous recombination-mediated gene replacement, but the mitochondrial localization peptide of the endogenous COQ1 enzyme is retained at the N terminal. Preferably, the mitochondrial localization peptide nucleotide sequence is shown in SEQ ID NO. 4 or SEQ ID NO. 5.

[0020] The endogenous ylCOQ1 enzyme replacement expression cassette contains the upstream homologous arm of the ylCOQ1 gene, the mitochondrial localization signal peptide, the decaprenyl diphosphate synthase RsDDSA and the downstream homologous arm of the ylCOQ1 gene.

[0021] Preferably, the mitochondrial localization signal peptide is any one of 40bp, 50bp, 105bp, 120bp, 150bp, 165bp, 180bp at the N terminal of the ylCOQ1 gene; and the upstream and downstream homologous arms are 1000bp-1500bp. Preferably, the endogenous ylCOQ1 enzyme replacement expression cassette plasmid carries a LEU2 label, which can complement the LEU2 defect of the strain.

[0022] In a specific example, the relevant enzymes are as follows: acetyl-CoA thiolase ERG10 (encoded by the nucleotide sequence shown in Gene ID: 2911520), HMG-CoA synthase ERG13 (encoded by the nucleotide sequence shown in Gene ID: 2907642), truncated hydroxymethylglutaryl-CoA reductase tHMG1 (encoded by the nucleotide sequence shown in SEQ ID NO. 2), mevalonate kinase ERG12 (encoded by the nucleotide sequence shown in Gene ID: 2906793), phosphomevalonate kinase ERG8 (encoded by the nucleotide sequence shown in Gene ID: 2912386), mevalonate diphosphate decarboxylase ERG19 (encoded by the nucleotide sequence shown in Gene ID: 2907970), IPP isomerase IDI (encoded by the nucleotide sequence shown in Gene ID: 2907710), geranyl / farnesyl diphosphate synthase ERG20 (encoded by the nucleotide sequence shown in Gene ID: 2912329), squalene epoxidase of the squalene synthesis pathway ERG9 (encoded by the nucleotide sequence shown in Gene ID: 2906604), endogenous ylCOQ1 enzyme (encoded by the nucleotide sequence shown in Gene ID: 2909963), mitochondrial localization peptide nucleotide sequence shown in SEQ ID NO. 4 or SEQ ID NO. 5.

[0023] The overexpression is controlled by a strong promoter selected from any one of PTEF, Php4d, PTEFin, PFBA, PFBAin, PPOX2, PEXP, PPOT1 or PGPD and PTDH, and the terminator is a terminator of Yarrowia lipolytica, for example, any one of Txpr2t, Tmig1t, Tlip2t, Tcyc1t, Tpex3t, Tpex10t or Tpex20t.

[0024] In one specific embodiment, the preservation number of the Yarrowia lipolytica genetically engineered strain is CCTCC NO. M20251154, which was preserved in the China Center for Type Culture Collection (CCTCC) on May 22, 2025, and the classification name is Yarrowia lipolytica DPP10.

[0025] The application also provides the use of the Yarrowia lipolytica genetically engineered strain in the preparation of decaprenylphenol or coenzyme Q10.

[0026] The present application further provides a method for preparing decaprenyl alcohol by fermentation of the Yarrowia lipolytica genetically engineered bacteria to produce decaprenyl alcohol. The method comprises the following steps, for example: mixing the bacterial liquid of the Yarrowia lipolytica genetically engineered bacteria with ethyl acetate, homogenizing, centrifuging, taking the upper ethyl acetate layer, drying, adding ethanol for redissolution, and filtering to obtain the product. The method for preparing the bacterial liquid of the Yarrowia lipolytica genetically engineered bacteria comprises the following steps: activating the bacterial strain of the Yarrowia lipolytica genetically engineered bacteria in a culture medium containing glucose to obtain a culture liquid; and transferring the culture liquid to a fermentation culture medium for further culture to obtain the bacterial liquid.

[0027] The present application modifies Yarrowia lipolytica by synthetic biology to obtain Yarrowia lipolytica genetically engineered bacteria producing decaprenyl alcohol. The yield of decaprenyl alcohol in the shake flask fermentation reaches more than 5 mg / L by overexpressing the decaprenyl diphosphate synthase RsDDSA gene, and the yield is the highest when three copies of the gene are integrated. Further optimization of genetic modification is carried out by further research to further improve the yield of decaprenyl alcohol of the genetically engineered bacteria, for example, the yield can reach more than 73 mg / L, more than 89 mg / L, and in a best example, the yield of decaprenyl alcohol of the genetically engineered bacteria of the present application can even reach more than 180 mg / L after shake flask fermentation. The raw material of the present application is easy to obtain, and glucose is used as the carbon source without the need for petrochemical raw materials. The present application provides a new method of “biology + chemistry” for producing coenzyme Q10. In addition, the hydroxyl activation of biological decaprenyl can be efficiently coupled with the benzoquinone nucleus of coenzyme Q10 by enzyme catalysis or transition metal catalysis (such as Pd and Cu), which reduces the cost while improving the yield, and has industrial development potential.

[0028] Obviously, according to the above content of the present application, according to the ordinary technical knowledge and common means in the art, other various forms of modifications, replacements or changes can be made without departing from the above basic technical idea of the present application.

[0029] The above content of the present application is further described in detail by the following specific embodiments in the form of examples. However, it should not be understood that the scope of the above subject matter of the present application is limited to the following examples. Any technology realized based on the above content of the present application belongs to the scope of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1 Comparison of the yields of decaprenyl alcohol produced by the genetically engineered bacteria of the present application.

[0031] Biological material preservation information: the genetically engineered bacteria DPP10 was preserved in China Center for Type Culture Collection (CCTCC) on May 22, 2025, and the address of the preservation unit is No. 299, Banyi Road, Wuchang District, Wuhan City, Hubei Province. The preservation number is CCTCC No. M 20251154, and the classification name is Yarrowia lipolytica DPP10. DETAILED DESCRIPTION

[0032] In the following examples and experimental examples, the reagents and raw materials not specifically explained are commercially available products. The relevant gene or nucleotide sequence information involved in the present application is as follows: RsDDSA gene codon-optimized nucleotide sequence (SEQ ID No. 1), acetyl-CoA thiolase ERG10 (Gene ID: 2911520), HMG-CoA synthase ERG13 (Gene ID: 2907642), truncated hydroxymethylglutaryl-CoA reductase tHMG1 (nucleotide sequence as shown in SEQ ID NO. 2), mevalonate kinase ERG12 (Gene ID: 2906793), phosphomevalonate kinase ERG8 (Gene ID: 2912386), mevalonate diphosphate decarboxylase ERG19 (Gene ID: 2907970), IPP isomerase IDI (Gene ID: 2907710), geranyl / farnesyl diphosphate synthase ERG20 (Gene ID: 2912329), squalene epoxidase ERG9 (Gene ID: 2906604) of the squalene synthesis pathway, endogenous ylCOQ1 enzyme (Gene ID: 2909963), mitochondrial localization peptide nucleotide sequence as shown in SEQ ID NO. 4 or SEQ ID NO. 5.

[0033] Nucleotide sequence of RsDDSA (SEQ ID NO. 1):

[0034] Nucleotide sequence of tHMG1 (SEQ ID NO. 2)

[0035] Truncated promoter of ERG9 (SEQ ID NO. 3) GGACACAAACTCGCTTGTTCACCAACTTCGAACCACCACTTTCAGCCACC.

[0036] Nucleotide sequence of mitochondrial localization peptide 1 of the retained COQ1 enzyme (SEQ ID NO. 4): atgctgagagtcggacgaattggcaccaagaccctagccagcagcagcctgcgtttcgtggcaggtgctcggcccaaatccacgctcaccgaggccgtgctggagaccacagggctgctg.

[0037] Nucleotide sequence of mitochondrial localization peptide 2 of the retained COQ1 enzyme (SEQ ID NO. 5): atgctgagagtcggacgaattggcaccaagaccctagccagcagcagcctgcgtttcgtggcaggtgctcggcccaaatccacgctcaccgaggccgtgctggagaccacagggctgctgaaaaccacgccccaaaaccccgagtggtct.

[0038] Example 1

[0039] The recombinant genetically engineered bacteria provided in this example were prepared according to the following method: The HO-hisG-URA3-hisG-poly-HO vector (purchased from Shanghai Newpui Biotechnology Co., Ltd.) was double-cut with restriction enzymes Xhol and Sail, and the 7527 bp fragment was recovered from the gel to obtain a linearized vector 1; the strong promoter TEFin fragment 1 was obtained by PCR with primers F1 and R1 using the Yarrowia lipolytica genome as a template; the codon-optimized decenyl diphosphate synthase RsDDSA gene was obtained by PCR with primers F2 and R2; the terminator Txpr2t fragment 3 was obtained by PCR with primers F3 and R3 using the Yarrowia lipolytica genome as a template; the vector 1 and fragments 1, 2, and 3 were subjected to multi-fragment homologous recombination by the ClonExpress MultiS OneStep Cloning Kit reagent kit from Novagen, and the Escherichia coli DH5a competent cells were transformed, and the plasmid containing the RsDDSA expression cassette was obtained by verification to obtain the plasmid pURA.

[0040] The pURA was linearized with Mlul and FastAP enzyme, and the vector 2 was purified. The RsDDSA expression cassette was obtained by PCR with plasmid pURA as template and primers F4 and R3, and then purified after Dpnl enzyme digestion. The vector 2 and fragment 4 were cloned by ClonExpress II One Step Cloning Kit of Invitrogen, and the plasmid pURA2 containing two copies of RsDDSA expression cassette was obtained by verifying the plasmid.

[0041] Table 1, the primer sequence information mentioned in this embodiment .

[0042] Similarly, the plasmids pURA3 and pURA4 containing three and four copies of RsDDSA expression cassette can be constructed respectively.

[0043] After linearization of the plasmid, the Frozen-EZ Yeast Transformation II Kit™ yeast transformation kit of Zymo Research Company was used for transformation, and the linearized plasmid was expressed in Yarrowia lipolytica po1f. The expression cassette carried by the linearized plasmid was integrated into the genome through the non-homologous end joining (NHEJ) mechanism of Yarrowia lipolytica. After hole plate screening and shake flask fermentation verification, the series of engineering recombinant strains DPP1~4 were obtained.

[0044] The series of strains DPP1~4 were activated on YPD (yeast extract peptone dextrose agar medium) plate, and single colonies were picked on YPD test tube medium. The culture conditions were 30°C, 220 rpm, and the culture time was 24 h. Then 2% of the culture liquid was transferred to 30 mL YPD fermentation medium. The culture conditions were 30°C, 220 rpm, and the culture time was 96 h. The cell growth was detected by measuring the optical density (OD600) at wavelength 600 nm, and the cell broth and ethyl acetate were mixed (volume ratio 1:1), zirconium oxide beads were added for homogenization, and the upper ethyl acetate layer was taken after centrifugation. After drying, ethanol was added for redissolution, and the filtrate was detected by liquid chromatography (LC) to detect the yield of decaprenylphenol (the concentration of the product was calculated according to the volume of the culture liquid). The results are shown in Table 2. The recombinant strain DPP3 containing three copies of RsDDSA expression cassette had the highest yield of decaprenylphenol, which could reach 10.42 mg / L.

[0045] Table 2, comparison of decaprenylphenol yield of DPP1~4 recombinant genetically engineered bacteria .

[0046] Example 2

[0047] The recombinant genetically engineered bacteria DPP3 constructed in Example 1 loses one HisG tag and URA3 screening marker under the screening pressure of 5-fluoroorotic acid, and then the endogenous acetyl-CoA thiolase ERG10, HMG-CoA synthase ERG13, truncated hydroxymethylglutaryl-CoA reductase tHMG1, mevalonate kinase ERG12, phosphomevalonate kinase ERG8, mevalonate diphosphate decarboxylase ERG19, IPP isomerase IDI, geranylgeranyl diphosphate synthase ERG20, squalene epoxidase ERG9 overexpressed.

[0048] wherein tHMG1 overexpresses two copies simultaneously, the promoter is PTEFin, and the terminator is Txpr2t (PTEFin-tHMG1-Txpr2t); the ERG10 expression cassette (PFBAin-ERG10-Tlip2t) and the ERG13 (PGPD-ERG13-TCYC1t) expression cassette are connected and overexpressed simultaneously; the ERG12 expression cassette (PFBAin-ERG12-Tlip2t), the ERG8 expression cassette (PTEFin-ERG8-Txpr2t), and the ERG19 expression cassette (PGPD-ERG19-TCYC1t) are connected and overexpressed simultaneously; the ERG20 expression cassette (PFBAin-ERG20-Tlip2t) and the IDI expression cassette (PTEFin-IDI-Txpr2t) are connected and overexpressed simultaneously. After screening verification, the series of engineering recombinant strains DPP5-8 are obtained, each of which loses one HisG tag and URA3 screening marker under the screening pressure of 5-fluoroorotic acid, so as to be used for URA screening in the next round.

[0049] wherein, taking the simultaneous overexpression of ERG10 and ERG13 as an example, the endogenous ERG10 and ERG13 genes are obtained by Yarrowia lipolytica genome PCR, and the pUFERG10 plasmid and the pUGERG13 plasmid are respectively constructed by one-step cloning; the linearized pUFERG10 vector is obtained by cutting pUFERG10 with SpeI and FastAP; the PGPD-ERG13-TCYC1t expression cassette is obtained by PCR using pUGERG13 as a template; and the linearized pUFERG10 vector and the PGPD-ERG13-TCYC1t expression cassette are connected to obtain an expression plasmid containing two expression cassettes by one-step cloning.

[0050] Wherein, DPP6 is obtained by engineering iteration based on DPP5, and so on. After obtaining DPP5, one HisG tag and URA3 screening marker are lost under the screening pressure of 5-fluoroorotic acid, the DPP5 losing the screening marker is made into yeast competent by Frozen-EZ Yeast Transformation II Kit™ kit, the above-mentioned ERG10 expression cassette (PFBAin-ERG10-Tlip2t) and ERG13 expression cassette (PGPD-ERG13-TCYC1) are transformed into the competent by Frozen-EZ Yeast Transformation II Kit™, the expression cassettes are integrated on the genome of DPP5 by the mechanism of non-homologous end joining (NHEJ) of Yarrowia lipolytica. DPP6 is obtained by screening verification. In succession, the subsequent engineering bacteria can be obtained.

[0051] The culture and detection conditions are the same as in Example 1, and the results are shown in Table 3.

[0052] Table 3, comparison of DPP5-8 recombinant engineering bacteria decaprenyl alcohol production .

[0053] Example 3

[0054] The recombinant genetic engineering bacteria DPP8 constructed in Example 2 is taken, one HisG tag and URA3 screening marker are lost under the screening pressure of 5-fluoroorotic acid, and the 477bp at the N terminal of squalene synthase ERG9 promoter is knocked out by homologous recombination mediated gene knockout technology, only leaving 50bp to weaken the expression of squalene synthase ERG9, while ensuring the normal growth of the strain is not destroyed. Among them, the upstream homologous arm is 1311bp, the downstream homologous arm is 1359bp, and a hisG-URA3-hisG marker cassette is connected in the middle. The engineering recombinant strain DPP9 is obtained by colony PCR verification and fermentation verification.

[0055] The culture and detection conditions are the same as in Example 1. The results are shown in Table 4.

[0056] Table 4, comparison of DPP9 recombinant engineering bacteria decaprenyl alcohol production .

[0057] Example 4

[0058] The recombinant genetically engineered bacteria constructed in Example 3 were screened under 5-fluoroorotic acid pressure to lose a HisG tag and a URA3 screening marker, and the endogenous ylCOQ1 enzyme was replaced by RsDDSA through homologous recombination-mediated gene replacement, but the N-terminal 120bp mitochondrial localization peptide of the endogenous COQ1 enzyme was retained. The upstream homologous arm was 1304bp (containing the 120bp mitochondrial localization peptide), the downstream homologous arm was 1300bp, and a RsDDSA and hisG-URA3-hisG marker cassette were connected in the middle. After screening verification, the engineering recombinant strain DPP10 (preservation number: CCTCC NO. M20251154) was obtained.

[0059] The culture conditions were the same as in Example 1. The results are shown in Table 5.

[0060] Table 5, DPP10 recombinant engineering bacteria decaprenyl alcohol production .

[0061] As can be seen from the above examples and experimental examples (such as Figure 1 The comparative diagram of the shake flask yield of decaprenyl alcohol is shown), the application constructs a Yarrowia lipolytica gene engineering bacteria for producing decaprenyl alcohol, the raw material is easy to obtain, the route is clear, decaprenyl alcohol is a precursor for producing coenzyme Q10, and the development of the whole cell conversion engineering bacteria provides a new method of "biochemistry" for producing coenzyme Q10. The application reduces the cost while improving the yield, is suitable for industrial scale production, and has good application prospect.

Claims

1. A lipophilic yeast that produces decanopentenol (Yersinia lipolytica) Yarrowia lipolytica Genetically engineered bacteria, characterized in that, The method involves overexpressing the decene diphosphate synthase gene in the *Yersinia lipolytica* strain; the decene diphosphate synthase gene is then integrated into the *Yersinia lipolytica* genome and overexpressed in the cytoplasm. The starting strain is a leucine and / or uracil auxotrophic lipophilic yeast.

2. The genetically engineered *Yarrowia lipolytica* strain according to claim 1, characterized in that: The decene diphosphate synthase gene is derived from the decene diphosphate synthase RsDDSA gene of Rhodotorula globulus, and the expression cassette of the decene diphosphate synthase gene carried by the linearized plasmid is integrated into the genome of Yersinia lipolytica through a non-homologous end joining mechanism.

3. The genetically engineered *Yarrowia lipolytica* strain according to claim 2, characterized in that: The nucleotide sequence of the decene diphosphate synthase gene is codon-optimized according to the expression preference of Yersinia lipolytica; the decene diphosphate synthase gene is integrated into the genome in 1, 2, 3 or 4 copies.

4. The Yersinia lipolyticis genetically engineered strain according to claim 1, characterized in that: The chassis strain is an auxotrophic strain containing leucine and uracil.

5. The genetically engineered *Yarrowia lipolytica* strain according to claim 4, characterized in that: This includes *Yersinia lipolytica* E150 / CLIB122, *Yersinia lipolytica* E129 / CLIB121, *Yersinia lipolytica* Po1d, *Yersinia lipolytica* Po1e, *Yersinia lipolytica* Po1f, *Yersinia lipolytica* Po1g, *Yersinia lipolytica* Po1h, *Yersinia lipolytica* w29 / CLIB89, *Yersinia lipolytica* ATCC20460, or *Yersinia lipolytica* CBS7504.

6. The *Yarrowia lipolytica* genetically engineered strain according to any one of claims 1 to 5, characterized in that: Furthermore, one or two of the genes of acetyl-CoA thiolysis enzyme ERG10 and HMG-CoA synthase ERG13 from the endogenous acetyl-CoA synthesis pathway in Yersinia lipolytica are overexpressed, and / or one or more of the genes of hydroxymethylglutaryl-CoA reductase tHMG1, mevalonate kinase ERG12, mevalonate phosphate kinase ERG8, mevalonate diphosphate decarboxylase ERG19, IPP isomerase IDI, and geranyl / farnesyl diphosphate synthase ERG20 from the endogenous mevalonate pathway in Yersinia lipolytica are overexpressed.

7. The *Yarrowia lipolytica* genetically engineered strain according to any one of claims 6, characterized in that: Overexpression of endogenous genes is achieved through iterative gene integration technology mediated by non-homologous end joining.

8. The *Yarrowia lipolytica* genetically engineered strain according to any one of claims 1 to 5, characterized in that: Further overexpression of the tHMG1 gene of hydroxymethylglutaryl-CoA reductase.

9. The genetically engineered *Yarrowia lipolytica* strain according to claim 8, characterized in that: Overexpression of two copies of the tHMG1 gene containing hydroxymethylglutaryl-CoA reductase.

10. The genetically engineered *Yarrowia lipolytica* strain according to claim 9, characterized in that: Further overexpression of the hydroxymethylglutaryl-CoA reductase tHMG1 gene resulted in a truncated hydroxymethylglutaryl-CoA reductase tHMG1 gene.

11. The *Yarrowia lipolytica* genetically engineered strain according to any one of claims 1 to 5, characterized in that: Further, simultaneously overexpress the genes for acetyl-CoA thiolase ERG10 and HMG-CoA synthase ERG13; or, Further, simultaneously overexpress the genes for mevalonate kinase ERG12, mevalonate phosphate kinase ERG8, and mevalonate diphosphate decarboxylase ERG19; or, Furthermore, the bifunctional enzyme ERG20 gene of gerany diphosphate synthase / farnesy diphosphate synthase and the IPP isomerase IDI gene were simultaneously overexpressed.

12. The genetically engineered *Yarrowia lipolytica* strain according to claim 6, characterized in that: Furthermore, the squalene synthase ERG9 gene can be weakened or knocked out using homologous recombination-mediated gene knockout technology or gene editing methods.

13. The genetically engineered *Yarrowia lipolytica* strain according to claim 12, characterized in that: The gene encoding the endogenous ylCOQ1 enzyme was replaced with the gene encoding RsDDSA through homologous recombination-mediated gene substitution, but the mitochondrial localization peptide of the endogenous COQ1 enzyme was retained at the N-terminus.

14. The genetically engineered *Yarrowia lipolytica* strain according to claim 6, characterized in that: The overexpression is controlled by a strong promoter, which is selected from any one of PTEF, Php4d, PTEFI, PFBA, PFBAin, PPOX2, PEXP, PPOT1, or PGPD and PTDH; the terminator is any one of the terminators of Yersinia lipophila, Txpr2t, Tmig1t, Tlip2t, Tcyc1t, Tpex3t, Tpex10t, or Tpex20t.

15. The genetically engineered *Yarrowia lipolytica* strain according to claim 6, characterized in that: Its accession number is: CCTCCNO. M20251154.

16. The use of the genetically engineered *Yarrowia lipolytica* strain as described in any one of claims 1 to 15 in the preparation of decanterenol or coenzyme Q10.

17. A method for preparing decanoisopentenol, characterized in that, It utilizes the genetically engineered *Yarrowia lipolytica* strain according to any one of claims 1 to 15 to produce decanpentol.

Images