Application of BvCCoAOMT gene in improving the freezing resistance of Arabidopsis

Abstract

The application discloses application of a BvCCoAOMT gene in improving the freezing resistance of Arabidopsis thaliana and belongs to the technical field of plant stress resistance. The application aims to improve the freezing resistance of Arabidopsis thaliana. The application provides application of a BvCCoAOMT protein in improving the freezing resistance and oxidation resistance of Arabidopsis thaliana, and the amino acid sequence of the BvCCoAOMT protein is shown as SEQ ID NO. 2. Heterologous expression of the BvCCoAOMT gene alleviates the damage caused by freezing stress to Arabidopsis thaliana seedlings.

Description

Technical Field

[0001] This invention belongs to the field of plant stress resistance technology, specifically involving the application of BvCCoAOMT protein in improving the freezing resistance of Arabidopsis thaliana. Background Technology

[0002] Caffeoyl-CoA O-methyltransferase (CCoAOMT) is a key S-adenosylmethionine (SAM)-dependent O-methyltransferase involved in the biosynthesis of lignin monomers in plants. In the classical pathway, it catalyzes the methylation of caffeoyl-CoA to feruloyl-CoA, providing a substrate for the synthesis of guaiacyl (G) lignin.

[0003] Temperature is a major limiting factor determining the geographical distribution of plants and a primary factor affecting the yield and quality of agricultural and horticultural crops under cultivation conditions. Plant frost damage refers to the non-infectious physiological damage caused when ice crystals form within plants (intercellular spaces or cells) when temperatures drop below freezing, disrupting cell structure and physiological functions. It is a direct injury to plants from low temperatures and is closely related to the intensity (temperature level), duration of frost damage, and the plant's own cold resistance.

[0004] As the world's second-largest sugar crop (accounting for about one-fifth of global sugar production), sugar beet growth and development are highly dependent on cool climates. However, low-temperature freezing damage remains the core hazard threatening its yield, quality, and industrial stability. From the seedling stage to harvest, freezing damage can severely hinder normal sugar beet growth and even lead to crop failure through direct and indirect effects. Therefore, research on sugar beet frost resistance is essential. However, genetic modification of sugar beets is relatively difficult, so it is necessary to first study the frost-resistant genes in sugar beets. Studying the development of frost-resistant genes in Arabidopsis thaliana is an urgent priority. Summary of the Invention

[0005] The purpose of this invention is to improve the freezing resistance of Arabidopsis thaliana.

[0006] The present invention provides an amino acid sequence of BvCCoAOMT protein, the amino acid sequence being shown in SEQ ID NO.2.

[0007] This invention provides a BvCCoAOMT gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] This invention provides an application of BvCCoAOMT protein in improving the freezing resistance or antioxidant capacity of Arabidopsis thaliana. The amino acid sequence of BvCCoAOMT protein is shown in SEQ ID NO.2.

[0009] This invention provides an application of the BvCCoAOMT gene in improving the freezing resistance or antioxidant capacity of Arabidopsis thaliana. The nucleotide sequence of the BvCCoAOMT gene is shown in SEQ ID NO.1.

[0010] This invention provides an application of a recombinant vector containing the BvCCoAOMT gene in improving the freezing resistance or antioxidant capacity of Arabidopsis thaliana, characterized in that the nucleotide sequence of the BvCCoAOMT gene is shown in SEQ ID NO.1.

[0011] To further specify, the departure carrier is pEarleyGate101.

[0012] This invention provides an application of recombinant microbial cells containing the BvCCoAOMT gene in improving the freezing resistance or antioxidant capacity of Arabidopsis thaliana. The nucleotide sequence of the BvCCoAOMT gene is shown in SEQ ID NO.1.

[0013] To further specify, the originating microbial cell is a eukaryotic microbial cell or a prokaryotic microbial cell.

[0014] Furthermore, the freezing condition is specified as -3 degrees Celsius.

[0015] Further, applications also include increasing relative conductivity and accumulating osmotic conditioning substances.

[0016] This invention provides a breeding method for improving the freezing resistance or antioxidant capacity of Arabidopsis thaliana. The specific breeding steps are as follows:

[0017] Step 1: Ligate the BvCCoAOMT gene with the overexpression vector to obtain a recombinant vector;

[0018] Step 2: Transform the recombinant vector obtained in Step 1 into Agrobacterium to obtain recombinant Agrobacterium;

[0019] Step 3: Transfect the recombinant Agrobacterium obtained in Step 2 into Arabidopsis thaliana to obtain transgenic plants.

[0020] Further specifying, the primers for amplifying the BvCCoAOMT gene are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0021] Beneficial effects: Heterologous expression of the BvCCoAOMT gene alleviated the damage caused by freezing stress to Arabidopsis seedlings. Attached Figure Description

[0022] Figure 1 Image showing the results of horizontal electrophoresis on agarose gel for gene amplification;

[0023] Figure 2Construct a colony PCR detection map for the T vector;

[0024] Figure 3 Construct sequencing results diagram for T vector;

[0025] Figure 4 Image of colony PCR detection for vector construction for homologous recombination;

[0026] Figure 5 Sequencing results of vector construction for homologous recombination;

[0027] Figure 6 Colony PCR detection diagram for LR recombination vector construction;

[0028] Figure 7 Figure 1 shows the identification results of the atccoaomt mutant plants and Arabidopsis plants heterologously expressing BvCCoAOMT; (a) Arabidopsis mutant plants (atccoaomt1), (b) Arabidopsis mutant plants (atccoaomt2) identified by gene-level PCR detection; (c) Arabidopsis mutant plants (atccoaomt1 and atccoaomt2) identified by transcription-level RT-PCR detection; (d) qPCR detection of Arabidopsis heterologous overexpression and complementation BvCCoAOMT gene-positive plants, with the expression level of OE3 set to 1; (e) protein level detection; WT: Arabidopsis wild type, OE: Arabidopsis heterologous overexpression of BvCCoAOMT gene, CO: Arabidopsis heterologous complementation of BvCCoAOMT;

[0029] Figure 8 Figure 1 shows the growth indicators of transgenic Arabidopsis BvCCoAOMT plants under freezing stress; (a) phenotype, bar=2cm; (bc) biomass; (d) survival rate; (e) relative electrical conductivity; WT: wild-type Arabidopsis, OE: Arabidopsis heterologous overexpression of BvCCoAOMT gene, KO: Arabidopsis atccoaomt mutant plant, CO: Arabidopsis heterologous replacement of BvCCoAOMT gene;

[0030] Figure 9 Figure 1 shows the physiological indicators of transgenic Arabidopsis BvCCoAOMT plants under freezing stress; (ab) osmotic regulators of transgenic Arabidopsis plants under freezing stress; (cf) antioxidant enzyme activity; (gh) cold oxidative damage staining, bar=1 cm; (i) flavonoid content; (j) lignin content; (k) CCoAOMT enzyme activity; WT: wild-type Arabidopsis, OE: Arabidopsis heterologous overexpression of BvCCoAOMT gene, KO: Arabidopsis atccoaomt mutant plants, CO: Arabidopsis heterologous replacement of BvCCoAOMT gene;

[0031] Figure 10 The spatiotemporal expression pattern of BvCCoAOMT in sugar beet seedlings under freezing stress is shown in the figure. The expression level of BvCCoAOMT in sugar beet leaves (a) and roots (b) was detected by qPCR under freezing stress and after recovery from freezing stress. Detailed Implementation

[0032] Example 1. Construction of recombinant vector

[0033] 1. Gene amplification

[0034] (1) Using sugar beet variety KWS1197 as the experimental material, indoor pot cultivation was conducted. Plastic pots (11 cm high, 9 cm bottom diameter, and 10 cm mouth diameter) were used to cultivate seedlings. 400 g of soil was filled into the pot and compacted, and 20 mL of fertilizer solution (containing 0.025 g of water per mL) was added. -1 Diammonium hydrogen phosphate, 0.05 g mL -1 Ammonium dihydrogen phosphate), cover with 100 g of soil and press firmly, then evenly sow 20 beet seeds, cover with 100 g of soil and press gently. Seedlings are cultured in a light-incubator with a photosynthetically active radiation of 450 μmol / m³. -2 s -1 The seedlings were cultured under a 14-hour light / 10-hour dark environment with a relative humidity of 55 ± 5%, as shown in Table 1 below. Fifteen days after sowing, once the cotyledons were fully expanded, the seedlings were subjected to -3°C freezing stress in a low-temperature incubator (BluePard, Yiheng, China). Once the incubator temperature reached the set freezing temperature, the seedlings were transferred to the low-temperature incubator and timed for 5 hours. After this time, the seedlings were transferred to a light-controlled incubator and allowed to recover for 7 days. After 5 hours of freezing stress, leaf samples were taken, total RNA was extracted, and cDNA was synthesized via reverse transcription. Using cDNA as a template and BvCCoAOMT-F: ATGACCTCAAAGGAGTCATTTTCG (SEQ ID NO.3) and BvCCoAOMT-R: TTAATGAAGGCGCTTGCATACAAG (SEQ ID NO.4) as primers, PCR was performed using Vazyme's 2×Phanta Mater Mix high-fidelity DNA polymerase in a 50 μL system. The PCR products were analyzed by horizontal electrophoresis on a 1% agarose gel. The amplification results are shown below. Figure 1 As shown, the fragment size is as expected. The nucleotide and protein sequences of BvCCoAOMT were obtained. BvCCoAOMT nucleotide sequence: (SEQ ID NO.1); BvCCoAOMT amino acid sequence: (SEQ ID NO.2).

[0035] Table 1 Temperature conditions for seedling cultivation

[0036]

[0037] (2) T-vector construction: The agarose gel fragments were recovered to obtain the purified target DNA fragments. Using the Vazyme 5 min TA / Blunt-Zero Cloning Kit, a 5 μL system was used. The reaction system is shown in Table 2. Ligation was performed at 25 ℃ for 5 min, and all ligation products were used for E. coli transformation. After colony PCR identification using universal M13 (TGTAAAACGACGGCCAGT, SEQ ID NO.5) and BvCCoAOMT-R as primers, single colonies of the expected size were selected for sequencing. The amplified sequences were compared with the original sequences. The original CCoAOMT CDS sequence was (SEQ ID NO.8), and the original CCoAOMT protein sequence was (SEQ ID NO.9). The results are as follows: Figure 2 and 3 Sequencing results for colonies 1, 2, 5, and 6 showed a synonymous mutation at position 126 and a missense mutation at position 319, changing from GAA to AAA. The sequencing results of the four single colonies were consistent, indicating reliable results. Plasmids were extracted from the colonies with accurate sequencing results and used as inserts for subsequent homologous recombination.

[0038] Table 2 Reaction system for T-carrier construction

[0039]

[0040] (3) Homologous recombination vector construction: Homologous recombination was performed using the Vazyme ClonExpress II One Step Cloning Kit according to the product instructions. A 10 μL system was used, and the recombination reaction system is shown in Table 3. Ligation was carried out at 37 ℃ for 30 min, and all ligation products were used for E. coli transformation. Colony PCR identification was performed using primers 207F:AACGCTAGCATGGATCTCGGG (SEQ ID NO. 6) and BvCCoAOMT-R. Single colonies meeting the expected size were selected for sequencing, and the results are shown below. Figure 4 and Figure 5 .

[0041] Table 3 Recombination Reaction System

[0042]

[0043] (4) LR Recombinant Vector Construction: The pEarleyGate101-BvCCoAOMT recombinant vector was constructed using the LR recombinase from Invitrogen. The reaction system is shown in Table 4. Ligation was performed at 25℃ for 3 h, and all ligation products were used for E. coli transformation. Since vector construction via LR enzyme does not require sequencing, colony PCR identification was performed using universal 35SF (CTATCCTTCGCAAGACCCTTC, SEQ ID NO.7) and BvCCoAOMT-R as primers. Single colonies of the expected size were selected for preservation. The results are shown in Table 4. Figure 6 .

[0044] Table 4 LR Recombination Reaction System

[0045]

[0046] Example 2. Construction of transgenic plants

[0047] 1. Arabidopsis mutants: To obtain homozygous Arabidopsis mutant plants, genetic and transcriptional modifications were performed on Arabidopsis mutants. atccoaomt ( atccoaomt1: SALK_027385C atccoaomt2: The three-primer method was used for identification. The results showed that... atccoaomt1 Mutant plants 1, 2, 4, 5, and 6 are homozygous mutants. Figure 7 a) ,atccoaomt2 Mutant plants 1, 2, 3, 4, and 5 are homozygous mutants. Figure 7 b). Further identification at the transcriptional level revealed that only WT plants showed detectable levels. AtCCoAOMT (This is a homologous gene of Arabidopsis thaliana, gene number: AT4G26220, which also encodes the CCoAOMT enzyme in Arabidopsis thaliana, the same as in sugar beets. According to EnsemblPlants, the homology between this gene and the sugar beet gene is 72.7%). atccoaomt1 mutant plants 1, 2 and atccoaomt2 No mutant plants 1, 2, 3, and 4 were detected. AtCCoAOMT ( Figure 7 c) indicates that homozygous Arabidopsis thaliana was successfully obtained. atccoaomt mutant plants ， The harvested seeds will be used for subsequent experiments.

[0048] 2. Obtaining transgenic Arabidopsis thaliana: BvCCoAOMT The gene (pEarleyGate101-BvCCoAOMT recombinant vector) was heterologously expressed in Arabidopsis thaliana WT via Agrobacterium xenograft expression to obtain heterologous overexpression in Arabidopsis thaliana. BvCCoAOMT Genetic lines, BvCCoAOMT Genes were transferred into Arabidopsis mutants via heterologous expression using Agrobacterium. atccoaomt After heterologous reintroduction of the BvCCoAOMT gene into Arabidopsis thaliana lines, seeds were harvested for screening of positive plants. After spraying with herbicide three times, the transgenic plants that did not develop bleaching were transplanted into new nutrient soil and cultured until the third generation, which were then homozygous. BvCCoAOMT Transgenic Arabidopsis thaliana plants. Transcriptional levels were detected by qPCR, such as... Figure 7 As shown in d, WT plants did not express BvCCoAOMT Both the overexpression and reinjection lines in Arabidopsis thaliana were detectable. BvCCoAOMT Expression. Among the Arabidopsis overexpression lines, lines 6, 7, and 8... BvCCoAOMT The expression levels were significantly higher than those of lines 1, 2, and 3; among the Arabidopsis thaliana supplemented lines CO1, lines 1 and 6... BvCCoAOMT The expression level was significantly higher than that of lines 7 and 8; in the Arabidopsis thaliana replenished CO2 lines, all four lines... BvCCoAOMT The expression levels did not differ significantly. Additionally, protein levels were detected using Western blotting (WB), such as... Figure 7 As shown in e, WT plants did not express [the desired expression]. BvCCoAOMT Both the overexpression and reinjection lines in Arabidopsis thaliana were detectable. BvCCoAOMT Expression. Among the Arabidopsis overexpression lines, lines 6, 7, and 8... BvCCoAOMT The expression levels were significantly higher than those of lines 1, 2, and 3; among the Arabidopsis thaliana supplemented lines CO1, lines 1 and 6... BvCCoAOMT The expression levels were significantly higher than those of lines 7 and 8; among the Arabidopsis thaliana supplemented CO2 lines, lines 2 and 5... BvCCoAOMT The expression level was significantly higher than that of samples 4 and 7. Therefore, based on the combined results of transcriptional and protein level detection, [sample 1] was selected. BvCCoAOMT The transgenic Arabidopsis positive lines OE6, OE8, CO1-1, CO1-6, CO2-5, and CO2-7 were used for subsequent experiments.

[0049] 3. Gene function identification: To investigate beet caffeoyl coenzyme AO-methyltransferase BvCCoAOMT The spatiotemporal expression patterns of genes were determined by qPCR detection at different time points under freezing stress (unfrozen, frozen for 3 h, and recovered from freezing stress for 7 d) and in different sugar beet tissues (roots and leaves). 。 The results are as follows Figure 10 As shown, under freezing stress (minus 3 degrees Celsius), the leaves of frost-resistant beet varieties... BvCCoAOMT Expression levels increased rapidly in the leaves of freeze-sensitive varieties. BvCCoAOMT The expression level did not increase significantly. Seven days after recovery from freezing stress, the expression level in the leaves of frost-resistant beet varieties... BvCCoAOMT Expression levels remained high, significantly higher than in freeze-sensitive varieties. However, under freeze stress and after recovery, the expression levels in beet roots of both freeze-resistant and freeze-sensitive varieties remained relatively high. BvCCoAOMT The expression level was low, and there were no significant differences among varieties.

[0050] For identification BvCCoAOMT Regulatory function of Arabidopsis thaliana seedlings against frost resistance, and the effect of 15-day wild-type Arabidopsis thaliana and Arabidopsis thaliana xenologian overexpression. BvCCoAOMT Gene lines, Arabidopsis mutants, and Arabidopsis xenologia replacement BvCCoAOMT Genetic line seedlings were subjected to freezing stress treatment. Results showed that under freezing stress, all Arabidopsis seedlings suffered varying degrees of freezing damage. The plants were significantly weaker than those not subjected to freezing stress, with wrinkled, chlorotic, and yellowing leaves; severely damaged plants died. Figure 8 (a) The study of Arabidopsis mutant plants and Arabidopsis heterologous replacement plants aims to demonstrate that the freeze resistance of mutant plants under freezing stress is lower than that of wild-type plants, while the freeze resistance of Arabidopsis heterologous replacement plants can be restored, thus providing reverse verification of the gene function of BvCCoAOMT. Biomass measurements showed that under freezing stress, atccoaomt The biomass of mutant plants KO1 and KO2 was significantly lower than that of WT plants, indicating that Arabidopsis heterologous replacement was necessary. BvCCoAOMT The biomass of the gene-expressing lines was not significantly different from that of WT plants; overexpression BvCCoAOMT The biomass of the genetically modified line was significantly higher than that of the WT plant. Figure 8 (b, c) . The results indicate that heterologous expression BvCCoAOMT The gene mitigated the damage caused by freezing stress to Arabidopsis plants. Statistics on seedling survival rates under freezing stress revealed... atccoaomt The survival rate of mutant plants KO1 and KO2 seedlings was significantly lower than that of WT plants, indicating that Arabidopsis heterologous replacement... BvCCoAOMT Seedling survival rate of the gene line was not significantly different from that of WT plants; Arabidopsis heterologous overexpression BvCCoAOMT The survival rate of the genetically modified lines was significantly higher than that of the WT plants. Figure 8 (d) In addition, under freezing stress, atccoaomt The relative electrical conductivity of mutant plants KO1 (48.91%) and KO2 (38.32%) was significantly higher than that of WT plants; Arabidopsis heterologous replacement BvCCoAOMT The relative conductivity of the gene line is relatively high atccoaomt The mutant plants showed a significant reduction in size, with no significant difference compared to the WT plants; Arabidopsis heterologous overexpression BvCCoAOMT The relative electrical conductivity of the OE6 and OE8 lines was significantly lower than that of the WT plants. The relative electrical conductivity of the OE6 and OE8 lines was reduced by 14.46% and 14.87% respectively compared with the WT plants. Figure 8 (e). The results indicate that heterologous expression BvCCoAOMTThe gene alleviated the damage caused by freezing stress to Arabidopsis seedlings, improving seedling survival rate and reducing relative conductivity. Relative conductivity is an indicator of the degree of membrane damage. The higher the relative conductivity, the more severe the cell membrane damage. Under low-temperature freezing, the lower this indicator, the less damage the plant suffers and the stronger its freeze resistance. This indicates that the degree of cell membrane damage in Arabidopsis lines heterologously overexpressing the BvCCoAOMT gene is lower than that at WT, suggesting that the BvCCoAOMT gene improves freeze resistance.

[0051] Under freezing stress, plants reduce osmotic potential by accumulating osmotic regulating substances. The results of this study indicate that, compared to total osmotic stress (WT), atccoaomt The soluble protein content of KO1 and KO2 mutant plants was significantly reduced by 49.95% and 46.87%, respectively. atccoaomt The soluble sugar content of mutant plants KO1 and KO2 was significantly reduced by 33.09% and 35.58%, respectively, indicating that Arabidopsis thaliana heterologous replenishment... BvCCoAOMT The soluble sugar content of the gene-expressing lines was not significantly different from that of WT plants; overexpression BvCCoAOMT The osmotic regulatory substances in the OE6 and OE8 strains were significantly higher than those in the WT strains. The soluble protein content of the OE6 and OE8 strains was 16.58% and 15.62% higher than that of the WT strains, respectively, and the soluble sugar content of the OE6 and OE8 strains was 68.08% higher than that of the WT strains. Figure 9 (ab in the text). The results showed that heterologous overexpression and complementation BvCCoAOMT The gene enhanced the accumulation of osmotic substances in Arabidopsis plants. When plants suffer from abiotic stress, they accumulate osmotic regulators to resist external stress and maintain their survival and growth under stress. Under low-temperature freezing, the higher the content of osmotic regulators, the stronger the plant's ability to resist low-temperature freezing. The osmotic regulator content of the BvCCoAOMT gene-overexpressing lines was significantly higher than that of WT plants, indicating that overexpression of BvCCoAOMT improved the freeze resistance of Arabidopsis.

[0052] To analyze heterologous overexpression and complementation under freezing stress BvCCoAOMT The regulation of reactive oxygen species (ROS) accumulation in Arabidopsis seedlings by genes was investigated, and oxidative damage staining was performed on Arabidopsis seedlings. The results showed that... atccoaomt The mutant plants KO1 and KO2 accumulated more H2O2 and O2 than the WT plants. - Arabidopsis heterologous replenishment BvCCoAOMT Genetic lines H2O2 and O2 - Accumulated less atccoaomt mutant plants, overexpression BvCCoAOMT Genetic lines H2O2 and O2 - Accumulation of less than WT plants ( Figure 9 (gh in the text). The results show that, BvCCoAOMTGenetically modified organisms (GMOs) can reduce ROS accumulation in Arabidopsis plants. Increased activity of antioxidant enzymes is an effective means of scavenging excess ROS. atccoaomt The KO1 and KO2 antioxidant enzyme activities in mutant plants were significantly lower than those in WT plants, indicating that Arabidopsis heterologous replacement therapy was effective. BvCCoAOMT The antioxidant enzyme activity of the gene line was not significantly different from that of the WT plant; overexpression BvCCoAOMT The antioxidant enzyme activities of the gene-derived lines were significantly higher than those of the WT plants, with the APX enzyme activity of the OE6 line being significantly higher than that of the OE8 line. Figure 9 (cf). The results showed that heterologous expression BvCCoAOMT The gene enhanced the ROS scavenging ability of Arabidopsis plants.

[0053] To analyze heterologous overexpression and complementation under freezing stress BvCCoAOMT The gene regulates the activity of CCoAOMT enzyme and the accumulation of flavonoids and lignin involved in its synthesis in Arabidopsis seedlings. The activity of CCoAOMT enzyme and the content of flavonoids and lignin were measured. The results showed that... atccoaomt The CCoAOMT enzyme activity of mutant plants was significantly lower than that of WT plants, with KO1 and KO2 lines showing 52.70% and 63.40% lower activity, respectively, compared to WT plants; Arabidopsis heterologous replacement BvCCoAOMT The activity of the CCoAOMT enzyme in the gene line was not significantly different from that in the WT plant; overexpression BvCCoAOMT The activity of the CCoAOMT enzyme in the gene line was significantly higher than that in the WT plant, being 2.3 to 2.4 times that of the WT plant. Figure 9 (k in the text). Additionally... atccoaomt The flavonoid and lignin contents of the mutant plants KO1 and KO2 were significantly lower than those of the WT plants. The flavonoid contents of KO1 and KO2 plants were 19.16% and 29.13% lower than those of the WT plants, respectively, while the lignin content of the WT plants was 3.17 times that of the mutant plants. This indicates that the Arabidopsis thaliana heterologous replacement therapy... BvCCoAOMT The flavonoid and lignin contents of the gene-based lines were not significantly different from those of the WT plants; overexpression BvCCoAOMT The flavonoid and lignin contents of the gene-based strains were significantly higher than those of the WT plants. Figure 9 The flavonoid content of the OE6 and OE8 lines was 55.35% and 55.70% higher than that of the WT plants, respectively, and the lignin content of the OE6 and OE8 lines was 41.16% and 45.84% higher than that of the WT plants, respectively. The results indicate that... BvCCoAOMT Transgenic technology can significantly increase the activity of CCoAOMT enzyme in Arabidopsis thaliana plants and promote the synthesis of flavonoids and lignin.

Claims

1. The application of BvCCoAOMT protein in improving the freezing resistance or antioxidant capacity of Arabidopsis thaliana, characterized in that, The amino acid sequence of the BvCCoAOMT protein is shown in SEQ ID NO.

2.

2. The application of the BvCCoAOMT gene in improving the freezing resistance or antioxidant capacity of Arabidopsis thaliana, characterized in that... The nucleotide sequence of the BvCCoAOMT gene is shown in SEQ ID NO.

1.

3. The application of recombinant vectors containing the BvCCoAOMT gene in improving the freezing resistance or antioxidant capacity of Arabidopsis thaliana, characterized in that... The nucleotide sequence of the BvCCoAOMT gene is shown in SEQ ID NO.

1.

4. The application of recombinant microbial cells containing the BvCCoAOMT gene in improving the freezing resistance or antioxidant capacity of Arabidopsis thaliana, characterized in that, The nucleotide sequence of the BvCCoAOMT gene is shown in SEQ ID NO.

1.

5. The application according to any one of claims 1-3, characterized in that, The freezing condition is -3 degrees Celsius.

6. The application according to any one of claims 1-3, characterized in that, Applications also include improving relative conductivity and accumulating osmotic conditioning substances.

7. A breeding method for improving the freezing resistance or antioxidant capacity of Arabidopsis thaliana, characterized in that, The specific steps of the breeding process are as follows: Step 1: The BvCCoAOMT gene was ligated to an overexpression vector to obtain a recombinant vector; the nucleotide sequence of the BvCCoAOMT gene is shown in SEQ ID NO.1; Step 2: Transform the recombinant vector obtained in Step 1 into Agrobacterium to obtain recombinant Agrobacterium; Step 3: Transfect the recombinant Agrobacterium obtained in Step 2 into Arabidopsis thaliana to obtain transgenic plants.

Images